CN113604457B

CN113604457B - Asparaginase mutant and gene, engineering bacterium and preparation method thereof

Info

Publication number: CN113604457B
Application number: CN202110915041.3A
Authority: CN
Inventors: 刘逸寒; 康宏伟; 王凤华; 路福平
Original assignee: Tianjin University of Science and Technology
Current assignee: Tianjin University of Science and Technology
Priority date: 2021-08-10
Filing date: 2021-08-10
Publication date: 2022-08-30
Anticipated expiration: 2041-08-10
Also published as: CN113604457A

Abstract

The invention belongs to the technical field of enzyme genetic engineering, and particularly relates to an L-asparaginase mutant with improved enzyme activity and a preparation method thereof. The invention obtains the wild-type L-asparaginase gene of Bacillus cereus by a molecular biology technical means, randomly mutates the wild-type L-asparaginase gene by utilizing an error-prone PCR technology to obtain L-asparaginase mutants Y55S/I203V, H8R/Y55S/I203V and encoding genes asnm1 and asnm2 thereof, reconstructs recombinant plasmids, realizes the high-efficiency expression of the L-asparaginase in Bacillus subtilis, Bacillus licheniformis and Bacillus amyloliquefaciens, and obtains the high-activity L-asparaginase by the technologies of fermentation, extraction and the like.

Description

Asparaginase mutant and gene, engineering bacterium and preparation method thereof

The technical field is as follows:

the invention belongs to the technical field of genetic engineering of enzymes, and particularly relates to an L-asparaginase mutant with improved enzyme activity obtained by in vitro directed evolution through an error-prone PCR (polymerase chain reaction) technology, and preparation and application thereof.

Background art:

L-Asparaginase (L-Asparaginase; EC 3.5.1.1; ASN) is a hydrolase that specifically catalyzes the hydrolysis and deamination of L-asparagine to L-aspartic acid and ammonia. Most asparaginases have a glutaminase activity of 3% -9%, catalyzing the hydrolysis of L-glutamine to L-glutamic acid and ammonia. The source of L-asparaginase is relatively extensive and its presence is found in guinea pig serum, plants and microorganisms. L-asparaginase has two different configurations, L-asparaginase I and L-asparaginase II. The structure of the type I enzyme is a dimer, typically intracellular and with low affinity for the substrate; while the type II enzyme is a tetramer and has high affinity to the substrate in the periplasm of the cells, and researches show that only the type II enzyme has the anti-tumor activity. The L-asparaginase reduces the content of L-asparagine in the organism through a catalytic reaction. The malignant cells in the body have slower L-asparagine synthesizing capability than normal cells and need exogenous supply, while the normal cells can not be influenced when the content of L-asparagine in the outside world is reduced because of the L-asparagine synthesizing capability. Nowadays, L-asparaginase has been prepared into a medicament and becomes one of new anticancer drugs, and the enzyme product is sold in countries such as the United states, Japan, Germany and the like. L-asparaginase II isolated and purified from E.coli, Erwinihrysanthemi and other bacteria has been widely used in the treatment of acute lymphoblastic leukemia, lymphosarcoma and reticulosarcoma. In addition, in recent years, L-asparaginase has been found to reduce acrylamide formation in fried foods. Acrylamide has been shown to have carcinogenic effects by the international agency for cancer (IARC) in 1994. A certain amount of glucose and L-asparagine are added into phosphate buffer solution and reacted at 185 ℃, and the measurement result shows that a large amount of acrylamide is generated. The processing temperature of the food rich in carbohydrate is higher than 120 ℃, the content of acrylamide is 1mg/kg through analysis and detection, and the content of acrylamide in restaurant food can reach 4 mg/kg. The Maillard reaction is related to the formation of flavor and color of processed food. Acrylamide formation during food processing occurs through the maillard reaction of amino acids and reducing sugars at elevated temperatures, and L-asparagine provides amino groups, and L-asparagine in potatoes and other grains is an important precursor for acrylamide formation. 2008 research reports that the incidence rate improvement of ovarian cancer, uterine cancer, breast cancer and renal tumor is related to the long-term consumption of foods with high content of acrylamide. Therefore, researchers are working on reducing the formation of acrylamide in foods, and related reports are increasing.

The design and modification of enzyme molecule is based on the complementary development and infiltration of gene engineering, protein engineering and computer technology, and it marks that human may modify enzyme molecule according to his will and need, even to design new enzyme molecule which does not exist originally in nature. Under the condition that the artificial modification of enzyme molecules is not mature, a large number of enzyme molecules are successfully modified by a site-directed mutagenesis technology, and industrial enzyme with higher activity and better stability than natural enzyme is obtained. In recent years, the application of technologies such as error-prone PCR (polymerase chain reaction), DNA shuffling (DNA shuffling) and the like establishes a directed evolution strategy of enzyme molecules under the condition of a high-efficiency detection and screening system for target gene phenotypes, and can obtain new enzymes with expected characteristics even though the structure of the enzyme molecules is not clear, thereby basically realizing the artificial rapid evolution of the enzyme molecules.

The bacillus expression system is widely applied to the fields of industry, agriculture, medicine, sanitation, food, animal husbandry, aquatic products and scientific research as a safe, efficient, multifunctional and microorganism strain with great development potential. Compared with the common escherichia coli expression system, the method has the unique advantage that the product expressed by the target gene can be secreted to the outside of cells, thereby reducing the cost and the workload of further collecting, separating and purifying the gene expression product. Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus megaterium and the like in the bacillus can be used as expression host bacteria. In the field of microbial genetics, background research of bacillus is also quite clear, and the bacillus has the advantages of unobvious codon preference, simple fermentation, rapid growth, no production of pathogenic toxin, no special requirement on a culture medium and the like. With the development of molecular biology techniques and the intensive research of Bacillus, a large number of genes have been cloned and expressed using Bacillus expression systems, and some have been industrially produced on a large scale, and various enzymes and clinically required chemicals or industrial products are produced by expression using Bacillus.

In the invention, the original L-asparaginase gene is subjected to directed evolution to obtain the high-activity L-asparaginase mutant gene, and the high-efficiency expression of the mutant gene in a bacillus subtilis expression system, a bacillus amyloliquefaciens expression system and a bacillus licheniformis expression system is realized, so that the mutant strain producing the high-activity L-asparaginase is obtained.

The invention content is as follows:

based on the problems in the prior art, in order to further promote the application of L-asparaginase in the industrial field, the prior properties of the L-asparaginase need to be further improved, and the invention aims to provide a high-activity mutant of the L-asparaginase.

The technical route for achieving the purpose of the invention is summarized as follows:

obtaining a wild type L-asparaginase ASN from Bacillus cereus TCCC 111005 by a basic molecular biology technical means, constructing a recombinant vector by enzyme digestion, connection and the like, sequencing to obtain a coding gene ASN (the sequence is shown as SEQ ID NO.2) of the wild type L-asparaginase ASN, randomly mutating the wild type ASN gene by using an error-prone PCR technology, screening by using a Bacillus subtilis expression system to obtain an ASN mutant Y55S/I203V and an ASN mutant H8R/Y55S/I203V, encoding genes asnm1 and asnm2 thereof, reconstructing the recombinant vector, realizing the high-efficiency expression of the recombinant vector in Bacillus subtilis, Bacillus amyloliquefaciens and Bacillus licheniformis, and obtaining the ASN mutant with improved enzyme activity by technologies such as fermentation, extraction and the like.

The following definitions are used in the present invention:

1. nomenclature for amino acid and DNA nucleic acid sequences

The accepted IUPAC nomenclature for amino acid residues is used, in the form of a three letter code. DNA nucleic acid sequences employ the accepted IUPAC nomenclature.

Identification of L-asparaginase mutants

The "amino acid substituted at the original amino acid position" is used to indicate the mutated amino acid in the ASN mutant. Such as Tyr55Ser, which indicates that the amino acid at position 55 is replaced by Ser in the Tyr of the wild-type ASN, and the numbering of the positions corresponds to the numbering of the amino acid sequence of the wild-type ASN in SEQ ID No. 1.

In the present invention, lower italic ASN represents the coding gene of the wild-type ASN, lower italic asnm1 represents the coding gene of mutant Y55S/I203V, and lower italic asnm2 represents the coding gene of mutant H8R/Y55S/I203V, and the information is as shown in the following table.

The invention also provides a recombinant plasmid or a recombinant bacterium containing the mutant coding gene;

preferably, the expression vector adopted by the recombinant plasmid is pBSA 43; the host cell adopted by the recombinant strain can be bacillus subtilis WB600, bacillus amyloliquefaciens CGMCC No.11218 or bacillus licheniformis 2709.

The experimental scheme of the invention is as follows:

1. the ASN mutant coding gene is obtained by the following steps:

(1) random mutation is carried out on the wild type ASN coding gene by error-prone PCR by taking the wild type ASN coding gene ASN (SEQ ID No.2) of the bacillus cereus as a template;

(2) constructing recombinant plasmids by enzyme digestion, connection and the like of the ASN coding genes after random mutation, transferring the recombinant plasmids into bacillus subtilis WB600, screening to obtain ASN mutants with improved enzyme activity, and sequencing to obtain ASN mutant coding genes asnm1 and asnm 2.

2. The Bacillus subtilis recombinant strain containing the L-asparaginase coding gene and the process for preparing the L-asparaginase with improved enzyme activity by using the Bacillus subtilis recombinant strain comprise the following steps:

(1) ASN mutant coding genes asnm1 and asnm2 are connected with an escherichia coli-bacillus subtilis shuttle plasmid pBSA43 to obtain new recombinant plasmids pBSA43-asnm1 and pBSA43-asnm 2;

(2) transferring the recombinant plasmid into bacillus subtilis WB600, screening kanamycin (Kan) resistance, performing enzyme digestion verification to obtain a recombinant strain, and then performing culture fermentation on the recombinant strain to obtain the L-asparaginase.

3. The recombinant strain of Bacillus amyloliquefaciens containing the coding gene of the L-asparaginase and the process for preparing the L-asparaginase with improved enzyme activity by using the recombinant strain comprise the following steps:

(1) transferring the recombinant plasmids pBSA43-asnm1 and pBSA43-asnm2 into bacillus amyloliquefaciens CGMCC No.11218, and performing Kan resistance screening and enzyme activity determination on the obtained recombinant strain to obtain an L-asparaginase high-yield strain;

(2) then carrying out fermentation to prepare the L-asparaginase.

4. The Bacillus licheniformis recombinant strain containing the L-asparaginase encoding gene and the process for preparing the L-asparaginase with improved enzyme activity by using the same comprise the following steps:

(1) transferring the recombinant plasmids pBSA43-asnm1 and pBSA43-asnm2 into a host strain Bacillus licheniformis 2709, and screening by Kan resistance to obtain an L-asparaginase recombinant strain;

(2) and fermenting the recombinant strain to prepare the L-asparaginase.

5. The enzymatic characteristics of the ASN wild type and the mutant Y55S/I203V and the mutant H8R/Y55S/I203V are as follows:

(1) specific activity: the specific activity of the wild type is 67.06U/mg, the specific activity of the ASN mutant Y55S/I203V is 109.57U/mg, and the specific activity of the ASN mutant H8R/Y55S/I203V is 139.32U/mg.

(2) Optimum reaction temperature: all at 50 ℃.

(3) Temperature stability: and (3) preserving the temperature of the mixture in water bath at 30, 40 and 50 ℃ for 40min under the condition of pH 9.0. After the temperature is preserved for 40min at 30 ℃ and 40 ℃, the residual activities of the ASN mutant Y55S/I203V, the ASN mutant H8R/Y55S/I203V and the wild type are all kept above 90 percent; after incubation at 50 ℃ for 40min, the residual viability of the wild type was 37.8%, that of the ASN mutant Y55S/I203V was 34.6%, and that of the ASN mutant H8R/Y55S/I203V was 41.6%.

(4) Optimum pH: are all 9.0.

(5) pH stability: the wild type and ASN mutant Y55S/I203V and ASN mutant H8R/Y55S/I203V maintain better stability under the conditions of pH 6.0, 7.0 and 8.0 when the temperature is kept for 5d in buffer solutions of pH 6.0, 7.0 and 8.0 at 4 ℃, the residual activity of the ASN mutant Y55S/I203V is 98.6%, 109.7% and 114.3% respectively, the residual activity of the ASN mutant H8R/Y55S/I203V is 97.4%, 106.3% and 108.6% respectively, and the residual activity of the wild type is 100.96%, 112.02% and 112.42% respectively.

Has the beneficial effects that:

1. the invention utilizes error-prone PCR technology to carry out random mutation on wild type ASN, and obtains mutant Y55S/I203V and mutant H8R/Y55S/I203V with improved enzyme activity. The highest values of the fermentation enzyme activity of the high-activity mutant Y55S/I203V in each expression system are 730.07U/ml, 1179.32U/ml and 913.94U/ml respectively; the highest values of the fermentation enzyme activities of the high-activity mutant H8R/Y55S/I203V in each expression system are 951.34U/ml, 1416.73U/ml and 1107.25U/ml respectively.

2. According to the invention, a bacillus subtilis expression system, a bacillus amyloliquefaciens expression system and a bacillus licheniformis system are respectively used, so that the high-efficiency expression of the ASN mutant with improved enzyme activity in different modes is realized.

Description of the drawings:

FIG. 1 is a PCR amplification electrophoretogram of the wild-type asn gene of the present invention

Wherein: m is DNA Marker, 1 is asn gene;

FIG. 2 is a restriction enzyme digestion verification diagram of the recombinant plasmid pBSA43-asnm1 of the present invention, wherein: m is DNA Marker, 1 is BamHI and NotI double-restriction electrophoretogram of recombinant plasmid pBSA43-asnm1 in bacillus subtilis, 2 is BamHI and NotI double-restriction electrophoretogram of recombinant plasmid pBSA43-asnm1 in bacillus amyloliquefaciens, and 3 is BamHI and NotI double-restriction electrophoretogram of recombinant plasmid pBSA43-asnm1 in bacillus licheniformis;

FIG. 3 is a restriction enzyme digestion verification diagram of the recombinant plasmid pBSA43-asnm2 of the present invention

Wherein: m is DNA Marker, 1 is BamHI and NotI double-restriction electrophoretogram of recombinant plasmid pBSA43-asnm2 in bacillus subtilis, 2 is BamHI and NotI double-restriction electrophoretogram of recombinant plasmid pBSA43-asnm2 in bacillus amyloliquefaciens, and 3 is BamHI and NotI double-restriction electrophoretogram of recombinant plasmid pBSA43-asnm2 in bacillus licheniformis;

FIG. 4 is a SDS-PAGE pattern of purified samples of mutant Y55S/I203V and mutant H8R/Y55S/I203V proteins of the present invention

Wherein: m is Protein Marker, 1 is mutant Y55S/I203V purified sample, 2 is mutant H8R/Y55S/I203V purified sample;

FIG. 5 is the optimum temperature curves of the wild type ASN and mutant Y55S/I203V and mutant H8R/Y55S/I203V of the present invention;

FIG. 6 is the optimum pH curve of the wild type ASN and mutant Y55S/I203V and mutant H8R/Y55S/I203V of the present invention;

FIG. 7 is the temperature stability curves of the wild type ASN and mutant Y55S/I203V and mutant H8R/Y55S/I203V of the present invention;

FIG. 8 shows the VpH stability curves of the wild type ASN and the mutant Y55S/I203V and the mutant H8R/Y55S/I203 of the present invention.

The specific implementation mode is as follows:

the technical contents of the present invention are further illustrated by the following examples, but the present invention is not limited to these examples, and the scope of the present invention is not limited by the following examples.

The bacillus licheniformis 2709 (also called bacillus licheniformis CICC 10266) used by the invention can be obtained from the China center for industrial microorganism culture collection.

The culture medium used in the examples of the present invention is as follows:

LB medium (g/L): 5.0 parts of yeast extract, 10.0 parts of tryptone, 10.0 parts of NaCl and the balance of water.

10 XSP salt solution (g/L): k ₂ HPO ₄ 91.7，KH ₂ PO ₄ 30，(NH4) ₂ SO ₄ 10, sodium citrate 5, MgSO ₄ ·7H ₂ O10 and the balance of water.

SP I medium: 1 XSP 97.6mL, 400. mu.L of 5% casein hydrolysate, 1mL of 10% yeast juice, 1mL of 50% glucose. (5% Casein hydrolysate: 0.5g Casein hydrolysate dissolved in 10mL ddH ₂ O; 10% yeast juice: 1g Yeast extract dissolved in 10mL ddH ₂ O; 50% glucose: 5g glucose dissolved in 10mL ddH ₂ O)。

SP II Medium: SP I Medium 99mL, 100mM CaCl ₂ 500μL，500mM MgCl ₂ 500 μ L, and the balance water.

LBS medium (g/L): sorbitol 91.085, NaCl 10, yeast extract 5, tryptone 10, and the balance water.

Seed culture medium: 5g/L of yeast powder, 10g/L of peptone, 5g/L of sodium chloride and the balance of water;

fermentation medium: 64g/L of corn flour, 40g/L of bean cake powder, 4g/L of disodium hydrogen phosphate, 0.3g/L of monopotassium phosphate, 0.7g/L of high-temperature amylase and the balance of water.

The solid culture medium of the above culture medium was supplemented with 2% agar.

The invention will be further illustrated by the following specific examples.

Example 1: acquisition of wild type ASN coding gene ASN

1. The wild type ASN coding gene ASN is derived from a strain of Bacillus cereus (Bacillus cereus) TCCC 111005 which is stored in a laboratory, and the genome is extracted by using a Bacterial DNA Kit of the American OMEGA company.

(1) Strain activation: dipping bacillus cereus liquid from a glycerin pipe by using an inoculating loop, inoculating the liquid to an LB solid culture medium flat plate, scribing in three areas, and culturing for 12 hours at the constant temperature of 37 ℃;

(2) transferring: selecting a single colony with a neat edge and a smooth surface from a plate for culturing the thalli, inoculating the single colony in 5mL of liquid LB culture medium, and culturing for 12h at the temperature of 37 ℃ at 220 r/min;

(3) and (3) collecting thalli: taking a proper amount of culture solution, sub-packaging the culture solution into 1.5mL of EP tubes, centrifuging the culture solution at 12000r/min for 2min, and removing supernatant;

(4) add 250. mu.L of ddH ₂ O resuspending the thallus, adding 50 mu L of 50mg/mL lysozyme, and carrying out water bath at 37 ℃ for 10 min;

(5) adding 100 mu L of BTL Buffer and 20 mu L of protease K, and carrying out vortex oscillation;

(6) water bath at 55 deg.C for 40-50min, shaking every 20-30min, and mixing;

(7) adding 5 μ L RNase, mixing several times, standing at room temperature for 5 min;

(8) centrifuging at 12000rpm for 2min, removing the undigested part, and transferring the supernatant part to a new 1.5mL EP tube;

(9) adding 220 μ L BDL Buffer, shaking, mixing, and water bath at 65 deg.C for 10 min;

(10) adding 220 mu L of absolute ethyl alcohol, blowing, sucking and uniformly mixing;

(11) transferring to an adsorption column, standing for 1min, centrifuging at 12000rpm for 1min, and removing the filtrate;

(12) adding 500 μ L HBC Buffer at 12000rpm, centrifuging for 1min, and removing the filtrate;

(13) adding 700 mu L of DNA Wash Buffer at 12000rpm, centrifuging for 1min, and removing the filtrate;

(14) adding 500 mu L of DNA Wash Buffer at 12000rpm, centrifuging for 1min, and removing the filtrate;

(15)12000rpm, air separation for 2min, metal bath at 55 ℃ for 10min, and air drying;

(16) add 40. mu.L of ddH ₂ O eluting the genome.

2. Amplification of wild type ASN coding gene ASN

Designing an amplification primer of a wild ASN coding gene ASN, wherein the sequence is as follows:

upstream primer P1:

CGCGGATCCTTGAAAAGAATCCTAGTTTTACACA (underlined is the BamHI cleavage site) downstream primer P2:

AAGGAAAAAAGCGGCCGCATTATGCATAAACATGTTTTGGAT (NotI cleavage site in underlined)

The reaction system for PCR amplification is 50 μ L, and comprises the following components:

PrimeSTAR Max	25μL
		upstream primer P1 (20. mu. mol/L)	2μL
Downstream primer P2 (20. mu. mol/L)	2μL
		Genome	2μL
ddH ₂ O	19μL
		Total volume	50μL

Note: the above-mentioned required reagents are from Takara, a precious bioengineering Co., Ltd.

The setting of the amplification program is as follows:

a. pre-denaturation at 98 ℃ for 30 s;

b. denaturation: 10s at 98 ℃;

c. annealing: 45s at 56 ℃;

d. extension: 10s at 72 ℃;

e.b-d for 30 cycles;

f. extension at 72 ℃ for 10 min.

And (3) carrying out agarose gel electrophoresis on the PCR product to see a band of about 1000bp of the wild ASN coding gene ASN of the bacillus cereus (see figure 1), recovering the PCR product by using a DNA gel cutting recovery kit, constructing a recombinant plasmid pET22b-ASN through enzyme cutting and connection, and sending the recombinant plasmid pET22b-ASN to a sequencing company for sequencing to obtain a wild ASN gene sequence (shown in SEQ ID NO. 2).

Example 2: acquisition of ASN mutant Y55S/I203V and mutant H8R/Y55S/I203V

1. Error-prone PCR: the wild type coding gene asn is used as a template to carry out error-prone PCR, and the reaction system is as follows:

note: the above-mentioned required reagents are from Takara, Bao bioengineering Co., Ltd.

After the system is completed, an error-prone PCR reaction is performed, and the program is set as follows:

a. pre-denaturation at 95 deg.C for 5 min;

b. denaturation: 30s at 95 ℃;

c. annealing: 45s at 56 ℃;

d. extension: 90s at 72 ℃;

e.b-d for 35 cycles;

f. extension at 72 ℃ for 10 min.

After the PCR reaction is finished, BamHI and NotI double enzyme digestion is carried out on the PCR product and the vector plasmid, purification and recovery are carried out, the error-prone PCR product is connected with the vector plasmid pBSA43 which is also subjected to double enzyme digestion, the transformed Bacillus subtilis WB600 is coated on an LB solid medium containing Kan (100 mu g/mL), and the transformant is obtained by standing and culturing in an incubator at 37 ℃ for 12 hours.

3. The screening method comprises the following steps: activity assays were performed using nesler reagents. Asparagine is hydrolyzed by L-asparaginase to produce aspartic acid and free ammonia, and upon completion the reaction is quenched with trichloroacetic acid. The free ammonia formed can be complexed with a Neusler reagent to form a reddish brown compound whose wavelength of maximum light absorption is 450 nm. Therefore, the amount of free ammonia produced has a certain proportional relationship with the color intensity of the reaction solution within a certain range, and the enzymatic activity of L-asparaginase can be measured by colorimetrically measuring the amount of free ammonia produced using a Neusler reagent. The fermentation supernatant can be directly used for screening because the target protein exists in the fermentation supernatant.

4. Screening of mutant libraries: 400. mu.L of LB liquid medium containing Kan (100. mu.g/mL) was added to each well of a 96-well plate, and then, a single clone of each transformant was picked up with a sterilized toothpick into the 96-well plate as much as possible so that just a small amount of the strain was stained each time. The 96 deep well plate was transferred to a shaker at 160rpm for 48h at 37 ℃. Then, the mixture was centrifuged at 4000rpm for 10min using a low temperature centrifuge (4 ℃). A96-well plate containing 0.5mL of a reaction solution (25 mML-asparagine, 50mM Tris-HCl, pH9.0) was placed in a 50 ℃ water bath and preheated, 100. mu.L of the fermentation supernatant was added to the 96-well plate, after reaction at 50 ℃ for 10min, 100. mu. L1.5M of trichloroacetic acid was added to terminate the reaction, the 96-well plate was centrifuged at 8000g for 5min, then 100. mu.L of Neusler reagent was added, and the plate was left at room temperature for 3min to develop a color. 200. mu.L of the supernatant was put in a 96-well plate 1, and absorbance was measured at 450nm with a microplate reader.

Drawing an ammonium chloride standard curve: 0, 40, 60, 80, 100, 120, 140, 160, 180 and 200. mu.L of standard ammonium chloride solution (10mM) were pipetted into each centrifuge tube, 200, 180, 160, 140, 120, 100, 80, 60, 40 and 0. mu.L of reaction solution (25mM L-asparagine, 50mM Tris-HCl, pH9.0) were added into each centrifuge tube, and 400. mu.L of Tris-HCl buffer and 100. mu.L of TCA solution were added into each centrifuge tube. After mixing, 100. mu.L of Neusler reagent was added thereto, and the mixture was left at room temperature for 3min to develop color. 200. mu.L of the supernatant was removed and placed in a 96-well plate, and absorbance was measured at 450nm with reference to the blank value. The absorbance is used as the ordinate, and the corresponding ammonia/ammonium ion content (mu mol/L) is used as the abscissa, so that a standard curve can be drawn.

Definition of enzyme activity: under certain conditions (50 ℃ C., pH9.0, unless otherwise specified), the amount of enzyme required to produce 1. mu. mol of ammonia per minute was 1 enzyme activity unit.

Note: trichloroacetic acid (TCA) solution (1.5M): 12.3g of trichloroacetic acid crystals are dissolved in deionized water, and the volume is adjusted to 50 mL. The mixture was stored in a glass bottle at room temperature in the dark.

Nesler reagent: 7.0776g of potassium mercuric iodide and 14.0275g of potassium hydroxide are weighed, respectively dissolved in deionized water, and are mixed together when the mixture is kept stand to room temperature, and the volume is 100 mL. The mixture was stored in a plastic bottle at room temperature in the dark.

Ammonium chloride standard solution (10 mM): 0.0535g of dried ammonium chloride is weighed by an analytical balance and dissolved in deionized water to a constant volume of 100 mL.

5. Selecting the mutant with improved enzyme activity. According to the condition of the plate 1, calculating the enzyme activity of each mutant, selecting the mutant with the activity improved compared with that of a wild enzyme, inoculating the recombinant bacteria containing the mutant into the plate, and sending out a bacteria sample for sequencing.

Through the error-prone PCR of the steps, mutants with improved enzyme activity are selected, and after sequencing, one of the mutants containing two amino acid mutations, namely Y55S/I203V (T)AT→TCT/ATT→GTT), thereby obtaining the ASN mutant Y55S/I203V (SEQ ID NO.3) and the coding gene asnm1(SEQ ID NO.4), the activity of which is about 1.6 times of that of the wild type; sequencing to obtain another mutantContains three amino acid mutations, namely H8R/Y55S/I203V (C)AC→CGC/TAT→TCT/ATT→GTT) to obtain the ASN mutant H8R/Y55S/I203V (SEQ ID NO.5) and the coding gene asnm2(SEQ ID NO.6), wherein the activity of the ASN mutant is about 2 times of that of the wild type.

Example 3: construction of L-asparaginase bacillus subtilis recombinant strain

1. Extraction of expression plasmids pBSA43-asnm1 and pBSA43-asnm2

Plasmids were extracted from the strains screened to obtain mutants Y55S/I203V and H8R/Y55S/I203V, to obtain recombinant expression plasmids pBSA43-asnm1 and pBSA43-asnm 2.

2. Expression plasmids pBSA43-asnm1 and pBSA43-asnm2 transform Bacillus subtilis WB600

(1) Activating a bacillus subtilis WB600 strain, scribing in three regions on a non-resistance LB plate, and culturing for 12 h;

(2) picking a single colony, inoculating the single colony in a test tube containing 5mL of LB culture medium, and culturing at 37 ℃ and 220rpm for 12 h;

(3) inoculating 100 μ L of the seed solution into a test tube containing 5mL of SPI culture medium at 37 deg.C and 220rpm according to the inoculation amount of 2%, and culturing for 3-4h to OD ₆₀₀ ＝1.2；

(4) Quickly inoculating 200 μ L of the culture medium into 2mL of SPII culture medium, culturing at 37 deg.C and 100rpm for 1.5 h;

(5) adding 20 μ L10 mM EGTA, culturing at 37 deg.C and 100rpm for 10 min;

(6) adding 1-2 μ L recombinant plasmid pBSA43-asnm1 and pBSA43-asnm2 respectively, culturing at 37 deg.C and 100rpm for 30min, adjusting rotation speed to 220rpm, and culturing for 1-2 hr;

(7) transferring the bacterial liquid into a sterilized 1.5mL EP tube, centrifuging at 5000rpm for 5min, discarding the supernatant, leaving 50 μ L of culture solution for resuspending the thallus, and coating the bacterial liquid on a plate containing Kan;

(8) the transformant was picked up, plasmid was extracted, and restriction enzyme digestion was carried out (as shown in FIG. 2 and FIG. 3, lane 1) to obtain Bacillus subtilis recombinant strains WB600/pBSA43-asnm1 and WB600/pBSA43-asnm 2.

Example 4: construction of L-asparagine enzymolysis bacillus amyloliquefaciens recombinant strain

(1) Preparation of Bacillus amyloliquefaciens CGMCC No.11218 competence

Activating strains, streaking in a three-region LB solid medium without antibiotics, and culturing at 37 ℃ for 24 hours;

② selecting a single colony to be inoculated in LBS culture medium, culturing for 12h at 37 ℃ and 220 rpm;

③ inoculating the seed liquid into 100mLLBS culture medium with 2 percent of inoculation amount, culturing at 37 ℃ and 220rpm for 2-3h to OD ₆₀₀ ＝0.4-0.6；

Fourthly, centrifuging for 10min at 5000rpm by using a low-temperature centrifuge (4 ℃), and discarding the supernatant;

fifthly, resuspending the thalli with 30mL of washing buffer (0.5M sorbitol, 0.5M mannitol, 10% glycerol), centrifuging for 10min at a low temperature of 4 ℃ by a low-temperature centrifuge (5000 rpm), and discarding the supernatant;

sixthly, repeating the step five, and washing for 3 times;

seventhly, resuspending the thallus with 10mL of buffer (0.5M sorbitol, 0.5M mannitol, 10% glycerol, 14% PEG 6000);

packing into 100 microliter tube and storing at-80 deg.c.

(2) Electro-transformation of bacillus amyloliquefaciens

Firstly, cleaning an electric revolving cup by 75% alcohol;

② respectively mixing 10ng recombinant plasmids pBSA43-asnm1, pBSA43-asnm2 and 100 microliter competence uniformly, transferring the mixture into an electric rotor cup, and carrying out ice bath for 2 min;

2100 ℃ 2500V, immediately adding 1mL of recovery liquid (LB +0.5M sorbitol +0.38M mannitol) after electric shock for 4-6ms, recovering for 3h at 37 ℃ and 220rpm, and coating on a flat plate containing Kan resistance;

fourthly, selecting transformants, extracting plasmids, and carrying out enzyme digestion verification (shown as 2 lanes in figure 2 and figure 3) to obtain the bacillus amyloliquefaciens recombinant strain CGMCCNo.11218/pBSA43-asnm1 and CGMCCNo.11218/pBSA43-asnm 2.

Example 5: construction of L-asparaginase Bacillus licheniformis recombinant strain

Adding 60 μ L of 2709 competent cells and 1 μ L (50ng/μ L) of pBSA43-asnm1 and pBSA43-asnm2 into a precooled 1mL electric rotor, mixing uniformly and performing ice bath for 5min, setting parameters (25 μ F, 200 Ω, 4.5-5.0ms), performing electric shock once, immediately adding 1mL of recovery medium (LB +0.5mol/L sorbitol +0.5mol/L mannitol), mixing uniformly, sucking into a 1.5mLEP tube, performing shaking culture at 37 ℃ for 3h, centrifuging, leaving 200 μ L of recovery, spreading on an LB plate with Kan resistance, performing culture at 37 ℃ for 24h, selecting transformants, extracting plasmids, performing enzyme digestion verification (shown as a lane 3 in a figure 2 and a figure 3), and obtaining bacillus recombinant strains 2709/pBSA43-asnm1 and 2709/pBSA43-asnm 2.

Example 6: expression and preparation of L-asparaginase with improved enzyme activity in bacillus subtilis

1. Respectively inoculating the recombinant bacillus subtilis strains WB600/pBSA43-asnm1 and WB600/pBSA43-asnm2 into LB liquid culture medium containing kanamycin (50 mu g/mL), and culturing at 37 ℃ and 220r/min overnight;

2. transferring the strain into 50mL LB culture medium according to the inoculum size of 1%, culturing at 37 ℃ at 220r/min for 48H, centrifuging and collecting fermentation supernatant to obtain crude enzyme liquid of Y55S/I203V and H8R/Y55S/I203V with improved enzyme activity;

3. and (3) separating and removing foreign proteins of the collected fermentation broth supernatant by using ammonium sulfate with the saturation of 25%, increasing the saturation to 65%, and precipitating the target protein. Dissolving with 0.02mol/L Tris-HCl (pH7.0), dialyzing to remove salt, loading the active component obtained after dialysis and desalination to a cellulose ion exchange chromatographic column, eluting unadsorbed protein with the same buffer solution, then carrying out gradient elution with 0.02mol/L Tris-HCl (pH7.0) buffer solution containing 0.1-1 mol/L NaCl, and collecting the target protein. The active fraction obtained by ion exchange was equilibrated with 0.02mol/L NaCl-containing 0.02mol/L LTris-HCl buffer (pH7.0), loaded onto sephadex 25 gel chromatography column, and eluted at 0.5mL/min with the same buffer to obtain purified enzyme solution, which was subjected to SDS-PAGE analysis to obtain a single band of about 35.3kDa as shown in

lanes

1 and 2 of FIG. 4. And freeze-drying the purified enzyme solution to obtain high-activity Y55S/I203V and H8R/Y55S/I203V enzyme powder.

Example 7: expression and preparation of L-asparaginase with improved enzyme activity in bacillus amyloliquefaciens

1. The plate three-region streak activation recombinant strains are CGMCCNo.11218/pBSA43-asnm1 and CGMCCNo.11218/pBSA43-asnm 2;

2. selecting a single colony, inoculating the single colony in 50mL of Kan-containing resistant seed culture medium, and carrying out shake culture at 37 ℃ and 220r/min for 12 h;

3. inoculating the strain into a fermentation medium containing kanamycin resistance at an inoculum size of 2%, and performing fermentation culture at 37 ℃ and 220r/min for 48 h.

4.12000rpm, centrifuging for 10min, and collecting fermentation supernatant to obtain crude enzyme solution of ASN mutants Y55S/I203V and H8R/Y55S/I203V;

5. collecting the fermentation supernatant, precipitating the enzyme protein by fractional salting-out method by the method of example 6, collecting the protein precipitate, dissolving, dialyzing to remove salt, performing ion exchange chromatography and gel chromatography to obtain the eluted enzyme solution, and performing vacuum freeze-drying to obtain the high-activity Y55S/I203V and H8R/Y55S/I203V enzyme powder.

Example 8: expression and preparation of L-asparaginase with improved enzyme activity in bacillus licheniformis

1. Plate three-region streaking activated recombinant strains 2709/pBSA43-asnm1 and 2709/pBSA43-asnm 2;

3. inoculating the strain into a fermentation medium containing kanamycin resistance at an inoculum size of 2%, and performing fermentation culture at 37 ℃ and 220r/min for 48 hours.

4.12000rpm, centrifuging for 10min, and collecting fermentation supernatant to obtain crude enzyme solution of ASN mutant Y55S/I203V and H8R/Y55S/I203V;

5. then collecting the fermentation supernatant, precipitating the enzyme protein by fractional salting-out method by the method of example 6, collecting the protein precipitate, dissolving, dialyzing to remove salt, performing ion exchange chromatography and gel chromatography to obtain the eluted enzyme solution, and performing vacuum freeze drying to obtain the high-activity Y55S/I203V and H8R/Y55S/I203V enzyme powder.

Example 9: l-asparaginase activity assay

Principle of enzyme activity determination of L-asparaginase

The Neusler reagent can react with ammonia or ammonium ions existing in a free state to generate a light red brown complex, the absorbance of the complex is in direct proportion to the content of ammonia nitrogen, and the L-asparaginase with ammonia nitrogen amount can be quantified by measuring the absorbance at the wavelength of 450 nm. Definition of enzyme activity.

One enzyme activity unit (U) is defined as the amount of 1 enzyme activity unit required to produce 1. mu. mol of ammonia per minute under certain conditions (50 ℃ C., pH9.0, unless otherwise specified).

1. Formula for calculation

Enzyme activity U ═ A ₁ -A ₀ )×n×V ₁ /(K×V ₂ ×T)

U: enzyme activity, U/ml;

A ₁ experimental group OD ₄₅₀ OD measured at 450nm after 10min of reaction of enzyme and substrate;

A ₀ blank group OD ₄₅₀ After the inactivated enzyme solution and the substrate react for 10min, the OD is measured at 450 nm;

n is the dilution multiple of the enzyme solution;

k is the slope value of the ammonium chloride standard curve;

v1 reaction volume, ml;

v2, volume of enzyme solution, ml;

t is reaction time, min;

2. the method and the steps for determining the enzyme activity of the L-asparaginase adopted by the invention

mu.L of the reaction mixture (25mM L-asparagine, 50mM Tris-HCl, pH9.0) was incubated at 50 ℃ and pH9.0 for 1min, and 100. mu.L of the enzyme solution was aspirated and added thereto, and after reaction at 50 ℃ for 10min, 100. mu.L of TCA (1.5M) solution was added to the reaction system to terminate the reaction. 8000g, centrifuging for 5min, adding 100 μ L Neusler reagent, standing at room temperature for 3min, and developing color. 200 mu L of supernatant was used to detect OD at 450nm using a microplate reader. The samples contained 3 sets of replicates.

Blank control: the enzyme solution was treated at 100 ℃ for 10min to inactivate the enzyme, and the heat-inactivated enzyme solution was used as a control, and the reaction system and method were as described above.

Drawing an ammonium chloride standard curve: 0, 40, 60, 80, 100, 120, 140, 160, 180 and 200. mu.L of ammonium chloride standard solution (10mM) are respectively pipetted into the centrifuge tubes, 200, 180, 160, 140, 120, 100, 80, 60, 40 and 0. mu.L of reaction solution (25mM L-asparagine, 50mM Tris-HCl, pH9.0) are respectively added into the centrifuge tubes, and 400. mu.L of Tris-HCl buffer solution and 100. mu.L of TCA solution are respectively added into each centrifuge tube. 8000g, centrifuging for 5min, adding 100 μ L Neusler reagent, standing at room temperature for 3min, and developing color. 200 mu L of supernatant was used to detect OD at 450nm using a microplate reader. The samples contained 3 parallel experiments. The absorbance is used as the ordinate, and the corresponding ammonia/ammonium ion content (mu mol/L) is used as the abscissa, so that a standard curve can be drawn.

Neusler reagent: 7.0776g of mercuric iodide and 14.0275g of potassium hydroxide are weighed, respectively dissolved by deionized water, mixed together when the mixture is kept stand to room temperature, and the volume is 100 mL. Stored in a plastic bottle at room temperature in the dark.

Ammonium chloride standard solution (10 mM): 0.053g of dried ammonium chloride is weighed by an analytical balance and dissolved in deionized water to be 100 mL.

4. The results of enzyme activity measurements are shown in the following table (taking crude enzyme solutions of Y55S/I203V and H8R/Y55S/I203V prepared in examples 6, 7 and 8 and crude enzyme solutions of wild type ASN prepared by the same method as the measurement objects):

note: in the preparation of crude enzyme solutions of wild-type ASN, recombinant strains of wild-type enzymes were first constructed in the same manner as in examples 3, 4 and 5, and then crude enzyme solutions of wild-type enzymes were prepared in the same fermentation manner as in examples 6, 7 and 8.

Example 10: determination of enzymatic Properties

The enzyme activity of the purified sample obtained by the Bacillus subtilis expression system in example 6 and the enzyme activity determination method in example 9 were used to determine the enzymatic properties of the wild type ASN, mutant Y55S/I203V and mutant H8R/Y55S/I203V, the results of which are shown in FIGS. 5-8:

(2) Optimum reaction temperature: all at 50 ℃.

(3) Temperature stability: and (3) preserving the temperature of the mixture in water bath at 30, 40 and 50 ℃ for 40min under the condition of pH 9.0. After the temperature is kept for 40min at 30 and 40 ℃, the residual activities of the ASN mutant Y55S/I203V, the ASN mutant H8R/Y55S/I203V and the wild type are all kept above 90 percent; after 40min incubation at 50 ℃, the residual viability of the wild type was 37.8%, that of the ASN mutant Y55S/I203V was 34.6%, and that of the ASN mutant H8R/Y55S/I203V was 41.6%.

(4) Optimum pH: are all 9.0.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the patent. It should be noted that, for those skilled in the art, various changes, combinations and improvements can be made in the above embodiments without departing from the patent concept, and all of them belong to the protection scope of the patent. Therefore, the protection scope of this patent shall be subject to the claims.

SEQUENCE LISTING

<110> Tianjin science and technology university

<120> asparaginase mutant, gene, engineering bacterium and preparation method thereof

<130> 1

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 324

<212> PRT

<213> Bacillus cereus TCCC 111005

<400> 1

Met Lys Arg Ile Leu Val Leu His Thr Gly Gly Thr Ile Ala Met Glu

1 5 10 15

Glu Asp Lys Glu Thr Gly Val Val Gln Pro Gly Glu Lys Asn Pro Leu

20 25 30

Leu Lys Phe Ile Pro Asp Leu Glu Gly Asp Val Asp Leu Ile Val Glu

35 40 45

Asp Val Phe His Leu Pro Tyr Pro His Met Thr Pro Ser Glu Met Leu

50 55 60

Gln Leu Gln Val Ile Ile Asp Glu Arg Val Lys Gln Asp Asn Ile His

65 70 75 80

Gly Val Val Ile Thr His Gly Thr Asp Thr Leu Glu Glu Thr Ala Tyr

85 90 95

Phe Leu Asp Leu Thr Val Gln Ala Thr Ile Pro Ile Val Val Thr Gly

100 105 110

Ala Met Arg Ser Ser Asn Glu Leu Gly Ala Asp Gly Leu Tyr Asn Phe

115 120 125

Leu Ser Ala Val Lys Val Ala Ser Ser Ser Glu Ala Ala Glu Lys Gly

130 135 140

Val Leu Val Val Leu Asn Asp Glu Ile His Cys Ala Thr Asn Val Thr

145 150 155 160

Lys Thr His Thr Ser Asn Val Ala Thr Phe Gln Ser Pro Gln Tyr Gly

165 170 175

Pro Ile Gly Met Val Thr Lys Arg Gly Val Val Phe His His Ala Leu

180 185 190

Val His His Glu Thr Tyr Ser Val Asn Lys Ile Ser Lys Asn Val Val

195 200 205

Val Leu Lys Ala Tyr Ala Gly Met Asp Asp Thr Leu Leu Ala Ala Ile

210 215 220

Glu Asn Leu Pro Val Asp Gly Ile Val Ile Glu Ala Leu Gly Gln Gly

225 230 235 240

Asn Leu Pro Pro Arg Thr Leu Pro Ser Leu Glu Arg Leu Ile Asn Lys

245 250 255

Gly Ile Pro Val Val Leu Val Ser Arg Cys Phe Asn Gly Ile Val Gln

260 265 270

Asp Val Tyr Ser Tyr Glu Gly Gly Gly Lys Gln Leu Lys Asp Met Gly

275 280 285

Ile Val Phe Thr Tyr Gly Leu Asn Ala Gln Lys Ala Arg Ile Lys Leu

290 295 300

Leu Val Ala Leu Glu Asn Thr Thr Ser His Glu Thr Ile Gln Asn Met

305 310 315 320

Phe Met His Asn

<210> 2

<211> 975

<212> DNA

<213> Bacillus cereus TCCC 111005

<400> 2

ttgaaaagaa tcctagtttt acacacaggt ggaacaattg caatggagga agataaagaa 60

actggggtcg tacaaccagg tgaaaaaaat cctcttttaa aattcattcc tgatttagaa 120

ggcgatgttg atttaatcgt tgaagatgtg ttccatctac catatcctca tatgacacca 180

agcgaaatgt tacaattaca agtcatcatt gatgaaagag taaaacaaga caacattcat 240

ggcgtagtca ttacgcatgg tacggataca ttagaagaaa cagcctattt cttagattta 300

acagtacaag caactattcc gatcgttgta acaggtgcaa tgcgatctag taatgaatta 360

ggtgctgatg gtctatataa cttcttatca gctgtaaaag tcgctagcag tagtgaagcc 420

gcagaaaaag gtgttttagt cgtattaaac gacgaaattc attgcgctac aaacgtaaca 480

aaaacacata caagcaatgt agcaacattc caaagtccac agtatggacc aattggtatg 540

gtaacaaagc gcggcgttgt attccaccat gctttagtac atcatgaaac atattcagta 600

aataaaattt ctaaaaatgt agtcgttcta aaagcttacg ctggtatgga cgatacattg 660

ttagcagcaa ttgaaaatct tccagtagac gggattgtta ttgaagcact tggacaaggt 720

aatttacctc caagaacact tcctagtcta gaacgattaa taaacaaagg aattcctgtc 780

gtattagttt ctcgctgttt caacggcatc gttcaagatg tatattcata tgaaggtggc 840

ggcaaacaat taaaagatat gggtattgta ttcacatacg gtttaaacgc tcaaaaagca 900

cgtattaaat tattagttgc attagagaat acaacttctc atgaaacaat ccaaaacatg 960

tttatgcata attaa 975

<210> 3

<211> 324

<212> PRT

<213> Artificial sequence

<400> 3

Met Lys Arg Ile Leu Val Leu His Thr Gly Gly Thr Ile Ala Met Glu

1 5 10 15

Glu Asp Lys Glu Thr Gly Val Val Gln Pro Gly Glu Lys Asn Pro Leu

20 25 30

Leu Lys Phe Ile Pro Asp Leu Glu Gly Asp Val Asp Leu Ile Val Glu

35 40 45

Asp Val Phe His Leu Pro Ser Pro His Met Thr Pro Ser Glu Met Leu

50 55 60

Gln Leu Gln Val Ile Ile Asp Glu Arg Val Lys Gln Asp Asn Ile His

65 70 75 80

Gly Val Val Ile Thr His Gly Thr Asp Thr Leu Glu Glu Thr Ala Tyr

85 90 95

Phe Leu Asp Leu Thr Val Gln Ala Thr Ile Pro Ile Val Val Thr Gly

100 105 110

Ala Met Arg Ser Ser Asn Glu Leu Gly Ala Asp Gly Leu Tyr Asn Phe

115 120 125

Leu Ser Ala Val Lys Val Ala Ser Ser Ser Glu Ala Ala Glu Lys Gly

130 135 140

Val Leu Val Val Leu Asn Asp Glu Ile His Cys Ala Thr Asn Val Thr

145 150 155 160

Lys Thr His Thr Ser Asn Val Ala Thr Phe Gln Ser Pro Gln Tyr Gly

165 170 175

Pro Ile Gly Met Val Thr Lys Arg Gly Val Val Phe His His Ala Leu

180 185 190

Val His His Glu Thr Tyr Ser Val Asn Lys Val Ser Lys Asn Val Val

195 200 205

Val Leu Lys Ala Tyr Ala Gly Met Asp Asp Thr Leu Leu Ala Ala Ile

210 215 220

Glu Asn Leu Pro Val Asp Gly Ile Val Ile Glu Ala Leu Gly Gln Gly

225 230 235 240

Asn Leu Pro Pro Arg Thr Leu Pro Ser Leu Glu Arg Leu Ile Asn Lys

245 250 255

Gly Ile Pro Val Val Leu Val Ser Arg Cys Phe Asn Gly Ile Val Gln

260 265 270

Asp Val Tyr Ser Tyr Glu Gly Gly Gly Lys Gln Leu Lys Asp Met Gly

275 280 285

Ile Val Phe Thr Tyr Gly Leu Asn Ala Gln Lys Ala Arg Ile Lys Leu

290 295 300

Leu Val Ala Leu Glu Asn Thr Thr Ser His Glu Thr Ile Gln Asn Met

305 310 315 320

Phe Met His Asn

<210> 4

<211> 975

<212> DNA

<213> Artificial sequence

<400> 4

ttgaaaagaa tcctagtttt acacacaggt ggaacaattg caatggagga agataaagaa 60

actggggtcg tacaaccagg tgaaaaaaat cctcttttaa aattcattcc tgatttagaa 120

ggcgatgttg atttaatcgt tgaagatgtg tttcatctac catctcctca tatgacaccg 180

agcgaaatgt tacaattaca agtcatcatt gatgaaagag taaaacaaga caacattcat 240

ggcgtagtca ttacgcatgg tacggataca ttagaagaaa cggcctattt cttagattta 300

acagtacaag caactattcc gatcgttgta acaggcgcaa tgcgctctag caatgaatta 360

ggtgctgatg gtctatataa cttcttatca gctgtaaaag tcgctagcag tagtgaagct 420

gccgaaaaag gcgttttagt cgtattaaac gacgaaattc attgcgctac aaacgtaacg 480

aaaacacata caagtaatgt agcaacattc caaagtccac agtatggacc aatcggtatg 540

gtaacaaaac gtggtgttgt attccaccat gctttagtac atcacgaaac atattcagta 600

aataaggttt ctaaaaatgt agtcgttcta aaagcgtacg ctggtatgga cgatacattg 660

ttagcagcaa ttgaaaatct tccagtagac gggattgtta ttgaagcgct tggacaaggt 720

aatttacctc caagaacact tcctagtcta gaacggctaa taaataaagg aattcctgtc 780

gtattagttt ctcgctgttt caatgggatc gttcaagatg tatattcata tgaaggtggc 840

ggcaaacaat taaaagatat gggtattgta ttcacatacg gtttaaacgc tcaaaaagca 900

cgtattaaat tattagttgc attagagaat acaacttctc atgaaacaat ccaaaacatg 960

tttatgcata attaa 975

<210> 5

<211> 324

<212> PRT

<213> Artificial sequence

<400> 5

Met Lys Arg Ile Leu Val Leu Arg Thr Gly Gly Thr Ile Ala Met Glu

1 5 10 15

Glu Asp Lys Glu Thr Gly Val Val Gln Pro Gly Glu Lys Asn Pro Leu

20 25 30

Leu Lys Phe Ile Pro Asp Leu Glu Gly Asp Val Asp Leu Ile Val Glu

35 40 45

Asp Val Phe His Leu Pro Ser Pro His Met Thr Pro Ser Glu Met Leu

50 55 60

Gln Leu Gln Val Ile Ile Asp Glu Arg Val Lys Gln Asp Asn Ile His

65 70 75 80

Gly Val Val Ile Thr His Gly Thr Asp Thr Leu Glu Glu Thr Ala Tyr

85 90 95

Phe Leu Asp Leu Thr Val Gln Ala Thr Ile Pro Ile Val Val Thr Gly

100 105 110

Ala Met Arg Ser Ser Asn Glu Leu Gly Ala Asp Gly Leu Tyr Asn Phe

115 120 125

Leu Ser Ala Val Lys Val Ala Ser Ser Ser Glu Ala Ala Glu Lys Gly

130 135 140

Val Leu Val Val Leu Asn Asp Glu Ile His Cys Ala Thr Asn Val Thr

145 150 155 160

Lys Thr His Thr Ser Asn Val Ala Thr Phe Gln Ser Pro Gln Tyr Gly

165 170 175

Pro Ile Gly Met Val Thr Lys Arg Gly Val Val Phe His His Ala Leu

180 185 190

Val His His Glu Thr Tyr Ser Val Asn Lys Val Ser Lys Asn Val Val

195 200 205

Val Leu Lys Ala Tyr Ala Gly Met Asp Asp Thr Leu Leu Ala Ala Ile

210 215 220

Glu Asn Leu Pro Val Asp Gly Ile Val Ile Glu Ala Leu Gly Gln Gly

225 230 235 240

Asn Leu Pro Pro Arg Thr Leu Pro Ser Leu Glu Arg Leu Ile Asn Lys

245 250 255

Gly Ile Pro Val Val Leu Val Ser Arg Cys Phe Asn Gly Ile Val Gln

260 265 270

Asp Val Tyr Ser Tyr Glu Gly Gly Gly Lys Gln Leu Lys Asp Met Gly

275 280 285

Ile Val Phe Thr Tyr Gly Leu Asn Ala Gln Lys Ala Arg Ile Lys Leu

290 295 300

Leu Val Ala Leu Glu Asn Thr Thr Ser His Glu Thr Ile Gln Asn Met

305 310 315 320

Phe Met His Asn

<210> 6

<211> 975

<212> DNA

<213> Artificial sequence

<400> 6

ttgaaaagaa tcctagtttt acgcacaggt ggaacaattg caatggagga agataaagaa 60

actggggtcg tacaaccagg tgaaaaaaat cctcttttaa aattcattcc tgatttagaa 120

ggcgatgttg atttaatcgt tgaagatgtg tttcatctac catctcctca tatgacaccg 180

agcgaaatgt tacaattaca agtcatcatt gatgaaagag taaaacaaga caacattcat 240

ggcgtagtca ttacgcatgg tacggataca ttagaagaaa cggcctattt cttagattta 300

acagtacaag caactattcc gatcgttgta acaggcgcaa tgcgctctag caatgaatta 360

ggtgctgatg gtctatataa cttcttatca gctgtaaaag tcgctagcag tagtgaagct 420

gccgaaaaag gcgttttagt cgtattaaac gacgaaattc attgcgctac aaacgtaacg 480

aaaacacata caagtaatgt agcaacattc caaagtccac agtatggacc aatcggtatg 540

gtaacaaaac gtggtgttgt attccaccat gctttagtac atcacgaaac atattcagta 600

aataaggttt ctaaaaatgt agtcgttcta aaagcgtacg ctggtatgga cgatacattg 660

ttagcagcaa ttgaaaatct tccagtagac gggattgtta ttgaagcgct tggacaaggt 720

aatttacctc caagaacact tcctagtcta gaacggctaa taaataaagg aattcctgtc 780

gtattagttt ctcgctgttt caatgggatc gttcaagatg tatattcata tgaaggtggc 840

ggcaaacaat taaaagatat gggtattgta ttcacatacg gtttaaacgc tcaaaaagca 900

cgtattaaat tattagttgc attagagaat acaacttctc atgaaacaat ccaaaacatg 960

tttatgcata attaa 975

Claims

1. An L-asparaginase mutant is characterized in that the mutants are Y55S/I203V and H8R/Y55S/I203V respectively, and the amino acid sequences are shown as SEQ ID No.3 and SEQ ID No.5 of a sequence table respectively.

2. The gene encoding the L-asparaginase mutant according to claim 1.

3. A recombinant vector or recombinant strain comprising the gene of claim 2.

4. The recombinant vector or recombinant strain of claim 3, wherein the expression vector is pBSA43 and the host cell is Bacillus subtilis WB600, Bacillus amyloliquefaciens CGMCC No.11218 or Bacillus licheniformis 2709.

5. Use of the L-asparaginase mutant according to claim 1 for catalyzing the hydrolysis of L-asparagine.

6. Use of the recombinant vector or the recombinant strain of claim 4 for preparing an L-asparaginase mutant.