CN112111472B

CN112111472B - Novel beta-xylosidase and preparation thereof

Info

Publication number: CN112111472B
Application number: CN202011029392.6A
Authority: CN
Inventors: 刘逸寒; 王凤华; 葛秀琪; 路福平
Original assignee: Tianjin University of Science and Technology
Current assignee: Tianjin University of Science and Technology
Priority date: 2020-09-27
Filing date: 2020-09-27
Publication date: 2022-03-18
Anticipated expiration: 2040-09-27
Also published as: CN112111472A

Abstract

The invention belongs to the technical field of enzyme genetic engineering, and particularly relates to a beta-xylosidase mutant with improved enzyme activity and a preparation method thereof. The invention obtains the wild beta-xylosidase gene of Bacillus pumilus (Bacillus pumilus) by a molecular biology technical means, randomly mutates the wild beta-xylosidase gene by an error-prone PCR technology to obtain a beta-xylosidase mutant E455G and a coding gene xylm thereof, reconstructs recombinant plasmids, realizes the high-efficiency expression of the beta-xylosidase in Bacillus subtilis, Bacillus licheniformis and Bacillus amyloliquefaciens, and obtains the high-activity beta-xylosidase by the technologies of fermentation, extraction and the like.

Description

Novel beta-xylosidase and preparation thereof

The technical field is as follows:

the invention belongs to the technical field of enzyme genetic engineering, and particularly relates to a beta-xylosidase mutant with improved enzyme activity obtained by in vitro directed evolution through an error-prone PCR (polymerase chain reaction) technology and preparation thereof.

Background art:

beta-xylosidase (beta-xylosidase, XYL, EC 3.2.1.37) is an important component of xylan degrading enzyme system, hydrolyzes non-reducing terminal residues of oligosaccharide and xyloside substrate in an exo-type manner to generate xylose, and has been widely applied in a plurality of fields through synergistic action with xylanase. In food application, the addition of xylanase and beta-xylosidase can decompose long-chain arabinoxylan into short chains to reduce the viscosity of beer. The mechanical property, the texture and the like of the bread can be greatly improved by adding a proper amount of beta-xylosidase in the bread production process; in the aspect of energy application, the xylan content in nature is rich, and the xylan can be hydrolyzed by a xylanase system to generate xylooligosaccharide and xylose, and further strains such as saccharomyces cerevisiae and the like are utilized to ferment to generate energy such as biomass ethanol and the like; in the aspect of environmental protection, the beta-xylosidase can degrade garbage and wastes generated in the production processes of agriculture, industry and the like, so that the environment is effectively improved, and meanwhile, the application of a plurality of harmful organic or inorganic chemical reagents is reduced due to the use of the beta-xylosidase, so that the aim of sustainable development of the environmental society is better fulfilled; in the aspect of feed production, the beta-xylosidase serving as a feed additive can partially hydrolyze xylan contained in the feed additive, so that cellulose and the like connected with the feed additive are more easily digested by rumen, and the aim of improving the nutritional value of the feed is fulfilled.

Based on the similarity of amino acid sequences, beta-xylosidase is divided into a plurality of Glycoside Hydrolase (GH) families, including GH1, GH2, GH3, GH5, GH30, GH39, GH43, GH52, GH54 and GH120, which are compatible with the heterogeneity of xylan, while the currently reported beta-xylosidase exists mostly in GH3, GH39 and GH 43. Beta-xylosidase has a wide source, is found in microorganisms such as bacteria, actinomycetes, archaea, and fungi (including yeast), and higher plants such as wheat, and is currently studied in many cases. Wherein the molecular weight of the beta-xylosidase varies from 26kDa to 400kDa, and the produced enzyme protein comprises monomers, dimers, trimers, tetramers and the like. It has been reported that most of the beta-xylosidases in bacteria and yeasts are intracellular enzymes, while the beta-xylosidases in some fungi are extracellular enzymes.

The directed evolution of enzyme molecules in vitro belongs to the irrational evolution of proteins, is one of the important means for improving the functions and activities of proteins, and belongs to the field of protein engineering. Under the condition that the factors such as the high-level structure of the protein, the catalytic site and the like are not known in advance, conditions can be artificially created to simulate the evolution mechanism of natural selection, a mutant library containing a large number of target protein coding genes is quickly established in vitro by a molecular biology means, and the protein mutant meeting certain expected effects is quickly obtained by a high-throughput directional screening method. The core steps of directed evolution mainly include the construction of a diverse library of mutants and high throughput screening methods. Commonly used include: error-prone PCR, saturation mutagenesis, DNA shuffling, staggered extension PCR, and the like. In contrast, when the spatial structure, active site, catalytic mechanism and other factors of the protein are known, the targeted modification of the gene based on the known factors is site-directed mutation, i.e., rational design. Since it can only substitute, delete or insert a few amino acids in the native enzyme protein, the modification of the enzyme function is limited. Therefore, for enzymes with unknown structure and function, directed evolution can make up for the deficiency of rational design to some extent.

The bacillus expression system is widely applied to the fields of industry, agriculture, medicine, health, food, animal husbandry, aquatic products and scientific research as a safe, efficient, multifunctional and microorganism strain with great development potential. Compared with the common escherichia coli expression system, the method has the unique advantage that the product expressed by the target gene can be secreted to the outside of cells, thereby reducing the cost and the workload of further collecting, separating and purifying the gene expression product. Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus megaterium and the like in the bacillus can be used as expression host bacteria. In the field of microbial genetics, background research of bacillus is also quite clear, and the bacillus has the advantages of unobvious codon preference, simple fermentation, rapid growth, no production of pathogenic toxin, no special requirement on a culture medium and the like. With the development of molecular biology techniques and the intensive research of Bacillus, a large number of genes have been cloned and expressed using Bacillus expression systems, and some have been industrially produced on a large scale, and various enzymes and clinically required chemicals or industrial products are produced by expression using Bacillus.

In the invention, the original beta-xylosidase gene is directionally evolved to obtain the beta-xylosidase mutant gene with high activity, and the high-efficiency expression of the beta-xylosidase gene in a bacillus subtilis expression system, a bacillus amyloliquefaciens expression system and a bacillus licheniformis expression system is realized, so that the mutant strain producing the beta-xylosidase with high activity is obtained.

The invention content is as follows:

based on the problems in the prior art, the present properties of the beta-xylosidase need to be further improved in order to further promote the application of the beta-xylosidase in the industrial field, and the invention aims to provide a high-activity beta-xylosidase mutant.

The technical route for achieving the purpose of the invention is summarized as follows:

the method comprises the steps of obtaining a wild-type beta-xylosidase XYL from Bacillus pumilus (TCCC 11573) by a basic molecular biology technical means, constructing a recombinant vector by enzyme digestion, connection and the like, sequencing to obtain a wild-type beta-xylosidase XYL coding gene XYL (the sequence is shown as SEQ ID No.2), randomly mutating the wild-type XYL gene by using an error-prone PCR technology, screening by using a Bacillus subtilis expression system to obtain a XYL mutant E455G and a coding gene xylm thereof, reconstructing the recombinant vector, realizing high-efficiency expression of the mutant in Bacillus subtilis, Bacillus amyloliquefaciens and Bacillus licheniformis, and obtaining the XYL mutant with improved enzyme activity by technologies such as fermentation, extraction and the like.

The following definitions are used in the present invention:

1. nomenclature for amino acid and DNA nucleic acid sequences

The accepted IUPAC nomenclature for amino acid residues is used, in the form of a three letter code. DNA nucleic acid sequences employ the accepted IUPAC nomenclature.

2. Identification of beta-xylosidase mutants

The "amino acid substituted at the original amino acid position" is used to indicate the mutated amino acid in the XYL mutant. Such as Glu455Gly, indicating the substitution of the amino acid at position 455 from Glu of the wild type XYL to Gly, the numbering of the positions corresponding to the numbering of the amino acid sequence of the wild type XYL in SEQ ID No. 1.

In the present invention, lower italic XYL represents the gene encoding the wild-type XYL, and lower italic xylm represents the gene encoding the mutant E455G, the information being as in the table below.

Beta-xylosidase	Amino acid mutation site	Site of gene mutation	Amino acid SEQ ID No.	Nucleotide SEQ ID No.
					Wild type	—	—	1	2
E455G	Glu455Gly	GAG→GGG	3	4

The invention also provides a recombinant plasmid or a recombinant bacterium containing the mutant coding gene;

preferably, the expression vector of the XYL mutant E455G encoding gene is pBSA 43; the host cell can be Bacillus subtilis WB600, Bacillus amyloliquefaciens CGMCC No.11218 or Bacillus licheniformis TCCC 11965.

The experimental scheme of the invention is as follows:

1. obtaining the coding gene of the XYL mutant, which comprises the following steps:

(1) carrying out error-prone PCR random mutation on a wild type XYL coding gene by taking the wild type XYL coding gene XYL (SEQ ID No.2) of the bacillus pumilus as a template;

(2) and (2) constructing a recombinant plasmid by enzyme digestion, connection and the like for the randomly mutated XYL coding gene, transferring the recombinant plasmid into the bacillus subtilis WB600, screening to obtain an XYL mutant with improved enzyme activity, sequencing to obtain an XYL mutant coding gene xylm, and storing a plasmid pET22b-xylm containing the XYL mutant coding gene with improved enzyme activity.

2. A bacillus subtilis recombinant strain containing a beta-xylosidase coding gene and a process for preparing beta-xylosidase with improved enzyme activity by using the bacillus subtilis recombinant strain comprise the following steps:

(1) connecting the XYL mutant coding gene xylm with an escherichia coli-bacillus subtilis shuttle plasmid pBSA43 to obtain a new recombinant plasmid pBSA 43-xylm;

(2) transferring the recombinant plasmid into bacillus subtilis WB600, screening kanamycin (Kan) resistance, performing enzyme digestion verification to obtain a recombinant strain, and then culturing and fermenting the recombinant strain to obtain the beta-xylosidase.

3. A bacillus amyloliquefaciens recombinant strain containing a beta-xylosidase coding gene and a process for preparing beta-xylosidase with improved enzyme activity by using the bacillus amyloliquefaciens recombinant strain comprise the following steps:

(1) transferring the recombinant plasmid pBSA43-xylm into bacillus amyloliquefaciens CGMCC No.11218, and carrying out Kan resistance screening and enzyme activity determination on the obtained recombinant strain to obtain a beta-xylosidase high-yield strain;

(2) then fermenting to prepare the beta-xylosidase.

4. A Bacillus licheniformis recombinant strain containing a beta-xylosidase coding gene and a process for preparing beta-xylosidase with improved enzyme activity by using the same comprise the following steps:

(1) transferring the recombinant plasmid pBSA43-xylm into a host strain Bacillus licheniformis TCCC11965, and screening by Kan resistance to obtain a beta-xylosidase recombinant strain;

(2) and fermenting the recombinant strain to prepare the beta-xylosidase.

The enzymatic properties of the XYL mutant E455G are as follows:

(1) specific activity: the specific activity of the XYL mutant E455G was 281.66U/mg.

(2) Optimum reaction temperature: at 30 ℃.

(3) Temperature stability: and (3) preserving the temperature of the mixture for 2 hours in water bath at 0, 10, 20, 30 and 40 ℃ respectively under the condition of pH 7.0. After 2h of incubation at 0, 10 and 20 ℃, the residual activity of the XYL mutant E455G and the wild type was maintained above 95%; after incubation for 2h at 30 ℃ and 40 ℃, the residual activity of XYL mutant E455G was 91.02% and 60%, respectively, corresponding to 90.08% and 63.98% for the wild type.

(4) Optimum pH: 7.0.

(5) pH stability: wild type and XYL mutant E455G were more stable at pH7.0, 8.0 and 9.0 by incubation at 4 ℃ in buffers pH 6.0, 7.0, 8.0, 9.0 and 10.0, respectively, the residual viability of the XYL mutant E455G was 79.55%, 83.27% and 70.19%, while the residual viability of the wild type was 83.4%, 84.85% and 65.92%, respectively. In contrast, at pH 6.0 and pH 10.0, the residual activity of the two was about 3% and 19%, respectively.

Has the advantages that:

1. the invention utilizes error-prone PCR technology to carry out random mutation on wild type XYL to obtain the mutant E455G with improved enzyme activity. The highest values of the fermentation enzyme activities of the high-activity beta-xylosidase in each expression system are 28428U/mL, 37122U/mL and 41407U/mL (g.cell dry weight), and the fermentation enzyme activity is improved by about 230% compared with that of a wild type.

2. According to the invention, a bacillus subtilis expression system, a bacillus amyloliquefaciens expression system and a bacillus licheniformis system are respectively used, so that the high-efficiency expression of the XYL mutant with improved enzyme activity in different modes is realized.

Description of the drawings:

FIG. 1 is a PCR amplification electrophoretogram of wild-type xyl gene of the present invention

Wherein: m is DNA Marker, 1 is xyl gene;

FIG. 2 is a restriction enzyme digestion verification diagram of the recombinant plasmid pBSA43-xylm of the present invention, wherein: m is DNAmarker, 1 is a BamH I and NotI double-enzyme digestion electrophoresis diagram of recombinant plasmid pBSA43-xylm in bacillus subtilis, 2 is a BamH I and NotI double-enzyme digestion electrophoresis diagram of recombinant plasmid pBSA43-xylm in bacillus amyloliquefaciens, and 3 is a BamH I and NotI double-enzyme digestion electrophoresis diagram of recombinant plasmid pBSA43-xylm in bacillus licheniformis;

FIG. 3 is a SDS-PAGE pattern of purified samples of wild type XYL and mutant E455G protein of the present invention wherein: m is Protein Marker, 1 is wild type XYL purified sample, and 2 is mutant E455G purified sample;

FIG. 4 is the temperature optimum curve of wild type XYL and mutant E455G according to the present invention

Wherein: WT is the wild type XYL of the invention, E455G is the mutant of the invention;

FIG. 5 is the optimum pH curve of wild type XYL and mutant E455G according to the present invention

FIG. 6 is a temperature stability curve

FIG. 7 is a pH stability curve

Wherein: WT is the wild type XYL of the invention, and E455G is the mutant of the invention.

The specific implementation mode is as follows:

the technical content of the present invention is further illustrated by the following examples, but the present invention is not limited to these examples, and the following examples should not be construed as limiting the scope of the present invention.

The bacillus licheniformis used in the invention is TCCC11965, which is disclosed in the following parts: development and application of a CRISPR/Cas9 system for Bacillus licheniformis microorganisms edition [ J ]. International Journal of Biological Macromolecules,2019,122:329-337, currently maintained at the institute of microbial cultures, university of Otsu technology, from which cultures are publicly available.

The culture medium used in the examples of the present invention was as follows:

LB medium (g/L): 5.0 yeast extract, 10.0 tryptone and 10.0 NaCl.

10 XSP salt solution (g/L): k₂HPO₄ 91.7，KH₂PO₄ 30，(NH4)₂SO₄10, sodium citrate 5, MgSO_4·7H₂O10。

SP I medium: 1 XSP 97.6mL, 400. mu.L of 5% casein hydrolysate, 1mL of 10% yeast juice, 1mL of 50% glucose. (5% Casein hydrolysate: 0.5g Casein hydrolysate dissolved in 10mL ddH₂O; 10% yeast juice: 1g Yeast extract dissolved in 10mL ddH₂O; 50% glucose: 5g glucose dissolved in 10mL ddH₂O)。

SP II medium: SP I Medium 99mL, 100mM CaCl₂ 500μL，500mM MgCl₂ 500μL。

LBS medium (g/L): sorbitol 91.085, NaCl 10, yeast extract 5, tryptone 10.

Seed culture medium: 5g/L of yeast powder, 10g/L of peptone and 5g/L of sodium chloride;

fermentation medium: 64g/L of corn flour, 40g/L of bean cake powder, 4g/L of disodium hydrogen phosphate, 0.3g/L of monopotassium phosphate and 0.7g/L of high-temperature amylase.

The solid culture medium of the above culture medium was supplemented with 2% agar.

The invention will be further illustrated by the following specific examples.

Example 1: obtaining the wild-type XYL-encoding Gene XYL

1. Wild-type XYL-encoding gene XYL was derived from a strain of Bacillus pumilus (Bacillus pumilus) TCCC 11573 which was stored in the laboratory, and the genome was extracted using the Bacterial DNA Kit from OMEGA, USA.

(1) Strain activation: dipping bacillus pumilus liquid from a glycerin pipe by using an inoculating loop, inoculating the bacillus pumilus liquid to an LB solid medium flat plate, scribing three zones, and culturing at the constant temperature of 37 ℃ for 12 hours;

(2) transferring: selecting a single colony with a neat edge and a smooth surface from a plate for culturing the thalli, inoculating the single colony in 5mL of liquid LB culture medium, and culturing for 12h at the temperature of 37 ℃ at 220 r/min;

(3) and (3) collecting thalli: taking a proper amount of culture solution, sub-packaging the culture solution into 1.5mL of EP tubes, centrifuging the culture solution at 12000r/min for 2min, and removing supernatant;

(4) add 250. mu.L of ddH₂O resuspending the thallus, adding 50 mu L of 50mg/mL lysozyme, and carrying out water bath at 37 ℃ for 10 min;

(5) adding 100 mu L of BTL Buffer and 20 mu L of protease K, and carrying out vortex oscillation;

(6) water bath at 55 deg.C for 40-50min, shaking every 20-30min, and mixing;

(7) adding 5 μ L RNase, reversing, mixing for several times, and standing at room temperature for 5 min;

(8) centrifuging at 12000rpm for 2min, removing the undigested part, and transferring the supernatant part to a new 1.5mL EP tube;

(9) adding 220 μ L BDL Buffer, shaking, mixing, and water bath at 65 deg.C for 10 min;

(10) adding 220 mu L of absolute ethyl alcohol, blowing, sucking and uniformly mixing;

(11) transferring to an adsorption column, standing for 1min, centrifuging at 12000rpm for 1min, and removing the filtrate;

(12) adding 500 μ L HBC Buffer at 12000rpm, centrifuging for 1min, and removing the filtrate;

(13) adding 700 mu L of DNA Wash Buffer at 12000rpm, centrifuging for 1min, and removing the filtrate;

(14) adding 500 mu L of DNA Wash Buffer at 12000rpm, centrifuging for 1min, and removing the filtrate;

(15)12000rpm, air separation for 2min, metal bath at 55 ℃ for 10min, and air drying;

(16) add 40. mu.L of ddH₂O eluting the genome.

2. Amplification of wild-type XYL encoding Gene XYL

An amplification primer of wild type XYL coding gene XYL is designed, and the sequence is as follows:

upstream P1(SEQ ID No. 5):

CGCGGATCCGATGAAAATTACCAATCCAGTGC (underlined part is BamH I site)

Downstream P2(SEQ ID No. 6):

AAGGAAAAAAGCGGCCGCTTCTGTTTCCTCATAACGGAAA (Not I cleavage site in the underlined part)

The reaction system for PCR amplification is 50 μ L, and comprises the following components:

PrimeSTAR Max	25μL
		upstream primer P1 (20. mu. mol/L)	2μL
Downstream primer P2 (20. mu. mol/L)	2μL
		Genome	2μL
ddH₂O	19μL
		Total volume	50μL

Note: the above-mentioned required reagents are from Takara, a precious bioengineering Co., Ltd.

The setting of the amplification program is as follows:

a. pre-denaturation at 98 ℃ for 30 s;

b. denaturation: 10s at 98 ℃;

c. annealing: 45s at 56 ℃;

d. extension: 10s at 72 ℃;

e.b-d for 30 cycles;

f. extension at 72 ℃ for 10 min.

The PCR product is subjected to agarose gel electrophoresis, a band of the gene XYL encoded by the wild type XYL of the Bacillus pumilus can be seen, the band is about 1600bp (shown in figure 1), the PCR product is recovered by a DNA gel cutting recovery kit, a recombinant plasmid pET22b-XYL is constructed by enzyme cutting and connection and sent to a sequencing company for sequencing, and the wild type XYL gene sequence (shown in SEQ ID NO.2) is obtained.

Example 2: acquisition of the XYL mutant E455G

1. Error-prone PCR: the wild type coding gene xyl is used as a template to carry out error-prone PCR, and the reaction system is as follows:

ddH₂O	10μL
		recombinant plasmid pET22b-xyl (5 ng/. mu.L)	2μL
Upstream primer P1 (10. mu. mol/L)	2μL
		Downstream primer P2 (10. mu. mol/L)	2μL
Taq DNA polymerase	0.5μL
		10×Taq buffer	5μL
dATP(10mmol/L)	1μL
		dGTP(10mmol/L)	1μL
dTTP(10mmol/L)	5μL
		dCTP(10mmol/L)	5μL
MgCl₂(25mmol/L)	14μL
		MnCl₂(10mmol/L)	2.5μL

After the system is completed, an error-prone PCR reaction is performed, and the program is set as follows:

a. pre-denaturation at 95 deg.C for 5 min;

b. denaturation: 30s at 95 ℃;

c. annealing: 45s at 56 ℃;

d. extension: 90s at 72 ℃;

e.b-d for 35 cycles;

f. extension at 72 ℃ for 10 min.

After the PCR reaction is finished, carrying out double enzyme digestion on the PCR product and the carrier plasmid by BamH I and Not I, purifying and recovering, connecting the error-prone PCR product with the carrier plasmid pBSA43 which is also subjected to double enzyme digestion, transforming bacillus subtilis WB600, coating the transformed bacillus subtilis WB600 on an LB solid culture medium containing Kan (100 mu g/mL), and carrying out static culture in an incubator at 37 ℃ for 12h to obtain a transformant.

3. The screening method comprises the following steps: the activity detection is carried out by adopting a p-nitrophenol (pNP) colorimetric method. pNPX is hydrolyzed by beta-xylosidase to produce pNP and xylose, which are then treated with Na₂CO₃The reaction was terminated. The pNP formed is a yellow compound whose maximum light absorption wavelength is 405 nm. Therefore, the amount of pNP produced has a certain proportional relationship with the color intensity of the reaction mixture within a certain range, and the β -xylosidase activity can be measured by measuring the amount of pNP produced by a colorimetric method. The fermentation supernatant can be directly used for screening because the target protein exists in the fermentation supernatant.

4. Screening of mutant libraries: 200. mu.L of LB liquid medium containing Kan (100. mu.g/mL) was added to each well of a 96-well plate, and then a single clone of each transformant was picked up with a sterilized toothpick into the 96-well plate as much as possible so that just a small amount of the strain was stained each time. The 96-well plate was transferred to a shaker culture at 160rpm for 48h at 37 ℃. Then, the mixture was centrifuged at 4000rpm for 10min at 4 ℃ by a low temperature centrifuge, 50. mu.L of the fermentation supernatant was put into a 96-well plate 1 containing 50. mu.L of the reaction solution, reacted at 30 ℃ for 10min, and then 100. mu.L of 2mol/L sodium carbonate solution was added to detect the absorbance at 405 nm.

Note: reaction solution: 0.8mmol/L p-nitrophenol-beta-D-xyloside (pNPX) solution: accurately weighing 21.7mg of p-nitrophenol-beta-D-xyloside, fixing the volume to 100mL, placing the obtained product in a brown bottle, and preserving the obtained product in a refrigerator at 4 ℃.

2mol/L sodium carbonate solution: 106g of anhydrous sodium carbonate is accurately weighed, about 450mL of deionized water is added, and the volume is adjusted to 500mL after stirring and dissolving.

5. Selecting the mutant with improved enzyme activity. According to the condition of the plate 1, calculating the residual enzyme activity of each mutant, selecting the mutant with the activity improved compared with that of a wild enzyme, inoculating the mutant into the plate, and sending out a bacterial sample for sequencing.

Through the error-prone PCR of the steps, the mutant with improved enzyme activity is selected, and the mutant containing one amino acid mutation, namely E455G (G), is obtained after sequencingAG→GGG) Thus, XYL mutant E455G (SEQ ID NO.3), and the gene xylm (SEQ ID NO.4) encoding it, were obtained.

Example 3: construction of beta-xylosidase bacillus subtilis recombinant bacteria

1. Construction of expression plasmid pBSA43-xylm

Carrying out BamHI and NotI double enzyme digestion on xylm and a Bacillus subtilis expression vector pBSA43, then connecting to construct a recombinant plasmid pBSA43-xylm, transforming to an escherichia coli DH5 alpha competent cell, selecting a positive transformant, extracting a plasmid, carrying out enzyme digestion verification and sequencing, and determining that the construction is successful, thereby obtaining the recombinant expression plasmid pBSA 43-xylm.

2. Expression plasmid pBSA43-xylm transformation of Bacillus subtilis WB600

(1) Activating a bacillus subtilis WB600 strain, scribing in three regions on a non-resistance LB plate, and culturing for 12 h;

(2) picking a single colony, inoculating the single colony in a test tube containing 5mL of LB culture medium, and culturing at 37 ℃ and 220rpm for 12 h;

(3) inoculating 100 μ L of the seed solution into a test tube containing 5mL of SPI culture medium at 37 deg.C and 220rpm according to the inoculation amount of 2%, and culturing for 3-4h to OD₆₀₀＝1.2；

(4) Quickly inoculating 200 μ L of the culture medium into 2mL of SPII culture medium, culturing at 37 deg.C and 100rpm for 1.5 h;

(5) adding 20 μ L10 mM EGTA, culturing at 37 deg.C and 100rpm for 10 min;

(6) adding 1-2 μ L recombinant plasmid pBSA43-xylm, culturing at 37 deg.C and 100rpm for 30min, adjusting rotation speed to 220rpm, and culturing for 1-2 hr;

(7) transferring the bacterial liquid into a sterilized 1.5mL EP tube, centrifuging at 5000rpm for 5min, discarding the supernatant, leaving 50 μ L of culture solution for resuspending the thallus, and coating the bacterial liquid on a plate containing Kan;

(8) the transformant was picked up, and the plasmid was extracted and digested with an enzyme (as shown in lane 1 in FIG. 2) to obtain a recombinant Bacillus subtilis strain WB600/pBSA 43-xylm.

Example 4: construction of beta-xyloside enzymolysis bacillus amyloliquefaciens recombinant strain

(1) Preparation of Bacillus amyloliquefaciens CGMCC No.11218 competence

Firstly, activating strains, streaking on a three-region of an anti-LB-free solid culture medium, and culturing for 24 hours at 37 ℃;

② selecting a single colony to be inoculated in LBS culture medium, culturing for 12h at 37 ℃ and 220 rpm;

③ inoculating the seed liquid into 100mL LBS culture medium with 2 percent of inoculation amount, culturing at 37 ℃ and 220rpm for 2-3h to OD₆₀₀＝0.4-0.6；

Fourthly, centrifuging for 10min at 5000rpm by using a low-temperature centrifuge (4 ℃), and discarding the supernatant;

fifthly, resuspending the thalli with 30mL of washing buffer (0.5M sorbitol, 0.5M mannitol, 10% glycerol), centrifuging for 10min at a low temperature of 4 ℃ by a low-temperature centrifuge (5000 rpm), and discarding the supernatant;

sixthly, repeating the step five, and washing for 3 times;

seventhly, resuspending the thallus with 10mL of buffer (0.5M sorbitol, 0.5M mannitol, 10% glycerol, 14% PEG 6000);

packing into 100 microliter tube and storing at-80 deg.c.

(2) Electro-transformation of bacillus amyloliquefaciens

Firstly, cleaning an electric revolving cup by 75% alcohol;

② transferring 10ng recombinant plasmid pBSA43-xylm and 100 μ L competent mixture into an electric rotor for ice bath for 2 min;

2100 ℃ 2500V, immediately adding 1mL of recovery liquid (LB +0.5M sorbitol +0.38M mannitol) after electric shock for 4-6ms, recovering for 3h at 37 ℃ and 220rpm, and coating on a flat plate containing Kan resistance;

fourthly, selecting a transformant, extracting a plasmid, and carrying out enzyme digestion verification (shown as a 2-lane in figure 2) to obtain the bacillus amyloliquefaciens recombinant strain CGMCC No.11218/pBSA 43-xylm.

Example 5: construction of recombinant strain of beta-xylosidase Bacillus licheniformis

Adding 60 mu L of TCCC11965 competent cells and 1 mu L (50 ng/. mu.L) of pBSA43-xylm into a precooled 1mL electric rotating cup, uniformly mixing and carrying out ice bath for 5min, setting parameters (25 mu F, 200 omega, 4.5-5.0ms), shocking once, immediately adding 1mL of recovery culture medium (LB +0.5mol/L sorbitol +0.5mol/L mannitol), uniformly mixing, sucking into a 1.5mLEP tube, shaking and culturing for 3h at 37 ℃, leaving 200 mu L of recovery after centrifugation, coating on an LB plate with Kan resistance, culturing for 24h at 37 ℃, picking up a transformant, extracting plasmids, carrying out enzyme digestion verification (shown as a 3 lane in figure 2), and obtaining the Bacillus licheniformis recombinant strain TCCC11965/pBSA 43-xylm.

Example 6: expression and preparation of beta-xylosidase with improved enzyme activity in bacillus subtilis recombinant bacteria

1. Inoculating the recombinant bacillus subtilis WB600/pBSA43-xylm into LB liquid culture medium containing kanamycin (50 mug/mL), and culturing at 37 ℃ and 220r/min overnight;

2. transferring the strain into 50mL LB culture medium according to the inoculum size of 1%, culturing at 37 ℃ at 220r/min for 48h, centrifuging and collecting fermentation supernatant to obtain E455G crude enzyme liquid with improved enzyme activity;

3. and (3) separating and removing foreign proteins from the collected fermentation broth supernatant by using ammonium sulfate with the saturation of 25%, increasing the saturation to 65%, and precipitating target proteins. Dissolving with 0.02mol/L Tris-HCl (pH7.0), dialyzing to remove salt, loading the active component obtained after dialysis and desalination to a cellulose ion exchange chromatographic column, eluting unadsorbed protein with the same buffer solution, then carrying out gradient elution with 0.02mol/L Tris-HCl (pH7.0) buffer solution containing 0.1-1 mol/L NaCl, and collecting the target protein. The active fraction obtained by ion exchange was equilibrated with 0.02mol/L Tris-HCl (pH7.0) buffer containing 0.15mol/L NaCl, loaded onto sephadex g25 gel column, eluted with the same buffer at 0.5mL/min to obtain purified enzyme solution, and the purified enzyme solution was subjected to SDS-PAGE analysis, resulting in a single band of 61kDa in size, as shown in lane 2 of FIG. 3. And freeze-drying the purified enzyme solution to obtain the high-activity E455G enzyme powder.

Example 7: expression and preparation of beta-xylosidase with improved enzyme activity in bacillus amyloliquefaciens

1. The plate three-region streak activation recombinant strain CGMCC No.11218/pBSA 43-xylm;

2. selecting a single colony, inoculating the single colony in 50mL of Kan-containing resistant seed culture medium, and carrying out shake culture at 37 ℃ and 220r/min for 12 h;

3. inoculating the strain into a fermentation medium containing kanamycin resistance at an inoculum size of 2%, and performing fermentation culture at 37 ℃ and 220r/min for 48 h.

4.12000rpm, centrifuging for 10min, and collecting fermentation supernatant to obtain crude enzyme solution of XYL mutant E455G;

5. collecting the fermentation supernatant, precipitating the enzyme protein by fractional salting-out method by the method of example 6, collecting the protein precipitate, dissolving, dialyzing to remove salt, performing ion exchange chromatography and gel chromatography to obtain the eluted enzyme solution, and performing vacuum freeze-drying to obtain the high-activity E455G enzyme powder.

Example 8: bacillus licheniformis for preparing beta-xylosidase with improved enzyme activity

1. Plate three-region streaking activated recombinant strain TCCC11965/pBSA 43-xylm;

3. inoculating the strain into a fermentation medium containing kanamycin resistance at an inoculum size of 2%, and performing fermentation culture at 37 ℃ and 220r/min for 48 hours.

5. then collecting the fermentation supernatant, precipitating the enzyme protein by using a fractional salting-out method by adopting the method of example 6, collecting the protein precipitate, dissolving, dialyzing to remove salt, carrying out ion exchange chromatography and gel chromatography to obtain an eluted enzyme solution, and carrying out vacuum freeze drying to obtain the high-activity E455G enzyme powder.

Example 9: beta-xylosidase enzyme activity assay

1. Principle for measuring enzyme activity of beta-xylosidase

Under a certain condition, the beta-xylosidase can hydrolyze a glycosidic bond in p-nitrophenyl-beta-D-xyloside (pNPX) to generate p-nitrophenol (namely pNP), the p-nitrophenol is yellow under an alkaline condition, an enzyme labeling instrument is used for measuring absorbance at 405nm, the content of the corresponding p-nitrophenol is calculated, and then the enzyme activity of the beta-xylosidase is calculated.

2. Definition of beta-xylosidase enzyme Activity

One unit of enzyme activity (U) is defined as the amount of enzyme required to hydrolyze the substrate pNPX to 1. mu. mol p-nitrophenol (pNP) per minute under certain reaction conditions.

The enzyme activity formula is as follows: enzyme activity (U) ═ c × V/(t × V)₁)]×N

Note: v: the total volume of the reaction system, in this study, was 0.2 mL;

V₁: the volume of the enzyme solution taken was 0.05mL in this study;

c: represents the concentration of pNP (. mu. mol/mL);

t: represents the time taken from the start to the end of the reaction, 10min in this study;

n: dilution factor of enzyme solution.

3. The enzyme activity determination method of beta-xylosidase adopted by the invention and the step 50 mu L of reaction liquid are insulated for 1min at 30 ℃ and pH7.0, 50 mu L of enzyme liquid is absorbed and added, after the reaction is carried out for 10min at 30 ℃, 100 mu L of 2mol/L sodium carbonate solution is added into the reaction system to terminate the reaction, and an enzyme-labeling instrument is adopted to detect the OD value at 405 nm. The samples contained 3 sets of replicates.

Blank control: the enzyme solution was treated at 100 ℃ for 10min to inactivate the enzyme, and the heat-inactivated enzyme solution was used as a control, and the reaction system and method were as described above.

4. The results of the enzyme activity measurements are shown in the following table (taking crude E455G enzyme solutions prepared in examples 6, 7 and 8 and crude wild type XYL enzyme solution prepared in the same manner as the above as experimental subjects):

note: in the preparation of the crude enzyme solution of wild-type XYL, a recombinant strain of wild-type enzyme was first constructed in the same manner as in examples 3, 4 and 5, and then a crude enzyme solution of wild-type enzyme was prepared in the same manner as in examples 6, 7 and 8.

Example 10: determination of enzymatic Properties

The enzymatic properties of wild-type XYL and mutant E455G were determined using the bacillus subtilis expression system enzyme activity assay sample and enzyme activity assay method used in example 9, and the results are shown below, in detail in fig. 4-7:

(2) Optimum reaction temperature: at 30 ℃.

(3) Temperature stability: and (3) respectively preserving the temperature in water bath at 0, 10, 20, 30 and 40 ℃ for 2h under the condition of pH7.0, and then measuring the enzyme activity. After 2h of incubation at 0, 10 and 20 ℃, the residual activity of the XYL mutant E455G and the wild type was maintained above 95%; after incubation for 2h at 30 ℃ and 40 ℃, the residual activity of XYL mutant E455G was 91.02% and 60%, respectively, corresponding to 90.08% and 63.98% for the wild type.

(4) Optimum pH: 7.0.

(5) pH stability: the enzyme activity was measured after incubation at 4 ℃ for 7d in buffers at pH 6.0, 7.0, 8.0, 9.0 and 10.0, respectively. The stability under the conditions of pH7.0, 8.0 and 9.0 is better, the residual enzyme activity of the mutant E455G is 79.55%, 83.27% and 70.19% respectively, and the residual enzyme activity of the wild type is 83.4%, 84.85% and 65.92% respectively. In contrast, at pH 6.0 and pH 10.0, the residual activity of the two was about 3% and 19%, respectively.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the patent. It should be noted that, for those skilled in the art, various changes, combinations and improvements can be made in the above embodiments without departing from the patent concept, and all of them belong to the protection scope of the patent. Therefore, the protection scope of this patent shall be subject to the claims.

SEQUENCE LISTING

<110> Tianjin science and technology university

<120> a novel beta-xylosidase and a process for its preparation

<130> 1

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 534

<212> PRT

<213> Bacillus pumilus (Bacillus pumilus) TCCC 11573

<400> 1

Met Lys Ile Thr Asn Pro Val Leu Lys Gly Phe Asn Pro Asp Pro Ser

1 5 10 15

Ile Cys Arg Val Gly Glu Asp Tyr Tyr Met Ala Val Ser Thr Phe Glu

20 25 30

Trp Phe Pro Gly Val Gln Ile Tyr His Ser Arg Asp Leu Val His Trp

35 40 45

Arg Leu Ala Ala Arg Pro Leu Gln Lys Thr Ser Gln Leu Asp Met Lys

50 55 60

Gly Asn Pro Asp Ser Gly Gly Val Trp Ala Pro Cys Leu Ser Tyr Ala

65 70 75 80

Asp Gly Gln Phe Trp Leu Ile Tyr Ser Asp Ile Lys Val Val Asp Gly

85 90 95

Pro Phe Lys Asp Gly His Asn Tyr Leu Val Thr Ala Ser Glu Val Asp

100 105 110

Gly Asp Trp Ser Glu Pro Val Arg Leu Asn Ser Ser Gly Phe Asp Pro

115 120 125

Ser Leu Phe His Asp Gln Ser Gly Lys Lys Tyr Val Leu Asn Met Leu

130 135 140

Trp Asp His Arg Glu Lys His His Ser Phe Ala Gly Ile Ala Leu Gln

145 150 155 160

Glu Tyr Ser Val Thr Glu Lys Lys Leu Ile Gly Gln Arg Lys Val Ile

165 170 175

Phe Lys Gly Thr Pro Ile Lys Leu Thr Glu Ala Pro His Leu Tyr His

180 185 190

Ile Gly Asp Tyr Tyr Tyr Leu Leu Thr Ala Glu Gly Gly Thr Arg Tyr

195 200 205

Glu His Ala Ala Thr Ile Ala Arg Ser Ser Gln Ile Glu Gly Pro Tyr

210 215 220

Glu Val His Pro Asp Asn Pro Ile Leu Ser Ala Phe His Ala Pro Glu

225 230 235 240

His Pro Leu Gln Lys Cys Gly His Ala Ser Ile Val Gln Thr His Thr

245 250 255

Asn Glu Trp Tyr Leu Ala His Leu Thr Gly Arg Pro Ile Gln Ser Ser

260 265 270

Lys Glu Ser Ile Phe Gln Gln Arg Gly Trp Cys Pro Leu Gly Arg Glu

275 280 285

Thr Ala Ile Gln Lys Leu Glu Trp Lys Asp Gly Trp Pro Tyr Val Val

290 295 300

Gly Gly Lys Glu Gly Ala Leu Glu Val Glu Ala Pro Ala Ile Asn Glu

305 310 315 320

Lys Val Phe Ala Pro Thr His His Thr Val Asp Glu Phe Lys Glu Ser

325 330 335

Thr Leu Asn Arg His Phe Gln Thr Leu Arg Ile Pro Phe Thr Asp Gln

340 345 350

Ile Gly Ser Leu Thr Glu Lys Pro Gln His Leu Arg Leu Tyr Gly Gln

355 360 365

Glu Ser Leu Thr Ser Lys Phe Thr Gln Ala Phe Val Ala Arg Arg Trp

370 375 380

Gln Ser Phe Tyr Phe Glu Ala Glu Thr Ala Val Ser Phe Phe Pro Glu

385 390 395 400

Asn Phe Gln Gln Ala Ala Gly Leu Val Asn Tyr Tyr Asn Thr Glu Asn

405 410 415

Trp Thr Ala Leu Gln Val Thr Tyr Asp Glu Glu Leu Gly Arg Ile Leu

420 425 430

Glu Leu Ser Val Cys Gln Asn Leu Ser Phe Ser Gln Pro Leu Thr Gln

435 440 445

Lys Ile Val Ile Pro Glu Glu Val Thr Tyr Val Tyr Leu Lys Val Thr

450 455 460

Val Gln Lys Glu Thr Tyr Thr Tyr Ser Tyr Ser Phe Asp Gln Arg Glu

465 470 475 480

Trp Lys Glu Ile Asp Val Ser Phe Glu Ser Ser His Leu Ser Asp Asp

485 490 495

Phe Ile Arg Gly Gly Gly Phe Phe Thr Gly Ala Phe Val Gly Met Gln

500 505 510

Cys Gln Asp Thr Ser Gly Glu Arg Leu Pro Ala Asp Phe Asn Tyr Phe

515 520 525

Arg Tyr Glu Glu Thr Glu

530

<210> 2

<211> 1602

<212> DNA

<213> Bacillus pumilus (Bacillus pumilus) TCCC 11573

<400> 2

atgaaaatta ccaatccagt gctcaaaggg tttaacccgg acccaagtat ttgccgtgta 60

ggagaagatt attacatggc ggtctctaca tttgaatggt ttccaggggt gcaaatttat 120

cattcgaggg atttagtcca ttggcggctt gctgcgcgtc ctttgcaaaa aacgtcgcag 180

ctggacatga aggggaatcc tgattctggc ggagtatggg caccgtgcct aagctatgca 240

gatggtcagt tttggctcat ttattcagat atcaaagtag tggatggtcc atttaaagat 300

ggtcataatt atttggtcac ggcaagtgaa gtggatggtg attggagtga gccggtccgt 360

ctcaatagct ctggctttga tccctcttta tttcatgatc aaagcggcaa gaaatacgtc 420

ttaaatatgc tgtgggatca tagggaaaag caccattcat ttgcgggtat tgccctgcag 480

gaatatagcg tgacggaaaa gaaactcatt ggtcagcgga aggtcatttt taaaggcacg 540

ccgataaaat tgacagaagc gccgcatctt tatcacattg gtgattacta ttatttatta 600

acagcagaag gaggtacccg gtacgagcat gcggcaacaa ttgcccgttc ctcgcagatt 660

gaagggcctt atgaggttca tcctgataac cccattttaa gtgcttttca cgcacctgaa 720

catccgcttc aaaaatgcgg gcatgcttcc atcgttcaaa cgcatacaaa tgaatggtat 780

ttggctcatc tcactggccg ccccattcaa tcaagcaagg aatctatttt tcaacagaga 840

gggtggtgtc ctttaggaag agaaacagcg attcaaaagc ttgaatggaa ggatggctgg 900

ccgtatgttg tgggcggaaa agagggggcg ctggaggttg aagcgccagc gataaacgaa 960

aaggtttttg ctcctacaca ccatacagtc gatgaattta aagaatcaac gttaaataga 1020

cacttccaaa cattaagaat cccttttact gatcagatcg gttcattaac ggaaaaacct 1080

cagcatttaa ggttatacgg tcaggaatct ctaacatcta agtttaccca agctttcgtt 1140

gcaaggcgct ggcaaagctt ttattttgaa gcagagacag ctgtttcgtt ctttccagag 1200

aattttcagc aagccgctgg tcttgtgaat tattataata cggaaaattg gacagcgctt 1260

caggtgacat atgacgagga acttggccgc attcttgaac tatctgtctg tcaaaacctt 1320

tccttttctc agccgttgac acaaaaaatc gtcattccag aggaggtcac gtatgtgtat 1380

ttaaaagtga ccgttcagaa agagacatat acctattctt attcttttga tcaaagagaa 1440

tggaaggaaa ttgatgtgtc atttgaatca agccatttat ccgatgactt cattcgagga 1500

gggggatttt ttacaggggc atttgtcggc atgcagtgcc aggatacaag cggcgagcgt 1560

cttcctgctg atttcaacta tttccgttat gaggaaacag aa 1602

<210> 3

<211> 534

<212> PRT

<213> Artificial sequence

<400> 3

Met Lys Ile Thr Asn Pro Val Leu Lys Gly Phe Asn Pro Asp Pro Ser

1 5 10 15

Ile Cys Arg Val Gly Glu Asp Tyr Tyr Met Ala Val Ser Thr Phe Glu

20 25 30

Trp Phe Pro Gly Val Gln Ile Tyr His Ser Arg Asp Leu Val His Trp

35 40 45

Arg Leu Ala Ala Arg Pro Leu Gln Lys Thr Ser Gln Leu Asp Met Lys

50 55 60

Gly Asn Pro Asp Ser Gly Gly Val Trp Ala Pro Cys Leu Ser Tyr Ala

65 70 75 80

Asp Gly Gln Phe Trp Leu Ile Tyr Ser Asp Ile Lys Val Val Asp Gly

85 90 95

Pro Phe Lys Asp Gly His Asn Tyr Leu Val Thr Ala Ser Glu Val Asp

100 105 110

Gly Asp Trp Ser Glu Pro Val Arg Leu Asn Ser Ser Gly Phe Asp Pro

115 120 125

Ser Leu Phe His Asp Gln Ser Gly Lys Lys Tyr Val Leu Asn Met Leu

130 135 140

Trp Asp His Arg Glu Lys His His Ser Phe Ala Gly Ile Ala Leu Gln

145 150 155 160

Glu Tyr Ser Val Thr Glu Lys Lys Leu Ile Gly Gln Arg Lys Val Ile

165 170 175

Phe Lys Gly Thr Pro Ile Lys Leu Thr Glu Ala Pro His Leu Tyr His

180 185 190

Ile Gly Asp Tyr Tyr Tyr Leu Leu Thr Ala Glu Gly Gly Thr Arg Tyr

195 200 205

Glu His Ala Ala Thr Ile Ala Arg Ser Ser Gln Ile Glu Gly Pro Tyr

210 215 220

Glu Val His Pro Asp Asn Pro Ile Leu Ser Ala Phe His Ala Pro Glu

225 230 235 240

His Pro Leu Gln Lys Cys Gly His Ala Ser Ile Val Gln Thr His Thr

245 250 255

Asn Glu Trp Tyr Leu Ala His Leu Thr Gly Arg Pro Ile Gln Ser Ser

260 265 270

Lys Glu Ser Ile Phe Gln Gln Arg Gly Trp Cys Pro Leu Gly Arg Glu

275 280 285

Thr Ala Ile Gln Lys Leu Glu Trp Lys Asp Gly Trp Pro Tyr Val Val

290 295 300

Gly Gly Lys Glu Gly Ala Leu Glu Val Glu Ala Pro Ala Ile Asn Glu

305 310 315 320

Lys Val Phe Ala Pro Thr His His Thr Val Asp Glu Phe Lys Glu Ser

325 330 335

Thr Leu Asn Arg His Phe Gln Thr Leu Arg Ile Pro Phe Thr Asp Gln

340 345 350

Ile Gly Ser Leu Thr Glu Lys Pro Gln His Leu Arg Leu Tyr Gly Gln

355 360 365

Glu Ser Leu Thr Ser Lys Phe Thr Gln Ala Phe Val Ala Arg Arg Trp

370 375 380

Gln Ser Phe Tyr Phe Glu Ala Glu Thr Ala Val Ser Phe Phe Pro Glu

385 390 395 400

Asn Phe Gln Gln Ala Ala Gly Leu Val Asn Tyr Tyr Asn Thr Glu Asn

405 410 415

Trp Thr Ala Leu Gln Val Thr Tyr Asp Glu Glu Leu Gly Arg Ile Leu

420 425 430

Glu Leu Ser Val Cys Gln Asn Leu Ser Phe Ser Gln Pro Leu Thr Gln

435 440 445

Lys Ile Val Ile Pro Glu Gly Val Thr Tyr Val Tyr Leu Lys Val Thr

450 455 460

Val Gln Lys Glu Thr Tyr Thr Tyr Ser Tyr Ser Phe Asp Gln Arg Glu

465 470 475 480

Trp Lys Glu Ile Asp Val Ser Phe Glu Ser Ser His Leu Ser Asp Asp

485 490 495

Phe Ile Arg Gly Gly Gly Phe Phe Thr Gly Ala Phe Val Gly Met Gln

500 505 510

Cys Gln Asp Thr Ser Gly Glu Arg Leu Pro Ala Asp Phe Asn Tyr Phe

515 520 525

Arg Tyr Glu Glu Thr Glu

530

<210> 4

<211> 1602

<212> DNA

<213> Artificial sequence

<400> 4

atgaaaatta ccaatccagt gctcaaaggg tttaacccgg acccaagtat ttgccgtgta 60

ggagaagatt attacatggc ggtctctaca tttgaatggt ttccaggggt gcaaatttat 120

cattcgaggg atttagtcca ttggcggctt gctgcgcgtc ctttgcaaaa aacgtcgcag 180

ctggacatga aggggaatcc tgattctggc ggagtatggg caccgtgcct aagctatgca 240

gatggtcagt tttggctcat ttattcagat atcaaagtag tggatggtcc atttaaagat 300

ggtcataatt atttggtcac ggcaagtgaa gtggatggtg attggagtga gccggtccgt 360

ctcaatagct ctggctttga tccctcttta tttcatgatc aaagcggcaa gaaatacgtc 420

ttaaatatgc tgtgggatca tagggaaaag caccattcat ttgcgggtat tgccctgcag 480

gaatatagcg tgacggaaaa gaaactcatt ggtcagcgga aggtcatttt taaaggcacg 540

ccgataaaat tgacagaagc gccgcatctt tatcacattg gtgattacta ttatttatta 600

acagcagaag gaggtacccg gtacgagcat gcggcaacaa ttgcccgttc ctcgcagatt 660

gaagggcctt atgaggttca tcctgataac cccattttaa gtgcttttca cgcacctgaa 720

catccgcttc aaaaatgcgg gcatgcttcc atcgttcaaa cgcatacaaa tgaatggtat 780

ttggctcatc tcactggccg ccccattcaa tcaagcaagg aatctatttt tcaacagaga 840

gggtggtgtc ctttaggaag agaaacagcg attcaaaagc ttgaatggaa ggatggctgg 900

ccgtatgttg tgggcggaaa agagggggcg ctggaggttg aagcgccagc gataaacgaa 960

aaggtttttg ctcctacaca ccatacagtc gatgaattta aagaatcaac gttaaataga 1020

cacttccaaa cattaagaat cccttttact gatcagatcg gttcattaac ggaaaaacct 1080

cagcatttaa ggttatacgg tcaggaatct ctaacatcta agtttaccca agctttcgtt 1140

gcaaggcgct ggcaaagctt ttattttgaa gcagagacag ctgtttcgtt ctttccagag 1200

aattttcagc aagccgctgg tcttgtgaat tattataata cggaaaattg gacagcgctt 1260

caggtgacat atgacgagga acttggccgc attcttgaac tatctgtctg tcaaaacctt 1320

tccttttctc agccgttgac acaaaaaatc gtcattccag agggggtcac gtatgtgtat 1380

ttaaaagtga ccgttcagaa agagacatat acctattctt attcttttga tcaaagagaa 1440

tggaaggaaa ttgatgtgtc atttgaatca agccatttat ccgatgactt cattcgagga 1500

gggggatttt ttacaggggc atttgtcggc atgcagtgcc aggatacaag cggcgagcgt 1560

cttcctgctg atttcaacta tttccgttat gaggaaacag aa 1602

<210> 5

<211> 32

<212> DNA

<213> Artificial sequence

<400> 5

cgcggatccg atgaaaatta ccaatccagt gc 32

<210> 6

<211> 40

<212> DNA

<213> Artificial sequence

<400> 6

aaggaaaaaa gcggccgctt ctgtttcctc ataacggaaa 40

Claims

1. The beta-xylosidase mutant is characterized in that the mutant is E455G, and the amino acid sequence of the mutant is shown in a sequence table SEQ ID No. 3.

2. A gene encoding the β -xylosidase mutant of claim 1.

3. The coding gene of the beta-xylosidase mutant according to claim 2, characterized in that the nucleotide sequence is shown in SEQ ID No.4 of the sequence Listing.

4. A recombinant vector or recombinant strain comprising the gene of claim 2.

5. The recombinant vector or the recombinant strain of claim 4, wherein the expression vector is pBSA43, and the host cell is Bacillus subtilis WB600 or Bacillus amyloliquefaciens CGMCC No. 11218.

6. Use of the recombinant vector or the recombinant strain according to claim 4 for the production of β -xylosidase.

7. Use of the mutant β -xylosidase according to claim 1 for hydrolyzing xylan.