CN113817758A

CN113817758A - Chitosan enzyme gene for encoding Bacillus belgii, chitosanase, preparation method and application thereof

Info

Publication number: CN113817758A
Application number: CN202111180847.9A
Authority: CN
Inventors: 王忠勇; 刘勇; 张德咏; 程菊娥; 张宇; 吴希阳; 乐昊
Original assignee: HUNAN PLANT PROTECTION INSTITUTE
Current assignee: HUNAN PLANT PROTECTION INSTITUTE
Priority date: 2021-10-11
Filing date: 2021-10-11
Publication date: 2021-12-21

Abstract

The invention discloses a chitinase gene and chitosanase for coding Bacillus belgii, a preparation method and application thereof, wherein the nucleotide sequence of the chitinase gene for coding the Bacillus belgii is shown as SEQ ID NO. 1. The encoding chitinase gene of the Bacillus belgii is used for preparing the chitosanase by using the chitinase gene of the Bacillus belgii, and the chitosanase is an extracellular enzyme after being expressed, so that the chitosanase is directly collected as a supernatant without cell disruption after induced expression.

Description

Chitosan enzyme gene for encoding Bacillus belgii, chitosanase, preparation method and application thereof

Technical Field

The invention relates to the field of bioengineering, in particular to a chitosan enzyme gene for encoding Bacillus belgii. In addition, the invention also relates to chitosanase, a preparation method and application thereof.

Background

Chitosan (chitosan) is a product obtained by removing partial N-deacetylation from chitin, has various biological characteristics of biodegradability, promotion of crop growth, improvement of crop stress resistance, no residue and the like, and is widely applied to the agricultural field. However, chitosan has large molecular weight and poor water solubility, and is not easy to be absorbed by plants; meanwhile, the chitosan has strong flocculation effect, so that the complex use of the chitosan and other preparations is seriously limited, and the large-scale application of the chitosan is further limited. In order to solve the defects, the polymerization degree of the chitosan oligosaccharide obtained by degrading chitosan is usually below 20, so that the water solubility is greatly improved, the chitosan oligosaccharide is very easy to be absorbed by plants, and the chitosan oligosaccharide has incomparable superiority.

Chitosan is degraded by a chemical method, a physical method and a biological enzyme method to produce chitosan oligosaccharide, and the biological enzyme method for preparing the chitosan oligosaccharide by hydrolyzing chitosan with chitosan (Chitosanase, EC3.2.1.132) has the characteristics of low energy consumption, strong specificity, mild reaction conditions, small environmental pollution and the like. At present, many chitosanases from fungi, bacteria, plants and other organisms have been reported. However, there are few reports on the use of Bacillus belgii for the preparation of chitosanase.

Disclosure of Invention

The invention provides a chitosan enzyme gene of Bacillus calcogenii, which aims to solve the technical problems that the existing chitosan has large polymerization degree and poor water solubility and cannot be popularized and applied in a large scale.

The technical scheme adopted by the invention is as follows:

a chitosanase gene for coding Bacillus belgii has the nucleotide sequence shown in SEQ ID No. 1.

The universal primers were designed based on the conserved sequence of the chitosan enzyme gene (NCBI accession number: OK 149223). The universal primers include a forward primer Csn (90) -F and a reverse primer Csn (670) -R. The nucleotide sequence of the forward primer Csn (90) -F is shown as SEQ ID NO: 3, the primer sequence is Csn (90) -F: CATGTGTTTTACCCTGATGATGA, the nucleotide sequence of the reverse primer Csn (670) -R is shown in SEQ ID NO: 4, primer sequence Csn (670) -R: GATTCATCAGATCGTCATAGCG are provided. The CTAB method extracted the genomic DNA of Bacillus belgii CS1 (isolated and stored from this unit). A partial fragment of the target gene was amplified using a conserved sequence primer (Csn (90) -F/Csn (670) -R) and genomic DNA as a template.

And after the PCR amplification product is purified and recovered, connecting a T vector for sequencing, and carrying out BLAST comparison on the sequence in NCBI to obtain a Bacillus beiLeisi genome sequence containing a homologous sequence. Then, by taking the genome sequence as a reference, primers with EcoRI and XholI enzyme cutting sites for amplifying the ORF fragment of the chitosanase gene are designed, wherein the primers comprise a forward primer Csn _ ORF _ F and a reverse primer Csn _ ORF _ R; the nucleotide sequence of the forward primer Csn _ ORF _ F is shown as SEQ ID NO:5, the primer sequence is Csn _ ORF _ F: CCGAATTCATGAAAATCAGCTTGAAGAA, respectively; the nucleotide sequence of the reverse primer Csn _ ORF _ R is shown as SEQ ID NO:6, the primer sequence is Csn _ ORF _ R: TGCTCGAGTTGAATAGTGAAATTACCGTAT are provided. And then using the genome DNA as a template, amplifying a complete gene sequence which codes the chitosanase of the Bacillus belgii and has enzyme cutting sites by high-fidelity PCR, wherein the nucleotide sequence is shown as SEQ ID NO. 1.

According to another aspect of the present invention, there is also provided a chitosanase of Bacillus belgii, the amino acid sequence of which is shown in SEQ ID NO. 2. Through analysis, the chitinase of the Bacillus belgii is extracellular enzyme, so that cell disruption is not needed after induction expression, and supernatant is directly collected to be the chitinase.

As shown in FIG. 1, the chitosanase of Bacillus belgii belongs to the family of glycoside hydrolase GH46, and has a molecular weight of 31.352KD and an enzymatic activity (titer) of 185U/mL. The expression level of the chitinase of Bacillus belgii was 2.5 mg/mL.

According to another aspect of the present invention, there is also provided a recombinant plasmid comprising the above-mentioned chitosan enzyme gene encoding Bacillus belgii.

Preferably, pET28a is used as a vector for the recombinant plasmid. A recombinant plasmid comprising the chitosanase gene sequence is constructed by adopting pET28a expression plasmid, and the recombinant plasmid is transformed into escherichia coli BL21(ED3) through heat shock, so as to prepare a prokaryotic recombinant expression strain for expressing the gene.

According to another aspect of the present invention, there is also provided a recombinant expression strain comprising the above recombinant plasmid.

Coli BL21(ED3) containing the recombinant plasmid was cultured in LB medium, expressed by IPTG induction, centrifuged, and the supernatant and cells were collected. And (3) carrying out protein electrophoresis analysis on SDS-PAGE gel, wherein the expression chitosanase is mainly distributed in a supernatant, so that the expression chitosanase is extracellular enzyme, and collecting the supernatant to obtain a crude enzyme solution with the activity of the chitosanase, namely the chitosanase. The content of the chitosanase in the supernatant is detected to be 2.5mg/mL by a BCA protein quantitative method.

According to another aspect of the present invention, there is also provided a method for preparing the chitosanase according to the above bacillus belgii, comprising the steps of:

recombining the genes into a pET28a vector, then transforming the vector into escherichia coli, and constructing a recombinant expression strain;

and culturing the recombinant expression strain, performing induced expression on the recombinant expression strain in IPTG (isopropyl-beta-thiogalactoside), centrifuging, and collecting supernatant to obtain the chitosanase.

According to the preparation method of the chitinase of the bacillus belgii, the chitinase of the bacillus belgii is analyzed to be extracellular enzyme, so that cell disruption is not needed after induction expression of the recombinant expression strain, and supernatant is directly collected to obtain the chitinase.

Preferably, the primers for amplifying the gene include a forward primer Csn _ ORF _ F and a reverse primer Csn _ ORF _ R; the nucleotide sequence of the forward primer Csn _ ORF _ F is shown as SEQ ID NO:5, the nucleotide sequence of the reverse primer Csn _ ORF _ R is shown as SEQ ID NO: and 6.

According to another aspect of the invention, the application of the chitosanase of the Bacillus belgii in the enzymolysis of chitosan is further provided, and the chitosanase is added into a chitosan solution for enzymolysis reaction to obtain chitosan oligosaccharide. The highest hydrolysis efficiency of chitosan (95% deacetylation degree) by the chitosan enzyme reaches 95%; the reaction temperature of the enzymolysis reaction is 30-50 ℃, the reaction pH value is 5-6.5, and the reaction time is 5-10 h. The polymerization degree of the chitosan oligosaccharide is 2-5.

The chitosanase with the enzyme activity of 9.0U and chitosan (with the deacetylation degree of 95%) solution with the enzyme activity of 1 g/L-5 g/L are directly mixed, the reaction temperature is 30-50 ℃, the reaction pH value is 5-6.5, the enzymolysis is carried out under the condition that the reaction time is 5-10 h, and the highest hydrolysis efficiency of the chitosanase on the chitosan (with the deacetylation degree of 95%) reaches 95%. The polymerization degree of the finally obtained chitosan oligosaccharide is 2-5, is obviously lower than that of chitosan, and the molecular weight of the chitosan oligosaccharide is small, so that the water solubility is greatly improved, the chitosan oligosaccharide is easy to absorb by plants, and the application of the chitosan oligosaccharide is expanded. Preferably, the optimum reaction temperature of the enzymolysis reaction is 40 ℃, and the optimum reaction pH value is 5.5.

According to another aspect of the invention, the application of the chitosan oligosaccharide in growth promotion of the pepper is further provided, wherein a chitosan oligosaccharide solution is prepared, and the chitosan oligosaccharide solution is sprayed on the pepper seedling stage. The concentration of the chitosan oligosaccharide solution is 0.002 g/L-1 g/L. The chitosan oligosaccharide solution is directly sprayed on pepper seedlings, the pepper seedlings have 3-5 true leaves, the chitosan oligosaccharide solution is sprayed for the first time after 10 days of transplantation, the chitosan oligosaccharide solution is sprayed for one time every 10 days, the chitosan oligosaccharide solution is sprayed for 3 times totally, and the fresh weight and the number of buds are counted on the 15 th day after the third spraying. Preferably, the concentration of the chitosan oligosaccharide solution is 0.002g/L, the fresh weight of the hot pepper treated by the chitosan oligosaccharide solution is improved by 60.5%, the number of buds is improved by 86%, and the growth of the hot pepper is obviously promoted.

The invention has the following beneficial effects:

the encoding chitinase gene of the Bacillus belgii is used for preparing the chitosanase by using the chitinase gene of the Bacillus belgii, and the chitosanase is an extracellular enzyme after being expressed, so that the chitosanase is directly collected as a supernatant without cell disruption after induced expression.

The chitosanase of the Bacillus belgii has lower reaction temperature, almost the same enzymolysis efficiency between 30 ℃ and 50 ℃, and the lower the reaction temperature is, the more the stability of the chitosanase can be kept, and meanwhile, the energy consumption is saved. Chitosan oligosaccharide generated by chitosan enzymolysis of the chitosan glycanase can obviously promote the growth of crops under low concentration, is particularly suitable for pepper, and has higher application value.

In addition to the objects, features and advantages described above, other objects, features and advantages of the present invention are also provided. The present invention will be described in further detail below with reference to the accompanying drawings.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this application, illustrate embodiments of the invention and, together with the description, serve to explain the invention and not to limit the invention. In the drawings:

FIG. 1 is an SDS-PAGE gel electrophoresis of the chitosanase of the present invention

FIG. 2 is a graph showing the reaction temperature profile of the chitosanase of the present invention, in which chitosanase oligosaccharide is substituted for a watchcase oligosaccharide;

FIG. 3 is a reaction pH profile of the chitosanase of the present invention, wherein Chitosan oligosaccharide is substituted for a watchcase oligosaccharide;

FIG. 4 is a graph showing the distribution of the degree of polymerization of chitosan oligosaccharide produced by the hydrolysis of chitosan by chitosanase of the present invention;

FIG. 5 is a graph showing the effect of chitosanase of the present invention on the flower bud of Capsicum annuum, wherein Blossom bud represents the flower bud;

FIG. 6 is a graph showing the effect of chitosanase of the present invention on Fresh weight of pepper, wherein Fresh weight is represented by Fresh weight.

Detailed Description

It should be noted that the embodiments and features of the embodiments in the present application may be combined with each other without conflict. The present invention will be described in detail below with reference to the embodiments with reference to the attached drawings.

Examples

LB liquid medium: peptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L, solid medium with 2g/L agar, pH 7.0.

Example 1

Obtaining of Chitosan Gene

The universal primers were designed based on the conserved sequence of the chitosan enzyme gene (NCBI accession number: OK 149223). The universal primers include a forward primer Csn (90) -F and a reverse primer Csn (670) -R. The nucleotide sequence of the forward primer Csn (90) -F is shown as SEQ ID NO: 3, the primer sequence is Csn (90) -F: CATGTGTTTTACCCTGATGATGA, the nucleotide sequence of the reverse primer Csn (670) -R is shown in SEQ ID NO: 4, the primer sequence is Csn (670) -R: GATTCATCAGATCGTCATAGCG are provided.

The CTAB method was used to extract the genomic DNA of Bacillus belgii CS1 (isolated and stored in this unit). A partial fragment of the target gene was amplified using a conserved sequence primer (Csn (90) -F/Csn (670) -R) and genomic DNA as a template. The total volume of the PCR reaction system was 20. mu.L, 2 XTaq Max Master Mix 10. mu.L, genomic DNA template 0.5. mu.L, Csn (90) -F primer 1. mu.L, Csn (670) -R primer 1. mu.L, ddH₂O7.5. mu.L. The PCR reaction program is: pre-denaturation at 95 ℃ for 5min, followed by denaturation at 94 ℃ for 30sec, annealing at 53 ℃ for 30sec, extension at 72 ℃ for 30sec, 30 cycles, and final extension at 72 ℃ for 2 min.

And after the PCR amplification product is purified and recovered, connecting a T vector for sequencing, and carrying out BLAST comparison on the sequence in NCBI to obtain a Bacillus beiLeisi genome sequence containing a homologous sequence. Then, by taking the genome sequence as a reference, primers with EcoRI and XholI enzyme cutting sites for amplifying the ORF fragment of the chitosanase gene are designed, wherein the primers comprise a forward primer Csn _ ORF _ F and a reverse primer Csn _ ORF _ R; the nucleotide sequence of the forward primer Csn _ ORF _ F is shown as SEQ ID NO:5, the primer sequence is Csn _ ORF _ F: CCGAATTCATGAAAATCAGCTTGAAGAA, respectively; the nucleotide sequence of the reverse primer Csn _ ORF _ R is shown as SEQ ID NO:6, the primer sequence is Csn _ ORF _ R: TGCTCGAGTTGAATAGTGAAATTACCGTAT are provided. Then using genome DNA as template, high-fidelity PCR amplifying complete gene sequence with enzyme cutting site and coding chitinase of Bacillus belgii, its nucleotide sequenceShown as SEQ ID NO. 1. The total volume of PCR reaction was 50. mu.L, 5. mu.L of 10 XTop Taq buffer, 1. mu.L of genomic DNA template, 4. mu.L of dNTPs, 1. mu.L of Csn _ ORF _ F primer, 1. mu.L of Csn _ ORF _ R primer, 1. mu.L of Top Taq DNA polymerase, ddH₂O37. mu.L. The PCR amplification reaction program is as follows: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 30sec, annealing at 54 deg.C for 30sec, and extension at 72 deg.C for 1min, and final extension at 72 deg.C for 2min after 30 cycles.

Example 2

Construction of recombinant plasmid

The pET28a plasmid and the gene fragment with the restriction enzyme cutting site are respectively cut by restriction enzymes EcoRI and XholI, the cut products are respectively purified by a nucleic acid purification and recovery kit, and the gene fragment and the linearized pET28a vector are connected by using T4 DNA ligase. A connection system: linearized pET28a vector 2. mu.L, gene fragment 2. mu.L, 10 XT 4 DNA Ligase buffer 1. mu.L, T4 DNA Ligase 1. mu.L, ddH₂O4. mu.L, and connecting overnight at 4 ℃ to obtain a connection product, namely a recombinant plasmid.

Example 3

Construction of recombinant expression strains

The plasmid transformation was performed by heat shock method, 10. mu.L of overnight ligated recombinant plasmid at 4 ℃ was mixed with 100. mu.L of BL21(DE3) competent cells and then ice-cooled for 30min, then heat shock in 42 ℃ water bath for 45sec, and rapidly transferred to ice-cooled for 2min, adding 400. mu.L of fresh LB liquid medium on an ultra-clean bench, mixing well, and shake-culturing at 37 ℃ and 200rpm for 1 h. And after the culture is finished, taking 200 mu L of the culture medium on an ultra-clean bench to a solid LB flat plate containing 50 mu g/mL kanamycin sulfate, uniformly coating the solid LB flat plate, blow-drying water, culturing the solid LB flat plate in a constant temperature box at 37 ℃ for 12-16 h, selecting positive transformants by colony PCR, and obtaining the prokaryotic recombinant expression strain of the chitosanase after the positive transformants are subjected to shake bacteria sequencing verification to be correct.

Example 4

Inducible expression of chitosanase

The prokaryotic recombinant expression strain with correct sequencing verification in example 3 is streaked on an LB plate at 37 ℃ for overnight culture, and a single colony is picked and inoculated into a fresh LB (50 mu g/mL of kanamycin sulfate-containing) liquid culture medium and is shaken at 37 ℃ and 200rpm for overnight culture. Inoculating the strain into a fresh LB liquid culture medium containing 50 mu g/mL of carramycin sulfate according to the inoculation amount of 2 percent, culturing under the same condition until the density of the strain OD600 is 0.5-0.6, and adding 0.2mmol/L of IPTG to induce and express for 4 hours. Centrifuging at 4 deg.C and 10000rpm for 5min, and collecting supernatant to obtain chitosanase solution.

Detection of chitosanase

(1) Detection of chitosanase concentration

The chitosanase solution uses a BCA protein content detection kit to detect the expression quantity of the chitosanase, culture supernatant liquid of escherichia coli transformed with pET28a plasmid and treated by the same induction condition is used as a control, and bovine serum albumin is used as a standard sample to prepare a standard curve.

(2) Chitosan enzyme Activity assay

Dissolving 100 mu L of chitosan solution with the concentration of 10g/L in 850 mu L of 0.2mol/L acetic acid-sodium acetate buffer solution with the pH value of 5.5 in a 2mL plastic centrifuge tube, adding 50 mu L of chitosan solution, uniformly mixing, obtaining the final concentration of chitosan of 1g/L, and carrying out water bath at 40 ℃ for 4h to obtain hydrolysate. Adding 10 μ L of hydrolysate into another 2mL plastic centrifuge tube, adding 490 μ L of distilled water, mixing, adding 1mL of potassium ferricyanide color developing solution, water bathing at 90 deg.C for 15min, cooling in ice water bath, and measuring OD₄₂₀。

A standard curve was prepared using D-glucosamine hydrochloride as a standard. One unit of enzyme activity (U) is defined as the amount of enzyme required to produce a reducing sugar equivalent to 1. mu. mol glucosamine per minute per ml of enzyme solution under the above conditions.

The detection result of the concentration of the chitosanase shows that the expression amount of the chitosanase is 2.5 mg/mL.

As a result of the chitosan enzyme activity measurement, the enzyme activity of the chitosan enzyme is 185U/mL.

Example 5

Biochemical Properties of chitosanase

(1) Reaction temperature of chitosanase

The chitosanase solution obtained in example 4 was subjected to water bath at 30-80 deg.C (10 deg.C) to determine the yield of chitooligosaccharide produced by hydrolyzing 1g/L chitosan per unit time in the same volume of chitosanase solution, and the hydrolysis temperature curve and the optimum hydrolysis temperature of the enzyme were determined according to the content of chitooligosaccharide produced.

(2) Reaction pH of chitosanase

Taking a certain amount of crude enzyme solution, respectively carrying out reaction in acetic acid-sodium acetate buffer solution with the pH value of 4.5-7.0 (the pH interval is 0.5 unit), and measuring the content of chitosan oligosaccharide under different pH values to determine the hydrolysis pH curve and the optimal pH value of the enzyme.

As shown in FIG. 2, the reaction temperature of the chitosanase is 30 ℃ to 50 ℃, the enzymolysis efficiency is almost the same, and the optimal reaction temperature is 40 ℃.

As shown in FIG. 3, the reaction pH of the chitosanase was 5 to 6.5, and the optimum reaction pH was 5.5.

Example 6

Measurement of degree of polymerization of Chitosan oligosaccharide

In a 2mL plastic centrifuge tube, 100 mu L of 10g/L chitosan solution is added into 850 mu L of 0.2mol/L acetic acid-sodium acetate buffer solution with pH5.5, 50 mu L of chitosan solution is added and mixed evenly, the final concentration of chitosan is 1g/L, and the mixture is subjected to water bath at 40 ℃ for 24h to obtain a hydrolysate, namely chitosan oligosaccharide. And (3) performing thin-layer chromatography on the chitosan oligosaccharide by adopting a G silica gel plate, and determining the polymerization degree interval of the hydrolysate by taking the mixed standard chitosan oligosaccharide with the polymerization degree of 1-6 as a reference.

As shown in FIG. 4, the polymerization degree range of the chitosan oligosaccharide after the hydrolysis of the chitosanase is 2-5.

Example 7

Growth promotion effect of chitosanase on pepper

Sequentially diluting 2g/L chitosan oligosaccharide solution generated by hydrolysis by 400, 600, 800, 1000, 1500 and 2000 times, and respectively spraying chili seedlings by taking 0.2mol/L acetic acid-sodium acetate buffer solution with pH of 5.5 as a blank control and taking 0.5g/L commercial amino oligosaccharide powder solution as a positive control. 5 plants and 4 pieces of true-leaf pepper seedlings in each treatment group are sprayed for the first time after being transplanted for 10 days, then the seedlings are sprayed for the first time every 10 days, the seedlings are sprayed for 3 times totally, and the fresh weight and the number of buds of each treatment group are counted on the 15 th day after the seedlings are sprayed for the third time.

As shown in figures 5 and 6, the chitosan oligosaccharide generated by hydrolysis obviously promotes the growth of the peppers, the fresh weight and the number of buds of the peppers treated by different diluents of the chitosan oligosaccharide are both obviously higher than those of blank controls and amino-oligosaccharide, wherein when the concentration of the chitosan oligosaccharide solution is 0.002g/L, the fresh weight of the peppers treated by the chitosan oligosaccharide solution is improved by 60.5 percent (the calculation formula (treatment group value-control group value)/treatment group value) multiplied by 100 percent), and the number of the buds is improved by 86 percent, namely the growth of the peppers is obviously promoted.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> plant protection institute of Hunan province

<120> chitosanase gene and chitosanase encoding Bacillus belgii, preparation method and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 837

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaaaatca gcttgaagaa aaaagcaggt ttttggaaga agacggcggt ttcgtcactt 60

attttcacca tgttttttac cctgatgatg agcggtacgg tttttgcggc cgggctgaat 120

acggatcaga agcgccgggc ggaacagctg accagcatct ttgaaaacgg aaagacggaa 180

atccaatacg gatatgttga agcgttggat gacggaagag gttacacttg cgggcgggcc 240

ggctttacga cggctaccgg agatgcgctg gaagtagtcg aagtatacac gaaagcggtg 300

ccgaataaca aattgaaaaa gtatttgcct gaattgcgtc gtcttgcgaa ggacgaaagc 360

gatgacatca gcaatctgaa aggattcgct tctgcttggc gctcacttgg caatgataaa 420

gccttccgcg ctgcccaaga taaggtaaat gacagcttgt attatcagcc ggcgatgaaa 480

cgttcagaaa atgccggact gaaaacggcc ttggcaaaag cggtgatgta cgatacggtg 540

attcagcatg gcgacggcga tgatccagac tccttttatg ccctgattaa acgcacgaac 600

aaaaaaatgg gcgggtcacc gaaagatgga attgatgaga agaaatggct caataaattc 660

ttggatgtgc gctatgacga tctgatgaat ccgtcagatg aggacactca ggatgaatgg 720

agagaatcgg ttgcccgtgt cgacgttttc cgcgatattg tcaaagagaa gaactacaat 780

ttaaacgggc cgattcatgt ccggtcaagc gaatacggta atttcactat tcaataa 837

<210> 2

<211> 278

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Leu Ile Ser Leu Leu Leu Leu Ala Gly Pro Thr Leu Leu Thr Ala

1 5 10 15

Val Ser Ser Leu Ile Pro Thr Met Pro Pro Thr Leu Met Met Ser Gly

20 25 30

Thr Val Pro Ala Ala Gly Leu Ala Thr Ala Gly Leu Ala Ala Ala Gly

35 40 45

Gly Leu Thr Ser Ile Pro Gly Ala Gly Leu Thr Gly Ile Gly Thr Gly

50 55 60

Thr Val Gly Ala Leu Ala Ala Gly Ala Gly Thr Thr Cys Gly Ala Ala

65 70 75 80

Gly Pro Thr Thr Ala Thr Gly Ala Ala Leu Gly Val Val Gly Val Thr

85 90 95

Thr Leu Ala Val Pro Ala Ala Leu Leu Leu Leu Thr Leu Pro Gly Leu

100 105 110

Ala Ala Leu Ala Leu Ala Gly Ser Ala Ala Ile Ser Ala Leu Leu Gly

115 120 125

Pro Ala Ser Ala Thr Ala Ser Leu Gly Ala Ala Leu Ala Pro Ala Ala

130 135 140

Ala Gly Ala Leu Val Ala Ala Ser Leu Thr Thr Gly Pro Ala Met Leu

145 150 155 160

Ala Ser Gly Ala Ala Gly Leu Leu Thr Ala Leu Ala Leu Ala Val Met

165 170 175

Thr Ala Thr Val Ile Gly His Gly Ala Gly Ala Ala Pro Ala Ser Pro

180 185 190

Thr Ala Leu Ile Leu Ala Thr Ala Leu Leu Met Gly Gly Ser Pro Leu

195 200 205

Ala Gly Ile Ala Gly Leu Leu Thr Leu Ala Leu Pro Leu Ala Val Ala

210 215 220

Thr Ala Ala Leu Met Ala Pro Ser Ala Gly Ala Thr Gly Ala Gly Thr

225 230 235 240

Ala Gly Ser Val Ala Ala Val Ala Val Pro Ala Ala Ile Val Leu Gly

245 250 255

Leu Ala Thr Ala Leu Ala Gly Pro Ile His Val Ala Ser Ser Gly Thr

260 265 270

Gly Ala Pro Thr Ile Gly

275

<210> 3

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

catgtgtttt accctgatga tga 23

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gattcatcag atcgtcatag cg 22

<210> 5

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccgaattcat gaaaatcagc ttgaagaa 28

<210> 6

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgctcgagtt gaatagtgaa attaccgtat 30

Claims

1. A chitosanase gene for coding Bacillus belgii, which is characterized in that the nucleotide sequence is shown in SEQ ID NO. 1.

2. The chitinase of the Bacillus beleisi is characterized in that the amino acid sequence of the chitinase is shown as SEQ ID NO. 2.

3. The Bacillus belief-Guarse enzyme of claim 2,

the chitinase of the Bacillus belgii belongs to a glycoside hydrolase GH46 family, the molecular weight of the chitinase is 31.352KD, and the enzyme activity (titer) is 185U/mL; and/or

The expression amount of the chitinase of the Bacillus belgii is 2.5 mg/mL.

4. A recombinant plasmid comprising the Bacillus belgii-encoding chitosan enzyme gene of claim 1.

5. The recombinant plasmid according to claim 4,

the vector of the recombinant plasmid adopts pET28 a.

6. A recombinant expression strain comprising the recombinant plasmid of claim 4 or 5.

7. A method for producing the Bacillus belgii chitosanase of claim 2 or 3,

recombining the gene of claim 1 into a pET28a vector, then transforming into Escherichia coli, and constructing a recombinant expression strain;

8. The method for producing a chitosanase of Bacillus belgii according to claim 7,

the primers for amplifying the gene comprise a forward primer Csn _ ORF _ F and a reverse primer Csn _ ORF _ R;

the nucleotide sequence of the forward primer Csn _ ORF _ F is shown as SEQ ID NO. 5,

the nucleotide sequence of the reverse primer Csn _ ORF _ R is shown as SEQ ID NO. 6.

9. The use of the Bacillus belgii chitosanase of claim 2 or 3 for enzymatic hydrolysis of chitosan,

adding chitosanase into chitosan solution for enzymolysis reaction to obtain chitosan oligosaccharide;

the highest hydrolysis efficiency of chitosan (95% deacetylation degree) by the chitosan enzyme reaches 95%;

the reaction temperature of the enzymolysis reaction is 30-50 ℃, the reaction pH value is 5-6.5, and the reaction time is 5-10 h;

the polymerization degree of the chitosan oligosaccharide is 2-5.

10. The use of chitosan oligosaccharide according to claim 9 for promoting the growth of pepper,

preparing a chitosan oligosaccharide solution, and spraying the chitosan oligosaccharide solution on pepper seedlings;

the concentration of the chitosan oligosaccharide solution is 0.002 g/L-1 g/L.