CN111944790B - Neutral protease gene, neutral protease, preparation method and application thereof - Google Patents
Neutral protease gene, neutral protease, preparation method and application thereof Download PDFInfo
- Publication number
- CN111944790B CN111944790B CN202010619037.8A CN202010619037A CN111944790B CN 111944790 B CN111944790 B CN 111944790B CN 202010619037 A CN202010619037 A CN 202010619037A CN 111944790 B CN111944790 B CN 111944790B
- Authority
- CN
- China
- Prior art keywords
- neutral protease
- gly
- ala
- val
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Abstract
The invention belongs to the technical field of genetic engineering, and particularly relates to a neutral protease gene, a neutral protease, and preparation methods and applications thereof. The nucleotide sequence of the neutral protease gene is shown as SEQ ID NO. 1, and the coded amino acid sequence is shown as SEQ ID NO. 2. According to the invention, through mutating 422 th amino acid and 433 th amino acid of neutral protease Np into cysteine, a disulfide bond can be formed, so that the thermal stability of the obtained neutral protease is obviously improved, and the neutral protease has a wider application prospect.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a neutral protease gene, a corresponding recombinant expression vector, a recombinant expression strain, a neutral protease, a preparation method and an application thereof.
Background
Protease is a kind of enzyme catalyzing protein hydrolysis, and the protease is widely applied to the fields of feed processing, brewing, washing, food processing and the like as an important industrial enzyme preparation. The protease is widely distributed, the protease on the market at present mainly comes from microorganisms, and compared with animals and plants, the microbial protease has wide pH value range and low production cost. Proteases can be classified into acid proteases, neutral proteases and alkaline proteases according to the optimal pH environment for microbial protease reaction. The neutral protease is an enzyme for hydrolyzing proteins under neutral conditions, and at present, the neutral protease is mainly derived from microorganisms such as bacillus, aspergillus and the like.
The Bacillus stearothermophilus neutral protease (Np for short) has good decomposition effect on different protein raw materials, and the heat stability of the Np is better than that of the Bacillus subtilis neutral protease and the Bacillus amyloliquefaciens neutral protease (after the Bacillus subtilis neutral protease is treated for 5 minutes at 70 ℃, the residual enzyme activity is lower than 10 percent, and the residual enzyme activity of the Np is higher than 60 percent). However, when the heat treatment temperature is increased to 80 ℃, Np is easily denatured and inactivated (the residual enzyme activity of Np is 18% when heat treatment is carried out at 80 ℃ for 3 minutes).
Disclosure of Invention
The invention aims to provide a neutral protease gene, a corresponding recombinant expression vector, a recombinant expression strain, a neutral protease, a preparation method and an application thereof, and aims to solve the technical problem of insufficient thermal stability of the existing neutral protease.
In order to achieve the purpose of the invention, the technical scheme adopted by the invention is as follows:
one aspect of the invention provides a neutral protease gene, the nucleotide sequence of which is shown in SEQ ID NO. 1.
In another aspect, the invention provides a neutral protease, the amino acid sequence of which is shown in SEQ ID NO. 2.
In still another aspect, the present invention provides a recombinant expression vector comprising the neutral protease gene.
In still another aspect, the present invention provides a recombinant expression strain comprising the recombinant expression vector described above.
In a further aspect, the present invention provides a method for preparing a neutral protease, comprising the steps of:
providing a nucleotide sequence, an expression vector and an expression strain of the neutral protease of the bacillus stearothermophilus;
connecting the nucleotide sequence of the neutral protease of the bacillus stearothermophilus with the expression vector, and amplifying by using an amplification primer to obtain a recombinant expression vector containing a neutral protease gene;
transferring the recombinant expression vector into an expression strain to obtain a recombinant expression strain;
culturing the recombinant expression strain to obtain the neutral protease;
wherein, the nucleotide sequence of the neutral protease gene is shown as SEQ ID NO. 1, and the nucleotide sequence of the amplification primer is shown as SEQ ID NO. 3-6.
In a final aspect of the present invention, there is provided use of the neutral protease or the neutral protease prepared by the method for preparing the neutral protease in hydrolyzing protein.
In the amino acid sequence coded by the neutral protease gene provided by the invention, the 422 th amino acid and the 433 th amino acid are cysteine, and sulfydryl on the two cysteine forms a disulfide bond. Because the disulfide bond has the function of stabilizing the spatial structure of a peptide chain, the neutral protease gene provided by the invention has higher stability compared with neutral protease Np by changing the 422 th amino acid site and the 433 th amino acid site of the code of the neutral protease gene, and the thermal stability in a high-temperature environment is obviously improved.
The neutral protease provided by the invention is a mutant of neutral protease Np, and compared with the neutral protease Np, the amino acid sequence of the neutral protease is that both the 422 th amino acid and the 433 th amino acid are cysteine, and the sulfydryl on the two cysteine forms a disulfide bond, so that the neutral protease provided by the invention has higher stability compared with the neutral protease Np. According to experimental detection, the enzyme activity retention rates of the neutral protease provided by the invention after heat treatment for 3min at 80 ℃ and 85 ℃ are respectively improved by 3.1 times and 69 times compared with that of the neutral protease Np, and the neutral protease has a wider application prospect.
The recombinant expression vector provided by the invention comprises the neutral protease gene, and because the amino acid sequence coded by the neutral protease gene has higher thermal stability compared with that of neutral protease Np, the recombinant expression vector comprising the neutral protease gene also contributes to obtaining the neutral protease with higher thermal stability.
The recombinant expression strain provided by the invention comprises the recombinant expression vector and the recombinant expression vector comprises the neutral protease gene, and the recombinant expression strain can be used for expressing the neutral protease with higher thermal stability.
In the preparation method of the neutral protease, the nucleotide sequence of the neutral protease Np of the bacillus stearothermophilus is connected with an expression vector, the connected nucleotide sequence is taken as a template, amplification is carried out through an amplification primer, a corresponding recombinant expression vector and a corresponding recombinant expression strain are obtained, and the neutral protease is obtained through culture. Wherein, the nucleotide sequences after connection are amplified by the amplification primer pair, the encoded 422 th amino acid and the encoded 433 th amino acid in the sequence of the amplification product are cysteine, and the sulfydryl on the two cysteine forms a disulfide bond, so that the amino acid sequence of the obtained neutral protease 414 KNPDWEIGEDVYTPGISGDSLRSMSD 439 The amino acid space structure of (A) is not easy to be damaged under the high temperature condition, and then the heat stability of the obtained neutral protease is improved.
The neutral protease or the neutral protease prepared by the preparation method of the neutral protease can be used in the field of protein hydrolysis, has good enzyme activity retention rate even if being treated under high temperature, and has the advantage of high efficiency.
Drawings
FIG. 1 is a three-dimensional structure diagram of the protein of neutral protease Np, wherein the black thin line in the middle of the right side is the flexible region from the 414 th to the 439 th;
FIG. 2 is a graph showing the comparison of the optimum reaction temperatures of the neutral protease and the neutral protease Np obtained in Experimental example 1 of the present invention;
FIG. 3 is a graph showing the comparison of the thermal stability of the neutral protease obtained in Experimental example 2 of the present invention and that of the neutral protease Np.
Detailed Description
In order to make the objects, technical solutions and technical effects of the embodiments of the present invention clearer and more completely describe the technical solutions in the embodiments of the present invention, the embodiments described below are a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments obtained by a person of ordinary skill in the art without any inventive step in connection with the embodiments of the present invention shall fall within the scope of protection of the present invention. Those whose specific conditions are not specified in the examples are carried out according to conventional conditions or conditions recommended by the manufacturer; the reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
In the description of the present invention, the term "and/or" describing an association relationship of associated objects means that there may be three relationships, for example, a and/or B, may mean: a is present alone, A and B are present simultaneously, and B is present alone. Wherein A and B can be singular or plural. The character "/" generally indicates that the former and latter associated objects are in an "or" relationship.
It should be understood that the weight of the related components mentioned in the embodiments of the present invention may not only refer to the specific content of each component, but also represent the proportional relationship of the weight among the components, and therefore, it is within the scope of the disclosure that the content of the related components is scaled up or down according to the embodiments of the present invention. Specifically, the weight described in the embodiments of the present invention may be a unit of mass known in the chemical field such as μ g, mg, g, kg, etc.
In addition, unless the context clearly uses otherwise, an expression of a word in the singular is to be understood as including the plural of the word. The terms "comprises" or "comprising" are intended to specify the presence of stated features, quantities, steps, operations, elements, portions, or combinations thereof, but are not intended to preclude the presence or addition of one or more other features, quantities, steps, operations, elements, portions, or combinations thereof.
It should be noted that the molecular biology experimental methods not specifically described in the examples of the present invention are all performed according to the specific methods listed in "molecular cloning experimental manual" (third edition) j. sambrook, or according to the kit and product instructions; related reagents and biomaterials, if not specifically stated, are commercially available.
The embodiment of the invention provides a neutral protease gene, and the nucleotide sequence of the neutral protease gene is shown in SEQ ID NO. 1.
Nucleotide sequence of neutral protease gene (SEQ ID NO: 1):
atgaaaatgaaaatgaaacttgcttctttcggccttgctgctggccttgctgctcaagttttccttccttacaacgctcttgcttctacagaacatgttacatggaaccaacaattccaaacacctcaattcatctctggcgatcttcttaaagttaacggcacatctcctgaagaacttgtttaccaatacgttgaaaaaaacgaaaacaaattcaaattccatgaaaacgctaaagatacacttcaacttaaagaaaaaaaaaacgataaccttggcttcacattcatgcgtttccaacaaacatacaaaggcatccctgttttcggcgctgttgttacatctcatgttaaagatggcacacttacagctctttctggcacacttatccctaaccttgatacaaaaggctctcttaaatctggcaaaaaactttctgaaaaacaagctcgtgatatcgctgaaaaagatcttgttgctaacgttacaaaagaagttcctgaatacgaacaaggcaaagatacagaattcgttgtttacgttaacggcgatgaagcttctcttgcttacgttgttaaccttaacttccttacacctgaacctggcaactggctttacatcatcgatgctgttgatggcaaaatccttaacaaattcaaccaacttgatgctgctaaacctggcgatgttaaatctatcacaggcacatctacagttggcgttggccgtggcgttcttggcgatcaaaaaaacatcaacacaacatactctacatactactaccttcaagataacacacgtggcaacggcatcttcacatacgatgctaaataccgtacaacacttcctggctctctttgggctgatgctgataaccaattcttcgcttcttacgatgctcctgctgttgatgctcattactacgctggcgttacatacgattactacaaaaacgttcataaccgtctttcttacgatggcaacaacgctgctatccgttcttctgttcattactctcaaggctacaacaacgctttctggaacggctctcaaatggtttacggcgatggcgatggccaaacattcatccctctttctggcggcatcgatgttgttgctcatgaacttacacatgctgttacagattacacagctggccttatctaccaaaacgaatctggcgctatcaacgaagctatgtctgatatcttcggcacacttgttaaattctacgctaacaaaaaccctgattgggaaatcggctgtgatgtttacacacctggcatctctggcgattgtcttcgttctatgtctgatcctgctaaatacggcgatcctgatcattactctaaacgttacacaggcacacaagataacggcggcgttcatatcaactctggcatcatcaacaaagctgcttaccttatctctcaaggcggcacacattacggcgtttctgttgttggcatcggccgtgataaacttggcaaaatcttctaccgtgctcttacacaataccttacacctacatctaacttctctcaacttcgtgctgctgctgttcaatctgctacagatctttacggctctacatctcaagaagttgcttctgttaaacaagctttcgatgctgttggcgttaaataa
in the amino acid sequence encoded by the neutral protease gene provided by the embodiment of the invention, the 422 th amino acid and the 433 th amino acid are cysteine, and sulfydryl on the two cysteine forms a disulfide bond. Because the disulfide bond has the function of stabilizing the spatial structure of the peptide chain, the neutral protease gene provided by the embodiment of the invention has higher stability compared with neutral protease Np by changing the 422 th amino acid site and the 433 th amino acid site coded by the neutral protease gene, and the thermal stability under a high-temperature environment is obviously improved.
Correspondingly, the embodiment of the invention also provides a neutral protease, and the amino acid sequence of the neutral protease is shown as SEQ ID NO. 2.
Amino acid sequence of neutral protease (SEQ ID NO: 2):
MKMKMKLASFGLAAGLAAQVFLPYNALASTEHVTWNQQFQTPQFISGDLLKVNGTSPEELVYQYVEKNENKFKFHENAKDTLQLKEKKNDNLGFTFMRFQQTYKGIPVFGAVVTSHVKDGTLTALSGTLIPNLDTKGSLKSGKKLSEKQARDIAEKDLVANVTKEVPEYEQGKDTEFVVYVNGDEASLAYVVNLNFLTPEPGNWLYIIDAVDGKILNKFNQLDAAKPGDVKSITGTSTVGVGRGVLGDQKNINTTYSTYYYLQDNTRGNGIFTYDAKYRTTLPGSLWADADNQFFASYDAPAVDAHYYAGVTYDYYKNVHNRLSYDGNNAAIRSSVHYSQGYNNAFWNGSQMVYGDGDGQTFIPLSGGIDVVAHELTHAVTDYTAGLIYQNESGAINEAMSDIFGTLVKFYANKNPDWEIGCDVYTPGISGDCLRSMSDPAKYGDPDHYSKRYTGTQDNGGVHINSGIINKAAYLISQGGTHYGVSVVGIGRDKLGKIFYRALTQYLTPTSNFSQLRAAAVQSATDLYGSTSQEVASVKQAFDAVGVK
the neutral protease provided by the embodiment of the invention is a mutant of neutral protease Np, and compared with the neutral protease Np, the amino acid sequence of the neutral protease is that the 422 th amino acid and the 433 th amino acid are cysteine, and the sulfhydryl on the two cysteine forms a disulfide bond, so that the neutral protease provided by the embodiment of the invention has higher stability compared with the neutral protease Np. According to experimental detection, the enzyme activity retention rates of the neutral protease provided by the embodiment of the invention after heat treatment for 3min at 80 ℃ and 85 ℃ are respectively improved by 3.1 times and 69 times compared with that of the neutral protease Np, and the neutral protease has a wider application prospect.
Correspondingly, the embodiment of the invention also provides a recombinant expression vector, which comprises the neutral protease gene.
The recombinant expression vector provided by the embodiment of the invention comprises the neutral protease gene, and because the amino acid sequence coded by the neutral protease gene has higher thermal stability compared with that of neutral protease Np, the recombinant expression vector comprising the neutral protease gene provided by the embodiment of the invention also contributes to obtaining the neutral protease with higher thermal stability.
Correspondingly, the embodiment of the invention also provides a recombinant expression strain, which comprises the recombinant expression vector.
The recombinant expression strain provided by the embodiment of the invention comprises the recombinant expression vector, and the recombinant expression vector comprises the neutral protease gene.
Correspondingly, the embodiment of the invention also provides a preparation method of the neutral protease, which comprises the following steps:
s1, providing a nucleotide sequence, an expression vector and an expression strain of the neutral protease of the bacillus stearothermophilus;
s2, connecting the nucleotide sequence of the neutral protease of the bacillus stearothermophilus with an expression vector, and amplifying by using an amplification primer to obtain a recombinant expression vector containing the neutral protease gene;
s3, transferring the recombinant expression vector into an expression strain to obtain a recombinant expression strain;
s4, culturing the recombinant expression strain to obtain neutral protease;
wherein, the nucleotide sequence of the neutral protease gene is shown as SEQ ID NO. l, and the nucleotide sequence of the amplification primer is shown as SEQ ID NO. 3-6.
Nucleotide sequence of primer S433C-F (SEQ ID NO: 3):
tctggcgattgtcttcgttct
nucleotide sequence of primer S433C-R (SEQ ID NO: 4):
agaacgaagacaatcgccaga
nucleotide sequence of primer E422C-F (SEQ ID NO: 5):
ggaaatcggctgcgatgttt
nucleotide sequence of primer E422C-R (SEQ ID NO: 6):
aaacatcgcagccgatttcc
in the preparation method of the neutral protease provided by the embodiment of the invention, after the nucleotide sequence of the neutral protease Np of the bacillus stearothermophilus is connected with an expression vector, the connected nucleotide sequence is taken as a template, an amplification primer is used for amplification to obtain a corresponding recombinant expression vector and a corresponding recombinant expression strain, and the neutral protease is obtained by culturing. Wherein, the nucleotide sequences after connection are amplified by the amplification primer pair, the encoded 422 th amino acid and the encoded 433 th amino acid in the amplification product sequence are cysteines, and sulfydryl groups on the two cysteines form a disulfide bond, so that the amino acid sequence of the obtained neutral protease is 414 KNPDWEIGEDVYTPGISGDSLRSMSD 439 The amino acid space structure of (A) is not easy to be damaged under the high temperature condition, and then the heat stability of the obtained neutral protease is improved.
Specifically, in S1, the nucleotide sequence of the Bacillus stearothermophilus neutral protease Np (neutral protease Np for short) is obtained by NCBI website query, the GenBank number is X76986.1, the sequence has a full length of 1647bp, encodes 548 amino acids, and consists of three parts, namely a signal peptide, a leader peptide and a mature peptide. Wherein, the first 28 amino acids of the N end of the protein are signal peptides, and the middle 204 amino acids are leader peptides. In some embodiments, in order to increase the expression amount of the neutral protease gene in bacillus subtilis, the gene sequence of the neutral protease Np is optimized and modified by referring to the codon preference of bacillus subtilis, and the neutral protease gene Np is synthesized from the whole gene, and the sequence of the neutral protease gene Np is shown as SEQ ID NO: 7.
Nucleotide sequence of neutral protease gene np (SEQ ID NO: 7):
atgaaaatgaaaatgaaacttgcttctttcggccttgctgctggccttgctgctcaagttttccttccttacaacgctcttgcttctacagaacatgttacatggaaccaacaattccaaacacctcaattcatctctggcgatcttcttaaagttaacggcacatctcctgaagaacttgtttaccaatacgttgaaaaaaacgaaaacaaattcaaattccatgaaaacgctaaagatacacttcaacttaaagaaaaaaaaaacgataaccttggcttcacattcatgcgtttccaacaaacatacaaaggcatccctgttttcggcgctgttgttacatctcatgttaaagatggcacacttacagctctttctggcacacttatccctaaccttgatacaaaaggctctcttaaatctggcaaaaaactttctgaaaaacaagctcgtgatatcgctgaaaaagatcttgttgctaacgttacaaaagaagttcctgaatacgaacaaggcaaagatacagaattcgttgtttacgttaacggcgatgaagcttctcttgcttacgttgttaaccttaacttccttacacctgaacctggcaactggctttacatcatcgatgctgttgatggcaaaatccttaacaaattcaaccaacttgatgctgctaaacctggcgatgttaaatctatcacaggcacatctacagttggcgttggccgtggcgttcttggcgatcaaaaaaacatcaacacaacatactctacatactactaccttcaagataacacacgtggcaacggcatcttcacatacgatgctaaataccgtacaacacttcctggctctctttgggctgatgctgataaccaattcttcgcttcttacgatgctcctgctgttgatgctcattactacgctggcgttacatacgattactacaaaaacgttcataaccgtctttcttacgatggcaacaacgctgctatccgttcttctgttcattactctcaaggctacaacaacgctttctggaacggctctcaaatggtttacggcgatggcgatggccaaacattcatccctctttctggcggcatcgatgttgttgctcatgaacttacacatgctgttacagattacacagctggccttatctaccaaaacgaatctggcgctatcaacgaagctatgtctgatatcttcggcacacttgttaaattctacgctaacaaaaaccctgattgggaaatcggcgaagatgtttacacacctggcatctctggcgattctcttcgttctatgtctgatcctgctaaatacggcgatcctgatcattactctaaacgttacacaggcacacaagataacggcggcgttcatatcaactctggcatcatcaacaaagctgcttaccttatctctcaaggcggcacacattacggcgtttctgttgttggcatcggccgtgataaacttggcaaaatcttctaccgtgctcttacacaataccttacacctacatctaacttctctcaacttcgtgctgctgctgttcaatctgctacagatctttacggctctacatctcaagaagttgcttctgttaaacaagctttcgatgctgttggcgttaaataa
the amino acid sequence coded by the neutral protease gene np is shown as SEQ ID NO. 8.
The amino acid sequence encoded by the neutral protease gene np (SEQ ID NO: 8):
MKMKMKLASFGLAAGLAAQVFLPYNALASTEHVTWNQQFQTPQFISGDLLKVNGTSPEELVYQYVEKNENKFKFHENAKDTLQLKEKKNDNLGFTFMRFQQTYKGIPVFGAVVTSHVKDGTLTALSGTLIPNLDTKGSLKSGKKLSEKQARDIAEKDLVANVTKEVPEYEQGKDTEFVVYVNGDEASLAYVVNLNFLTPEPGNWLYIIDAVDGKILNKFNQLDAAKPGDVKSITGTSTVGVGRGVLGDQKNINTTYSTYYYLQDNTRGNGIFTYDAKYRTTLPGSLWADADNQFFASYDAPAVDAHYYAGVTYDYYKNVHNRLSYDGNNAAIRSSVHYSQGYNNAFWNGSQMVYGDGDGQTFIPLSGGIDVVAHELTHAVTDYTAGLIYQNESGAINEAMSDIFGTLVKFYANKNPDWEIGEDVYTPGISGDSLRSMSDPAKYGDPDHYSKRYTGTQDNGGVHINSGIINKAAYLISQGGTHYGVSVVGIGRDKLGKIFYRALTQYLTPTSNFSQLRAAAVQSATDLYGSTSQEVASVKQAFDAVGVK
the expression vector is used for constructing a recombinant expression vector for expressing the neutral protease gene shown as SEQ ID NO. 1 in the embodiment of the invention. In some embodiments, pBEs is selected as the expression vector, the pBEs expression vector exists in Bacillus subtilis in a multi-copy form, and the length of the vector is 5938bp, so that PCR amplification and expression vector modification are facilitated.
Expression strains, used in the examples of the present invention to construct recombinant expression strains. In some embodiments, bacillus subtilis is selected as the expression strain. The bacillus subtilis is used as a food-grade expression host, and has the advantages of clear genetic background, simple molecular operation, easy high-density fermentation and the like.
In S2, the neutral protease gene Np or neutral protease Np is connected (preferably connected with neutral protease Np modified by codon optimization), and the connected sequence is used as a template to be amplified through an amplification primer, so that a recombinant expression vector can be constructed to express the neutral protease gene shown as SEQ ID NO: 1.
Wherein the nucleotide sequences of amplification primers S433C-F, S433C-R, E422C-F and E422C-R are sequentially shown as SEQ ID NO:3-6, and the amplification primers are used for amplifying the nucleotide sequences of mutants encoding neutral protease Np. Before designing the amplification primers, it is first clear which way to improve the thermostability of the neutral protease mutants. The embodiment of the invention discovers that the protein has three-dimensional structure and molecular dynamics simulation analysis on neutral protease Np 414 KNPDWEIGEDVYTPGISGDSLRSMSD 439 The amino acid fragment has high degree of freedom and belongs to flexible region, and the amino acid space structure of the part is easily destroyed when heating, so that neutral protease Np is inactivated byImproving the rigidity of the part of amino acid fragments is beneficial to improving the stability of the obtained neutral protease mutant. In the embodiment of the invention, by designing the amino acid sites of the disulfide bonds and designing amplification primers according to the nucleotide sequences encoding the sites, the amplification primers S433C-F, S433C-R, E422C-F and E422C-R are finally obtained. In addition, since there are two pairs of amplification primers, in actual amplification, a first amplification can be performed using one of the primers, and then a second amplification can be performed using the other primer pair using the obtained amplified sequence as a template, thereby finally obtaining a nucleotide sequence encoding a mutant of neutral protease Np.
And S3, transferring the obtained recombinant expression vector into an expression strain to obtain the recombinant expression strain. The embodiment of the invention has no special requirements on the specific construction method of the recombinant expression strain, and the conventional method in the field can be adopted.
In S4, the nucleotide sequence of the mutant of neutral protease Np is replicated along with the reproduction of the recombinant expression strain by culturing the recombinant expression strain, and then the culture of the recombinant expression strain is collected, separated and purified to obtain the neutral protease. In some embodiments, the recombinant expression strain is cultured by: the recombinant expression strain is inoculated into an LB culture medium to be cultured for 24 hours under the conditions of 37 ℃ and 200rpm, and then is inoculated into a maltose culture medium to be cultured for 48 hours under the conditions of 37 ℃ and 200 rpm.
The neutral protease provided by the embodiment of the invention can be used as a mutant of neutral protease Np and can be applied to the field of protein hydrolysis. The neutral protease has good thermal stability, so that the neutral protease has the advantages of good enzyme activity retention rate and high efficiency even if the neutral protease is treated under high-temperature conditions when hydrolyzing proteins.
In some embodiments, the neutral protease provided in the embodiments of the present invention has a reaction temperature of 40 ℃ to 80 ℃ and an optimal reaction temperature of 65 ℃ in the protein hydrolysis reaction. When the neutral protease provided by the embodiment of the invention hydrolyzes protein within the temperature range of 60-80 ℃, the relative enzyme activity is more than 60%; when the reaction temperature is 65 ℃, the relative enzyme activity reaches up to 100 percent.
In order to make the above implementation details and operations of the present invention clearly understood by those skilled in the art and to make the progress of the neutral protease gene and neutral protease, and the preparation method and application thereof remarkably apparent in the examples of the present invention, the above technical solutions are illustrated by examples below.
Experimental materials and reagents referred to in the following examples:
bacterial strain and carrier: escherichia coli strain Top10, Bacillus subtilis 1285, and expression vector pBE-s were all obtained from commercial sources.
Enzyme and kit: q5 high fidelity Taq enzyme MIX was purchased from NEB; the plasmid extraction and gel purification kit is purchased from Tiangen Biotechnology (Beijing) Co., Ltd; restriction enzymes were purchased from Baori physician technology (Beijing) Ltd.
Culture medium: the E.coli medium was LB (1% (w/v) peptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCl, pH 7.0). Ampicillin was added to LB medium at a concentration of 25. mu.g/mL for LBA, and kanamycin was added to LB medium at a concentration of 50. mu.g/mL for LBK.
The bacillus subtilis culture medium comprises the following components: 2% (w/v) maltose, 1.5% (w/v) soybean meal, 0.5% (w/v) bran, 0.5% (w/v) dipotassium hydrogen phosphate.
Example 1
The embodiment provides a preparation method of neutral protease, which comprises the following steps:
1. neutral protease Np expression vector construction
The neutral protease Np gene (Genebank: X76986.1) reported by NCBI website is analyzed, and the total length of the Np neutral protease gene is 1647bp, and the gene codes 548 amino acids and consists of a signal peptide, a leader peptide and a mature peptide, wherein the first 28 amino acids at the N end of the protein are the signal peptide, and the middle 204 amino acids are the leader peptide. According to the Np gene sequence, the protease gene Np is synthesized by the whole gene according to the codon preference of the bacillus subtilis, and the sequence of the synthesized protease gene Np is shown as SEQ ID NO. 7.
The construction of the expression vector pBE-np was as follows:
(1) taking expression vector pBEs as a template, and amplifying by primers pBE-f and pBE-r to obtain main frame pBE (removing signal peptide carried by the expression vector pBEs);
(2) taking the synthesized gene np as a template, and amplifying by primers np-f and np-r to obtain a gene np; (3) np is ligated to the main frame pBE by means of seamless cloning, resulting in the recombinant vector pBE-np, which is the signal peptide of np itself.
Wherein the nucleotide sequences of the primer pBE-f, the primer pBE-r, the primer np-f and the primer np-r are respectively shown in SEQ ID NO. 9-12.
Nucleotide sequence of primer pBE-f (SEQ ID NO: 9):
acgcgtccctctccttttgct
nucleotide sequence of primer pBE-r (SEQ ID NO: 10):
gtcgacctgcagtctagacat
nucleotide sequence of primer np-f (SEQ ID NO: 11):
ggacgcgtatgaaaatgaaaatgaaactt
nucleotide sequence of primer np-r (SEQ ID NO: 12):
caggtcgactttaacgccaacagcatc
2. construction of disulfide bond mutants
Firstly, obtaining a protein three-dimensional structure of Np through online homologous modeling software Swiss-Model, then carrying out molecular dynamics simulation of Np through molecular dynamics software Gromacs, and discovering the protein of Np through the molecular dynamics simulation 414 KNPDWEIGEDVYTPGISGDSLRSMSD 439 The amino acid fragment has high degree of freedom (shown as a black thin line in the middle of the right side of FIG. 1), belongs to a flexible region, and the spatial structure of the amino acid in the part is easy to damage after heating, so that the neutral protease Np is inactivated, and the rigidity of the part of the amino acid fragment is improved, which is beneficial to improving the thermal stability of the neutral protease. 5 pairs of disulfide bonds were designed by the online disulfide bond design website (http:// cptgweb. cpt. wayne. edu/DbD2/index. php), E419/419C/S433C, I420C/R435C, G421C/L434C, E422C/S433C and M437C/N470C, respectively.
The construction of disulfide-bond mutants (disulfide-bond expression vectors) is roughly as follows (taking mutant E419C/S433C as an example, and so on): the constructed pBE-np is used as a template, PCR amplification is carried out by using upstream and downstream primers E419C-F and E419C-R, agarose electrophoresis is used for detecting the PCR amplification result, a PCR product is purified and recovered, an original plasmid is decomposed by using restriction enzyme DpnI, the decomposed product is transferred into escherichia coli Top10 by a heat shock method, a recombinant transformant is verified by bacterial liquid PCR, and the plasmid of the transformant which is verified to be correct is extracted and sequenced, so that the mutant E419C is determined. According to the same method, E419C mutant plasmid is used as a template, primers S433C-F and S433C-R are used for PCR amplification, purification, transformation of Escherichia coli Top10, plasmid extraction and sequencing are carried out, and finally, the mutant E419C/S433C is obtained. The primers used in the experimental procedure are shown in table 1.
TABLE 1 primers used for disulfide bond mutant construction
| Name of primer | Sequence numbering | Nucleotide sequence (5 '-3') |
| E419C-F | SEQ ID NO:13 | ctgattggtgcatcggcga |
| E419C-R | SEQ ID NO:14 | tcgccgatgcaccaatcag |
| S433C-F | SEQ ID NO:3 | tctggcgattgtcttcgttct |
| S433C-R | SEQ ID NO:4 | agaacgaagacaatcgccaga |
| I420C-F | SEQ ID NO:15 | gattgggaatgcggcgaag |
| I420C-R | SEQ ID NO:16 | cttcgccgcattcccaatc |
| S435C-F | SEQ ID NO:17 | gattctctttgttctatgtct |
| S435C-R | SEQ ID NO:18 | agacatagaacaaagagaatc |
| G421C-F | SEQ ID NO:19 | gggaaatctgcgaagatg |
| G421C-R | SEQ ID NO:20 | catcttcgcagatttccc |
| L434C-F | SEQ ID NO:21 | ggcgattcttgtcgttctatg |
| L434C-R | SEQ ID NO:22 | catagaacgacaagaatcgcc |
| E422C-F | SEQ ID NO:5 | ggaaatcggctgcgatgttt |
| E422C-R | SEQ ID NO:6 | aaacatcgcagccgatttcc |
| M437C-F | SEQ ID NO:23 | cttcgttcttgttctgatcct |
| M437C-R | SEQ ID NO:24 | aggatcagaacaagaacgaag |
| N470C-F | SEQ ID NO:25 | ggcatcatctgcaaagctgct |
| N470C-R | SEQ ID NO:26 | agcagctttgcagatgatgcc |
3. Construction and screening of recombinant bacillus subtilis
The recombinant Bacillus subtilis was constructed as follows:
(1) bacillus subtilis competence was prepared with reference to the Bacillus subtilis competence preparation method (https:// www.takarabiomed.com.cn/ProductShow. aspxm. 20141220170014043129& productID. 20141226101312330227);
(2) transferring different expression vectors (pBE-np and disulfide bond expression vectors) into bacillus subtilis 1285 by a warm bath method;
(3) the transformation was plated on LBK solid plates and incubated overnight at 37 ℃.
The Bacillus subtilis recombinant transformants on the LBK solid plate were picked one by one with toothpicks into 24-well plates containing 2mL maltose medium per well, cultured at 37 ℃ for about 24h at 200rpm, centrifuged to take the supernatant for enzyme activity determination. The determination of the activity of the neutral protease is carried out according to the national standard GB/T23527-2009, and casein is hydrolyzed to generate 1 mu g of tyrosine per minute, namely 1 enzyme activity unit, which is expressed by U. Screening a recombinant engineering strain with the highest enzyme activity for each disulfide bond mutant, and performing shake flask culture.
The shake flask culture was carried out in a 250mL Erlenmeyer flask, and the corresponding recombinant engineered strain was first inoculated into a 50mL centrifuge tube containing 5mL LB medium, cultured at 37 ℃ for about 24 hours at 220rpm, and the cultured strain was inoculated into a 250mL Erlenmeyer flask containing 50mL maltose medium at an inoculum size of 1% (v/v). The shake flask culture conditions were 37 ℃ and 220rpm, samples were taken every 24 hours to determine the neutral protease activity, and the enzyme activities of the original Np and disulfide bond mutant recombinant bacteria after shake flask culture for 48 hours are shown in table 2.
TABLE 2 original neutral protease Np and shake flask culture enzyme activity of mutant recombinant bacteria
| Strains/recombinant strains | Enzyme activity (U/mL) |
| Original strain | 356 |
| Mutant E419C/S433C | 430 |
| Mutant I420C/R435C | 186 |
| Mutant G421C/L434C | 209 |
| Mutant E422C/S433C | 320 |
| Mutant M437C/N470C | 332 |
4. Preliminary analysis of original neutral protease Np and heat stability of disulfide bond mutant
The thermostability of the disulfide mutants was determined as follows: first, a buffer (50 mM Tris-HCl buffer pH7.5 containing 10mmol/L CaCl) was used 2 ) Properly diluting the protease, adding the diluted neutral protease enzyme solution into a PCR reaction tube, putting the PCR reaction tube filled with the enzyme solution into a PCR instrument, respectively carrying out heat treatment for 3 minutes at 80 ℃ and 85 ℃, determining the enzyme activity of the residual neutral protease by referring to a neutral protease activity determination method, and calculating the residual enzyme activity by taking the neutral protease which is not subjected to heat treatment as a reference. The residual enzyme activity is expressed as the enzyme activity of the heat-treated sample divided by the enzyme activity of the control sample, multiplied by 100%.
The thermostability of the original neutral protease Np (nucleotide sequence shown in SEQ ID NO:7, amino acid sequence shown in SEQ ID NO:8) and disulfide bond mutants at 80 ℃ and 85 ℃ is shown in Table 3. As can be seen from Table 3, only E422C/S433C (nucleotide sequence is shown as SEQ ID NO:1, amino acid sequence is shown as SEQ ID NO:2) in the 5 pairs of disulfide bond mutants can effectively improve the heat stability, the residual enzyme activities of the mutants after heat treatment for 3 minutes at 80 ℃ and 85 ℃ are respectively 75% and 35%, and the enzyme activity retention rates of the original Np after water bath for 3 minutes at 80 ℃ and 85 ℃ are only 18% and 0.5%. The other 4 pairs of disulfide bonds did not have much effect on thermal stability.
TABLE 3 original neutral protease Np and disulfide bond mutant thermostability assay
5. Purification of neutral protease Np and mutant E422C/S433C
The neutral protease Np and the mutant E422C/S433C were purified as follows:
(1) centrifuging the fermentation liquor cultured by the shake flask to obtain a supernatant;
(2) performing ultrafiltration concentration by using a 10kDa ultrafiltration tube;
(3) performing tweezer column purification on the ultrafiltered enzyme solution, and specifically referring to a Shanghai bioprotein purification kit;
(4) the purified protein is neutral protease and is stored at 4 ℃ for the next experimental analysis.
Experimental example 1
The enzyme activities of neutral protease Np and the mutant E422C/S433C at different temperatures of 30-70 ℃ are measured under the condition of pH7.5, the enzyme activity at the highest temperature of the enzyme activity is measured to be 100%, and the relative enzyme activities at other temperatures are calculated.
The experimental results are as follows: the optimal reaction temperatures of the neutral protease Np and the mutant E422C/S433C are shown in FIG. 2. As can be seen from FIG. 2, the optimal reaction temperature of the original neutral protease Np is 60 ℃ while the optimal reaction temperature of the mutant E422C/S433C is 65 ℃. It can be seen that the relative enzyme activity of the mutant E422C/S433C under the high temperature condition is higher than that of the original neutral protease Np.
Experimental example 2
The neutral protease Np and the mutant E422C/S433C are respectively treated in water bath at different temperatures (65 ℃ to 85 ℃) for 3 minutes, then enzyme activity determination is carried out, and the enzyme without heat treatment is used as a control, and the residual enzyme activity after heat treatment is calculated.
The experimental results are as follows: the heat stability of the neutral protease Np and the mutant E422C/S433C is shown in FIG. 3. it can be seen from FIG. 3 that the residual enzyme activities are equivalent when the treatment temperature is 65 ℃ and 70 ℃. When the heat treatment temperature is increased to over 75 ℃, the residual enzyme activity of the original neutral protease Np is sharply reduced. After being treated in water bath at 75 ℃, 80 ℃ and 85 ℃ for 3 minutes, the residual enzyme activity of the original neutral protease Np is 45 percent, 18 percent and 0.5 percent respectively; the mutants E422C/S433C were 90%, 75% and 35%, respectively.
Experimental example 3
The neutral protease Np and the mutant E422C/S433C are used for hydrolyzing soybean protein powder and soybean meal powder as follows: 1g of protein material was added to 50mL of pH7.5 buffer, the amount of neutral protease Np and mutant E422C/S433C added was 2000U, 180rpm was 65 ℃, the amount of small peptide produced was measured after 6 hours of reaction, the increment of small peptide was calculated using a sample without enzyme as a control, and the results of the experiment are shown in Table 4. From Table 4, the hydrolysis effect of the mutant E422C/S433C on soybean protein powder and soybean meal powder is better than that of neutral protease Np, and the increment of small peptides of the mutant E422C/S433C on the soybean protein powder and the soybean meal powder is 48% and 32% respectively; whereas the neutral protease Np is only 31% and 15%.
TABLE 4 hydrolysis of small peptide increments of different protein materials by the original neutral protease Np and the mutant E422C/S433C
| Sample (I) | Soybean protein powder (%) | Soybean meal (%) |
| Np | 31 | 15 |
| Mutant E422C/S433C | 48 | 32 |
It can be seen from the above examples that the neutral protease Np of the invention can form a disulfide bond by mutating the 422 th amino acid and the 433 th amino acid of the neutral protease Np into cysteine, thereby significantly improving the thermal stability of the obtained neutral protease.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that various changes and modifications can be made by those skilled in the art without departing from the spirit of the invention, and these changes and modifications are all within the scope of the invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> Shenzhen Runkang ecological environment shares Limited
<120> neutral protease gene, neutral protease, preparation method and application thereof
<160> 26
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1647
<212> DNA
<213> Bacillus thermophilus (Bacillus thermoproteolyticus)
<400> 1
atgaaaatga aaatgaaact tgcttctttc ggccttgctg ctggccttgc tgctcaagtt 60
ttccttcctt acaacgctct tgcttctaca gaacatgtta catggaacca acaattccaa 120
acacctcaat tcatctctgg cgatcttctt aaagttaacg gcacatctcc tgaagaactt 180
gtttaccaat acgttgaaaa aaacgaaaac aaattcaaat tccatgaaaa cgctaaagat 240
acacttcaac ttaaagaaaa aaaaaacgat aaccttggct tcacattcat gcgtttccaa 300
caaacataca aaggcatccc tgttttcggc gctgttgtta catctcatgt taaagatggc 360
acacttacag ctctttctgg cacacttatc cctaaccttg atacaaaagg ctctcttaaa 420
tctggcaaaa aactttctga aaaacaagct cgtgatatcg ctgaaaaaga tcttgttgct 480
aacgttacaa aagaagttcc tgaatacgaa caaggcaaag atacagaatt cgttgtttac 540
gttaacggcg atgaagcttc tcttgcttac gttgttaacc ttaacttcct tacacctgaa 600
cctggcaact ggctttacat catcgatgct gttgatggca aaatccttaa caaattcaac 660
caacttgatg ctgctaaacc tggcgatgtt aaatctatca caggcacatc tacagttggc 720
gttggccgtg gcgttcttgg cgatcaaaaa aacatcaaca caacatactc tacatactac 780
taccttcaag ataacacacg tggcaacggc atcttcacat acgatgctaa ataccgtaca 840
acacttcctg gctctctttg ggctgatgct gataaccaat tcttcgcttc ttacgatgct 900
cctgctgttg atgctcatta ctacgctggc gttacatacg attactacaa aaacgttcat 960
aaccgtcttt cttacgatgg caacaacgct gctatccgtt cttctgttca ttactctcaa 1020
ggctacaaca acgctttctg gaacggctct caaatggttt acggcgatgg cgatggccaa 1080
acattcatcc ctctttctgg cggcatcgat gttgttgctc atgaacttac acatgctgtt 1140
acagattaca cagctggcct tatctaccaa aacgaatctg gcgctatcaa cgaagctatg 1200
tctgatatct tcggcacact tgttaaattc tacgctaaca aaaaccctga ttgggaaatc 1260
ggctgtgatg tttacacacc tggcatctct ggcgattgtc ttcgttctat gtctgatcct 1320
gctaaatacg gcgatcctga tcattactct aaacgttaca caggcacaca agataacggc 1380
ggcgttcata tcaactctgg catcatcaac aaagctgctt accttatctc tcaaggcggc 1440
acacattacg gcgtttctgt tgttggcatc ggccgtgata aacttggcaa aatcttctac 1500
cgtgctctta cacaatacct tacacctaca tctaacttct ctcaacttcg tgctgctgct 1560
gttcaatctg ctacagatct ttacggctct acatctcaag aagttgcttc tgttaaacaa 1620
gctttcgatg ctgttggcgt taaataa 1647
<210> 2
<211> 548
<212> PRT
<213> Bacillus thermophilus (Bacillus thermoproteolyticus)
<400> 2
Met Lys Met Lys Met Lys Leu Ala Ser Phe Gly Leu Ala Ala Gly Leu
1 5 10 15
Ala Ala Gln Val Phe Leu Pro Tyr Asn Ala Leu Ala Ser Thr Glu His
20 25 30
Val Thr Trp Asn Gln Gln Phe Gln Thr Pro Gln Phe Ile Ser Gly Asp
35 40 45
Leu Leu Lys Val Asn Gly Thr Ser Pro Glu Glu Leu Val Tyr Gln Tyr
50 55 60
Val Glu Lys Asn Glu Asn Lys Phe Lys Phe His Glu Asn Ala Lys Asp
65 70 75 80
Thr Leu Gln Leu Lys Glu Lys Lys Asn Asp Asn Leu Gly Phe Thr Phe
85 90 95
Met Arg Phe Gln Gln Thr Tyr Lys Gly Ile Pro Val Phe Gly Ala Val
100 105 110
Val Thr Ser His Val Lys Asp Gly Thr Leu Thr Ala Leu Ser Gly Thr
115 120 125
Leu Ile Pro Asn Leu Asp Thr Lys Gly Ser Leu Lys Ser Gly Lys Lys
130 135 140
Leu Ser Glu Lys Gln Ala Arg Asp Ile Ala Glu Lys Asp Leu Val Ala
145 150 155 160
Asn Val Thr Lys Glu Val Pro Glu Tyr Glu Gln Gly Lys Asp Thr Glu
165 170 175
Phe Val Val Tyr Val Asn Gly Asp Glu Ala Ser Leu Ala Tyr Val Val
180 185 190
Asn Leu Asn Phe Leu Thr Pro Glu Pro Gly Asn Trp Leu Tyr Ile Ile
195 200 205
Asp Ala Val Asp Gly Lys Ile Leu Asn Lys Phe Asn Gln Leu Asp Ala
210 215 220
Ala Lys Pro Gly Asp Val Lys Ser Ile Thr Gly Thr Ser Thr Val Gly
225 230 235 240
Val Gly Arg Gly Val Leu Gly Asp Gln Lys Asn Ile Asn Thr Thr Tyr
245 250 255
Ser Thr Tyr Tyr Tyr Leu Gln Asp Asn Thr Arg Gly Asn Gly Ile Phe
260 265 270
Thr Tyr Asp Ala Lys Tyr Arg Thr Thr Leu Pro Gly Ser Leu Trp Ala
275 280 285
Asp Ala Asp Asn Gln Phe Phe Ala Ser Tyr Asp Ala Pro Ala Val Asp
290 295 300
Ala His Tyr Tyr Ala Gly Val Thr Tyr Asp Tyr Tyr Lys Asn Val His
305 310 315 320
Asn Arg Leu Ser Tyr Asp Gly Asn Asn Ala Ala Ile Arg Ser Ser Val
325 330 335
His Tyr Ser Gln Gly Tyr Asn Asn Ala Phe Trp Asn Gly Ser Gln Met
340 345 350
Val Tyr Gly Asp Gly Asp Gly Gln Thr Phe Ile Pro Leu Ser Gly Gly
355 360 365
Ile Asp Val Val Ala His Glu Leu Thr His Ala Val Thr Asp Tyr Thr
370 375 380
Ala Gly Leu Ile Tyr Gln Asn Glu Ser Gly Ala Ile Asn Glu Ala Met
385 390 395 400
Ser Asp Ile Phe Gly Thr Leu Val Lys Phe Tyr Ala Asn Lys Asn Pro
405 410 415
Asp Trp Glu Ile Gly Cys Asp Val Tyr Thr Pro Gly Ile Ser Gly Asp
420 425 430
Cys Leu Arg Ser Met Ser Asp Pro Ala Lys Tyr Gly Asp Pro Asp His
435 440 445
Tyr Ser Lys Arg Tyr Thr Gly Thr Gln Asp Asn Gly Gly Val His Ile
450 455 460
Asn Ser Gly Ile Ile Asn Lys Ala Ala Tyr Leu Ile Ser Gln Gly Gly
465 470 475 480
Thr His Tyr Gly Val Ser Val Val Gly Ile Gly Arg Asp Lys Leu Gly
485 490 495
Lys Ile Phe Tyr Arg Ala Leu Thr Gln Tyr Leu Thr Pro Thr Ser Asn
500 505 510
Phe Ser Gln Leu Arg Ala Ala Ala Val Gln Ser Ala Thr Asp Leu Tyr
515 520 525
Gly Ser Thr Ser Gln Glu Val Ala Ser Val Lys Gln Ala Phe Asp Ala
530 535 540
Val Gly Val Lys
545
<210> 3
<211> 21
<212> DNA
<213> primers (Primer)
<400> 3
tctggcgatt gtcttcgttc t 21
<210> 4
<211> 21
<212> DNA
<213> primers (Primer)
<400> 4
agaacgaaga caatcgccag a 21
<210> 5
<211> 20
<212> DNA
<213> primers (Primer)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> primers (Primer)
<400> 6
<210> 7
<211> 1647
<212> DNA
<213> Bacillus thermophilus (Bacillus thermoproteolyticus)
<400> 7
atgaaaatga aaatgaaact tgcttctttc ggccttgctg ctggccttgc tgctcaagtt 60
ttccttcctt acaacgctct tgcttctaca gaacatgtta catggaacca acaattccaa 120
acacctcaat tcatctctgg cgatcttctt aaagttaacg gcacatctcc tgaagaactt 180
gtttaccaat acgttgaaaa aaacgaaaac aaattcaaat tccatgaaaa cgctaaagat 240
acacttcaac ttaaagaaaa aaaaaacgat aaccttggct tcacattcat gcgtttccaa 300
caaacataca aaggcatccc tgttttcggc gctgttgtta catctcatgt taaagatggc 360
acacttacag ctctttctgg cacacttatc cctaaccttg atacaaaagg ctctcttaaa 420
tctggcaaaa aactttctga aaaacaagct cgtgatatcg ctgaaaaaga tcttgttgct 480
aacgttacaa aagaagttcc tgaatacgaa caaggcaaag atacagaatt cgttgtttac 540
gttaacggcg atgaagcttc tcttgcttac gttgttaacc ttaacttcct tacacctgaa 600
cctggcaact ggctttacat catcgatgct gttgatggca aaatccttaa caaattcaac 660
caacttgatg ctgctaaacc tggcgatgtt aaatctatca caggcacatc tacagttggc 720
gttggccgtg gcgttcttgg cgatcaaaaa aacatcaaca caacatactc tacatactac 780
taccttcaag ataacacacg tggcaacggc atcttcacat acgatgctaa ataccgtaca 840
acacttcctg gctctctttg ggctgatgct gataaccaat tcttcgcttc ttacgatgct 900
cctgctgttg atgctcatta ctacgctggc gttacatacg attactacaa aaacgttcat 960
aaccgtcttt cttacgatgg caacaacgct gctatccgtt cttctgttca ttactctcaa 1020
ggctacaaca acgctttctg gaacggctct caaatggttt acggcgatgg cgatggccaa 1080
acattcatcc ctctttctgg cggcatcgat gttgttgctc atgaacttac acatgctgtt 1140
acagattaca cagctggcct tatctaccaa aacgaatctg gcgctatcaa cgaagctatg 1200
tctgatatct tcggcacact tgttaaattc tacgctaaca aaaaccctga ttgggaaatc 1260
ggcgaagatg tttacacacc tggcatctct ggcgattctc ttcgttctat gtctgatcct 1320
gctaaatacg gcgatcctga tcattactct aaacgttaca caggcacaca agataacggc 1380
ggcgttcata tcaactctgg catcatcaac aaagctgctt accttatctc tcaaggcggc 1440
acacattacg gcgtttctgt tgttggcatc ggccgtgata aacttggcaa aatcttctac 1500
cgtgctctta cacaatacct tacacctaca tctaacttct ctcaacttcg tgctgctgct 1560
gttcaatctg ctacagatct ttacggctct acatctcaag aagttgcttc tgttaaacaa 1620
gctttcgatg ctgttggcgt taaataa 1647
<210> 8
<211> 548
<212> PRT
<213> Bacillus thermophilus (Bacillus thermoproteolyticus)
<400> 8
Met Lys Met Lys Met Lys Leu Ala Ser Phe Gly Leu Ala Ala Gly Leu
1 5 10 15
Ala Ala Gln Val Phe Leu Pro Tyr Asn Ala Leu Ala Ser Thr Glu His
20 25 30
Val Thr Trp Asn Gln Gln Phe Gln Thr Pro Gln Phe Ile Ser Gly Asp
35 40 45
Leu Leu Lys Val Asn Gly Thr Ser Pro Glu Glu Leu Val Tyr Gln Tyr
50 55 60
Val Glu Lys Asn Glu Asn Lys Phe Lys Phe His Glu Asn Ala Lys Asp
65 70 75 80
Thr Leu Gln Leu Lys Glu Lys Lys Asn Asp Asn Leu Gly Phe Thr Phe
85 90 95
Met Arg Phe Gln Gln Thr Tyr Lys Gly Ile Pro Val Phe Gly Ala Val
100 105 110
Val Thr Ser His Val Lys Asp Gly Thr Leu Thr Ala Leu Ser Gly Thr
115 120 125
Leu Ile Pro Asn Leu Asp Thr Lys Gly Ser Leu Lys Ser Gly Lys Lys
130 135 140
Leu Ser Glu Lys Gln Ala Arg Asp Ile Ala Glu Lys Asp Leu Val Ala
145 150 155 160
Asn Val Thr Lys Glu Val Pro Glu Tyr Glu Gln Gly Lys Asp Thr Glu
165 170 175
Phe Val Val Tyr Val Asn Gly Asp Glu Ala Ser Leu Ala Tyr Val Val
180 185 190
Asn Leu Asn Phe Leu Thr Pro Glu Pro Gly Asn Trp Leu Tyr Ile Ile
195 200 205
Asp Ala Val Asp Gly Lys Ile Leu Asn Lys Phe Asn Gln Leu Asp Ala
210 215 220
Ala Lys Pro Gly Asp Val Lys Ser Ile Thr Gly Thr Ser Thr Val Gly
225 230 235 240
Val Gly Arg Gly Val Leu Gly Asp Gln Lys Asn Ile Asn Thr Thr Tyr
245 250 255
Ser Thr Tyr Tyr Tyr Leu Gln Asp Asn Thr Arg Gly Asn Gly Ile Phe
260 265 270
Thr Tyr Asp Ala Lys Tyr Arg Thr Thr Leu Pro Gly Ser Leu Trp Ala
275 280 285
Asp Ala Asp Asn Gln Phe Phe Ala Ser Tyr Asp Ala Pro Ala Val Asp
290 295 300
Ala His Tyr Tyr Ala Gly Val Thr Tyr Asp Tyr Tyr Lys Asn Val His
305 310 315 320
Asn Arg Leu Ser Tyr Asp Gly Asn Asn Ala Ala Ile Arg Ser Ser Val
325 330 335
His Tyr Ser Gln Gly Tyr Asn Asn Ala Phe Trp Asn Gly Ser Gln Met
340 345 350
Val Tyr Gly Asp Gly Asp Gly Gln Thr Phe Ile Pro Leu Ser Gly Gly
355 360 365
Ile Asp Val Val Ala His Glu Leu Thr His Ala Val Thr Asp Tyr Thr
370 375 380
Ala Gly Leu Ile Tyr Gln Asn Glu Ser Gly Ala Ile Asn Glu Ala Met
385 390 395 400
Ser Asp Ile Phe Gly Thr Leu Val Lys Phe Tyr Ala Asn Lys Asn Pro
405 410 415
Asp Trp Glu Ile Gly Glu Asp Val Tyr Thr Pro Gly Ile Ser Gly Asp
420 425 430
Ser Leu Arg Ser Met Ser Asp Pro Ala Lys Tyr Gly Asp Pro Asp His
435 440 445
Tyr Ser Lys Arg Tyr Thr Gly Thr Gln Asp Asn Gly Gly Val His Ile
450 455 460
Asn Ser Gly Ile Ile Asn Lys Ala Ala Tyr Leu Ile Ser Gln Gly Gly
465 470 475 480
Thr His Tyr Gly Val Ser Val Val Gly Ile Gly Arg Asp Lys Leu Gly
485 490 495
Lys Ile Phe Tyr Arg Ala Leu Thr Gln Tyr Leu Thr Pro Thr Ser Asn
500 505 510
Phe Ser Gln Leu Arg Ala Ala Ala Val Gln Ser Ala Thr Asp Leu Tyr
515 520 525
Gly Ser Thr Ser Gln Glu Val Ala Ser Val Lys Gln Ala Phe Asp Ala
530 535 540
Val Gly Val Lys
545
<210> 9
<211> 21
<212> DNA
<213> primers (Primer)
<400> 9
acgcgtccct ctccttttgc t 21
<210> 10
<211> 21
<212> DNA
<213> primers (Primer)
<400> 10
gtcgacctgc agtctagaca t 21
<210> 11
<211> 29
<212> DNA
<213> primers (Primer)
<400> 11
ggacgcgtat gaaaatgaaa atgaaactt 29
<210> 12
<211> 27
<212> DNA
<213> primers (Primer)
<400> 12
caggtcgact ttaacgccaa cagcatc 27
<210> 13
<211> 19
<212> DNA
<213> primers (Primer)
<400> 13
ctgattggtg catcggcga 19
<210> 14
<211> 19
<212> DNA
<213> primers (Primer)
<400> 14
tcgccgatgc accaatcag 19
<210> 15
<211> 19
<212> DNA
<213> primers (Primer)
<400> 15
gattgggaat gcggcgaag 19
<210> 16
<211> 19
<212> DNA
<213> primers (Primer)
<400> 16
cttcgccgca ttcccaatc 19
<210> 17
<211> 21
<212> DNA
<213> primers (Primer)
<400> 17
gattctcttt gttctatgtc t 21
<210> 18
<211> 21
<212> DNA
<213> primers (Primer)
<400> 18
agacatagaa caaagagaat c 21
<210> 19
<211> 18
<212> DNA
<213> primers (Primer)
<400> 19
gggaaatctg cgaagatg 18
<210> 20
<211> 18
<212> DNA
<213> primers (Primer)
<400> 20
catcttcgca gatttccc 18
<210> 21
<211> 21
<212> DNA
<213> primers (Primer)
<400> 21
ggcgattctt gtcgttctat g 21
<210> 22
<211> 21
<212> DNA
<213> primers (Primer)
<400> 22
catagaacga caagaatcgc c 21
<210> 23
<211> 21
<212> DNA
<213> primers (Primer)
<400> 23
cttcgttctt gttctgatcc t 21
<210> 24
<211> 21
<212> DNA
<213> primers (Primer)
<400> 24
aggatcagaa caagaacgaa g 21
<210> 25
<211> 21
<212> DNA
<213> primers (Primer)
<400> 25
ggcatcatct gcaaagctgc t 21
<210> 26
<211> 21
<212> DNA
<213> primers (Primer)
<400> 26
agcagctttg cagatgatgc c 21
Claims (10)
1. A neutral protease gene is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1.
2. A neutral protease is characterized in that the amino acid sequence of the neutral protease is shown as SEQ ID NO. 2.
3. A recombinant expression vector comprising the neutral protease gene according to claim 1.
4. A recombinant expression strain comprising the recombinant expression vector of claim 3.
5. A method for preparing neutral protease is characterized by comprising the following steps:
providing a nucleotide sequence of neutral protease, an expression vector and an expression strain;
connecting the nucleotide sequence of the neutral protease with the expression vector, and amplifying by using an amplification primer to obtain a recombinant expression vector containing a neutral protease gene;
transferring the recombinant expression vector into an expression strain to obtain a recombinant expression strain;
culturing the recombinant expression strain to obtain the neutral protease;
wherein the nucleotide sequence of the neutral protease gene is shown as SEQ ID NO. 1, and the nucleotide sequence of the amplification primer is shown as SEQ ID NO. 3-6.
6. The method for producing a neutral protease according to claim 5, wherein the expression vector is a pBEs expression vector.
7. The method for producing a neutral protease according to claim 5, wherein the expression strain is Bacillus subtilis.
8. The method for producing a neutral protease according to any one of claims 5 to 7, wherein the recombinant expression strain is cultured by: the recombinant expression strain is inoculated into an LB culture medium to be cultured for 24h under the conditions of 37 ℃ and 200rpm, then is inoculated into a maltose culture medium to be cultured for 36h to 54h under the conditions of 33 ℃ to 37 ℃ and 160rpm to 200rpm, and the obtained culture is purified to obtain the neutral protease.
9. Use of the neutral protease according to claim 2 or the neutral protease produced by the method according to any one of claims 5 to 8 for hydrolyzing proteins.
10. The use according to claim 9, wherein the reaction temperature of the neutral protease in the protein hydrolysis reaction is 60 ℃ -70 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010619037.8A CN111944790B (en) | 2020-07-01 | 2020-07-01 | Neutral protease gene, neutral protease, preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010619037.8A CN111944790B (en) | 2020-07-01 | 2020-07-01 | Neutral protease gene, neutral protease, preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111944790A CN111944790A (en) | 2020-11-17 |
| CN111944790B true CN111944790B (en) | 2022-09-09 |
Family
ID=73337791
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010619037.8A Active CN111944790B (en) | 2020-07-01 | 2020-07-01 | Neutral protease gene, neutral protease, preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111944790B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111893126A (en) * | 2020-07-01 | 2020-11-06 | 深圳润康生态环境股份有限公司 | Alkaline protease gene, alkaline protease, preparation method and application thereof |
| CN116179519B (en) * | 2023-01-18 | 2024-04-23 | 天津科技大学 | Pediococcus-derived proteases and uses thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101194015A (en) * | 2004-12-22 | 2008-06-04 | 诺维信北美公司 | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| CN102939386A (en) * | 2010-04-14 | 2013-02-20 | 诺维信公司 | Processes for producing fermentation products |
| CN110819609A (en) * | 2019-12-13 | 2020-02-21 | 华南农业大学 | Mutant lipase with improved thermal stability as well as preparation method and application thereof |
Family Cites Families (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4966846A (en) * | 1987-10-01 | 1990-10-30 | W. R. Grace & Co.-Conn. | Molecular cloning and expression of a vibrio proteolyticus neutral protease gene |
| JPH02265492A (en) * | 1989-04-03 | 1990-10-30 | Tosoh Corp | Signal sequence and dna sequence containing the same |
| IT1239733B (en) * | 1990-02-23 | 1993-11-15 | Eniricerche Spa | NEUTRAL THERMO-STABLE MUTANTS AND MEANS AND METHODS FOR THEIR PREPARATION |
| EP0728196B1 (en) * | 1993-12-07 | 2003-05-02 | Sagami Chemical Research Center | Mutants of a thermostable neutral protease from bacillus |
| US6103512A (en) * | 1994-01-27 | 2000-08-15 | Rijksuniversiteit Te Groningen | Thermostable variants of neutral proteases of Bacillus stearothermophilus and Bacillus thermoproteolyticus |
| JPH09255A (en) * | 1995-04-20 | 1997-01-07 | Daiwa Kasei Kk | Variant type thermolysin yt73 and its gene |
| EP1735438A2 (en) * | 2004-04-12 | 2006-12-27 | Catalyst Biosciences | Cleavage of vegf and vegf receptor by wild-type and mutant proteases |
| EP2516636A1 (en) * | 2009-12-21 | 2012-10-31 | Novozymes Inc. | Methods for producing heterologous polypeptides in thiol-disulfide oxidoreductase-deficient bacterial mutant cells |
| KR20130132416A (en) * | 2010-10-20 | 2013-12-04 | 다니스코 유에스 인크. | Thermostable trichoderma cellulase |
| US10106761B2 (en) * | 2014-04-14 | 2018-10-23 | Novozymes A/S | Metalloprotease from chryseobacterium |
| US10281374B2 (en) * | 2015-11-04 | 2019-05-07 | Diagnostic Biosystems | Method of pretreatment of biological samples for an analyte-staining assay method |
| CN106754833B (en) * | 2017-01-16 | 2020-06-09 | 广东溢多利生物科技股份有限公司 | Method for efficiently expressing pullulanase in bacillus subtilis and recombinant bacillus subtilis |
| CN111363734A (en) * | 2018-12-25 | 2020-07-03 | 丰益(上海)生物技术研发中心有限公司 | Lipase mutant, composition and application thereof |
| CN110283025A (en) * | 2019-06-19 | 2019-09-27 | 深圳润康生态环境股份有限公司 | Biological organic fertilizer and preparation method thereof |
| CN111893126A (en) * | 2020-07-01 | 2020-11-06 | 深圳润康生态环境股份有限公司 | Alkaline protease gene, alkaline protease, preparation method and application thereof |
-
2020
- 2020-07-01 CN CN202010619037.8A patent/CN111944790B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101194015A (en) * | 2004-12-22 | 2008-06-04 | 诺维信北美公司 | Polypeptides having glucoamylase activity and polynucleotides encoding same |
| CN102939386A (en) * | 2010-04-14 | 2013-02-20 | 诺维信公司 | Processes for producing fermentation products |
| CN110819609A (en) * | 2019-12-13 | 2020-02-21 | 华南农业大学 | Mutant lipase with improved thermal stability as well as preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 微生物源蛋白酶研究进展;韩爽等;《食品工业科技》;20191231(第13期);全文 * |
| 氨基酸残基在蛋白质热稳定性机制中的研究进展;易弋等;《广西科技大学学报》;20151215(第04期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111944790A (en) | 2020-11-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107475228B (en) | Keratinase mutant with improved substrate specificity and preparation method thereof | |
| WO2022134236A1 (en) | Alkaline protease mutant, gene thereof, engineering bacteria thereof, preparation method therefor and use thereof | |
| CN113862233B (en) | Method for improving acid stability of glucose oxidase, mutant Q241E/R499E, gene and application | |
| CN110066777B (en) | Endo-inulase and application thereof in production of fructo-oligosaccharide | |
| CN113862241B (en) | Chitosanase Csncv, mutant CsnB thereof and application of mutant CsnB | |
| CN112458072B (en) | Alkaline protease mutant and preparation thereof | |
| CN111944790B (en) | Neutral protease gene, neutral protease, preparation method and application thereof | |
| CN106591271A (en) | Arginine deiminase mutant with improved enzyme activity and temperature stability and application of mutant | |
| CN108004220B (en) | Alkaline protease BmP mutant for improving thermal stability and gene and application thereof | |
| CN108841851B (en) | Method for expressing glutamine transaminase by using food-source-safe host | |
| CN111893126A (en) | Alkaline protease gene, alkaline protease, preparation method and application thereof | |
| CN111893125A (en) | Chitosan enzyme gene, chitosanase, preparation method and application thereof | |
| CN114517192B (en) | Protease mutant BLAPR1 with improved thermal stability, and encoding gene and application thereof | |
| CN114107266B (en) | Protease mutant with improved heat resistance, encoding gene and application thereof | |
| CN111996205A (en) | Chitinase gene, chitinase and preparation method and application thereof | |
| CN113699138A (en) | Alkaline protease gene, hybrid promoter, recombinant expression vector, recombinant expression engineering bacterium, alkaline protease, method and application | |
| CN111676211B (en) | Trypsin mutant with autogenous cutting resistance and high specific activity | |
| CN112111472B (en) | Novel beta-xylosidase and preparation thereof | |
| CN112725315B (en) | Application of chitosanase and mutant thereof in preparation of chitosan oligosaccharide | |
| CN111004794B (en) | Subtilisin E mutant with improved thermal stability and application thereof | |
| CN112852788B (en) | Subtilisin E mutant with improved alkaline substrate selectivity and application thereof | |
| CN114621944B (en) | Arginine deiminase mutant with improved enzyme activity | |
| CN114350643B (en) | Recombinant strain for producing aminopeptidase and application of recombinant strain in efficient proteolysis | |
| CN117417922B (en) | High-temperature-resistant alkaline protease and gene and application thereof | |
| CN113481187B (en) | Algin lyase mutant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |