CN109576244B - Novel lipase, preparation and application thereof - Google Patents

Abstract

The invention belongs to the technical field of enzyme genetic engineering, and particularly relates to a lipase mutant with improved alkali resistance, and preparation and application thereof. The method comprises the steps of obtaining a wild lipase gene by a molecular biology technical means, randomly mutating the wild lipase gene after codon optimization of escherichia coli by using an error-prone PCR technology to obtain a lipase mutant N157F and a coding gene mpcl thereof, reconstructing a recombinant vector, realizing high-efficiency expression of the lipase in bacillus subtilis WB600 and pichia pastoris GS115, and obtaining the lipase with further improved alkali tolerance by using technologies such as fermentation and extraction.

Description

Novel lipase, preparation and application thereof

The technical field is as follows:

the invention belongs to the technical field of enzyme genetic engineering, and particularly relates to a lipase mutant with improved alkali resistance, and preparation and application thereof.

Background art:

lipases (Lipase, E.C.3.1.1.3), all known as triacylglycerol hydrolases, belong to the class of carboxyl ester hydrolases and are capable of catalyzing the hydrolysis of natural substrate oils to produce fatty acids, glycerol and monoglycerides, which are distributed mainly in animal and plant and microbial tissues. The low level of lipase activity in animals leads to low industrial production. The lipase in plants is mainly present in oil-rich oilseeds, and because the enzyme activity difference is large, the research on the plant lipase is relatively less. Due to the fact that the microorganisms are various and fast in propagation, the reaction pH value, the reaction temperature and the substrate selectivity are wider, and the microbial lipase is generally extracellular. Thus, microbial lipases are an important source of industrial lipases. It has been reported that there are at least 65 genera of lipase-producing microorganisms, among which 28 genera of bacteria, 10 genera of yeast, 23 genera of other fungi, and 4 actinomycetes.

Generally, lipase has wide distribution and various catalytic reactions, can perform catalytic reactions in an organic phase system, has mild reaction conditions, causes little pollution to the environment and has low cost, so the lipase is widely applied to the fields of detergents, leather making, paper making, textiles, foods, medicines, chemical engineering and the like. At present, microbial lipase, as an important industrial enzyme, has wide application in both traditional industries and novel industries, and is a research hotspot in the industries. Compared with other hydrolases, the application of different types of lipase is strictly limited by the enzymological properties such as activity, specificity, optimal temperature and pH value, temperature and acid-base stability, solvent tolerance and the like, so that the market puts higher requirements on various properties and indexes of the enzyme preparation. Although the information of related resources of microbial lipase genes and proteins is rich, the varieties of lipase preparations suitable for industrial application of foods, medicines, energy sources and the like are still few, so that screening of suitable lipase and encoding genes thereof is an important basis for research and development of lipase. Some of the lipases found at present show a certain alkali tolerance, but still need to be further improved to meet the needs of various industries.

Directed evolution belongs to the field of protein engineering and the irrational design of proteins. The directed evolution is to simulate the evolution mechanism of natural selection, quickly establish a mutant library containing a large number of target protein coding genes in vitro by a molecular biology means, and quickly obtain a protein mutant which accords with the application value of human beings by a high-throughput directed screening method. The directed evolution and the natural evolution follow the strategy of trial and error method, and the mutants meeting the expectation are obtained through continuous experiments. Because the directed evolution does not need to obtain the high-level structure of the protein, the catalytic site and other structures, only random mutation needs to be carried out on the amino acid sequence of the protein, which is an important research means of protein engineering. The core steps of directed evolution mainly include two parts, namely the construction of a mutant library with diversity and a high-throughput screening method. Commonly used include: error-prone PCR, DNA shuffling, staggered extension process, random guided recombination, truncated template recombination extension, etc. On the other hand, it is necessary to know the spatial structure, active site, catalytic mechanism and other factors of the protein in advance, and it is rational design to modify the DNA based on these factors.

The bacillus subtilis belongs to gram-positive bacteria, has no pathogenicity, does not produce any endotoxin, and is widely applied to the fields of industry, agriculture, medicine, sanitation, food, animal husbandry, aquatic products and scientific research as a microbial strain which is safe, efficient, multifunctional and has great development potential. The bacillus subtilis belongs to intestinal bacteria of a human body, can promote the growth of beneficial anaerobic bacteria, generates organic acids such as lactic acid and the like, reduces the pH value of the intestinal tract, and indirectly inhibits the growth of other pathogenic bacteria. In addition, the bacillus subtilis is taken as a genetic engineering receptor bacterium, and can express nearly 200 protein genes from prokaryotic and eukaryotic organisms. In the field of microbial genetics, the background research of bacillus is also clear, codon preference is not obvious, fermentation is simple, growth is rapid, and no special requirement on a culture medium exists. Compared with the common escherichia coli expression system, the method has the unique advantage that the product expressed by the target gene can be secreted to the outside of cells, thereby reducing the cost and the workload of further collecting, separating and purifying the gene expression product.

Pichia pastoris belongs to unicellular lower eukaryote, and is an ideal tool for expressing exogenous genes. The method has various excellent characteristics, such as simple genetic operation, integration of exogenous genes in a pichia pastoris genome, post-translational modification of exogenous proteins, realization of high-density fermentation in a basic culture medium and the like. In recent years, pichia pastoris is gradually developed into an effective heterologous protein expression system, and a strictly regulated AOX (alcohol oxidase gene) promoter is adopted, so that the expression of a foreign gene can be strictly regulated by methanol. The carbon source of the pichia pastoris is generally glycerol or glucose and methanol, and the rest is inorganic salt, so the culture cost is low, the product is easy to separate, the stable inheritance can be performed on the foreign protein gene, and as an eukaryotic expression system, the pichia pastoris has a subcellular structure of eukaryote and has post-translational modification processing functions of glycosylation, fatty acylation, protein phosphorylation and the like. The pichia pastoris expression system becomes the most important tool and model for modern molecular biology research, and the most commonly used host bacteria comprise histidine-deficient strains GS115, wild type X-33, alcohol oxidase gene knockout host bacteria KM71 and KM71H, protease-deficient strains SMD1168 and SMD1168H and the like. In addition, the pichia pastoris cell surface display system not only has the advantages of post-translational processing capability of exogenous genes, folding processing and proper glycosylation of proteins and the like, but also can repeatedly utilize the whole-cell catalyst obtained by the system so as to reduce the production cost.

The invention content is as follows:

based on the problems in the prior art, the invention aims to provide a novel lipase with improved alkali resistance, and preparation and application thereof.

The technical route for achieving the purpose of the invention is summarized as follows:

obtaining a penicillium cyclopium wild lipase gene by basic molecular biology technical means, constructing a recombinant vector by enzyme digestion, connection and the like, then randomly mutating the wild lipase gene after escherichia coli codon optimization by using an error-prone PCR technology to obtain a lipase mutant N157F and a coding gene mpcl thereof, reconstructing the recombinant vector, realizing high-efficiency expression of the lipase mutant in bacillus subtilis WB600 and pichia pastoris GS115, and obtaining the lipase mutant with improved alkali resistance by technologies of fermentation, extraction and the like.

The following definitions are used in the present invention:

1. nomenclature for amino acid and DNA nucleic acid sequences

The accepted IUPAC nomenclature for amino acid residues is used, in the form of a three letter code. DNA nucleic acid sequences employ the accepted IUPAC nomenclature.

2. Identification of lipase mutants

"amino acid substituted for the original amino acid position" is used to indicate the mutated amino acid in the lipase mutant. Such as Asn157Phe, the amino acid at position 157 is replaced by Asn of the wild-type lipase to Phe, the numbering of the positions corresponding to the numbering of the amino acid sequence of the wild-type lipase in SEQ ID No. 1.

In the present invention, the lower case italics pcl represents the gene encoding the wild-type lipase and the lower case italics mpcl represents the gene encoding the mutant lipase N157F, the information being as in the table below.

Lipase enzyme	Amino acid mutation site	Site of gene mutation	Amino acid SEQ ID No.	Nucleotide SEQ ID No.
					Wild type	—	—	1	2
N157F	Asn157Phe	AAC→TTC	3	4

The host cell of the lipase mutant and the encoding gene thereof is Bacillus subtilis WB600, and the expression vector is pBSA 43;

the host cell of the lipase mutant and the coding gene thereof is Pichia pastoris GS115, and the expression vector is pPIC 9K;

the host cell of the lipase mutant and the coding gene thereof is Pichia pastoris GS115, and the display vector is pPIC 9K-Flo.

The experimental scheme of the invention is as follows:

1. the method for obtaining the lipase mutant coding gene with improved alkali resistance comprises the following steps:

(1) connecting a Penicillium cyclopium wild-type lipase gene pcl (SEQ ID No.5) subjected to codon optimization of escherichia coli with a vector pET-22b (+), constructing a recombinant plasmid pET-pcl, and randomly mutating a wild-type lipase gene by error-prone PCR (polymerase chain reaction) by taking the pET-pcl as a template to obtain a lipase mutant coding gene mpcl with improved alkali resistance;

(2) and (3) storing the plasmid pET-mpcl containing the lipase mutant coding gene with improved alkali resistance.

2. A bacillus subtilis recombinant strain containing lipase gene with improved alkali resistance and a process for preparing alkali-resistant lipase by using the same comprise the following steps:

(1) carrying out bacillus subtilis codon optimization on the lipase mutant encoding gene mpcl (SEQ ID No.6), and connecting the gene with an escherichia coli-bacillus subtilis shuttle plasmid pBSA43 to obtain a new recombinant plasmid;

(2) and transferring the recombinant plasmid into the bacillus subtilis WB600 to obtain a recombinant strain, and then culturing and fermenting the recombinant strain to obtain the lipase with improved alkali resistance.

3. A pichia pastoris recombinant strain containing lipase genes with improved alkali resistance and a process for preparing the lipase with improved alkali resistance by using the pichia pastoris recombinant strain comprise the following steps:

(1) connecting a gene (SEQ ID No.7) obtained by optimizing a pichia pastoris codon of a lipase mutant encoding gene mpcl with an expression vector pPIC9K to obtain a new recombinant plasmid;

(2) transferring the recombinant plasmid into pichia pastoris GS115, and screening the obtained recombinant strain by using geneticin and determining the enzyme activity of lipase to obtain a lipase high-yield strain with improved alkali resistance;

(3) then fermenting to prepare the lipase with improved alkali resistance.

4. A pichia pastoris cell surface display recombinant strain containing lipase genes with improved alkali resistance and a process for preparing a lipase whole-cell catalyst with improved alkali resistance by using the same comprise the following steps:

(1) the gene (SEQ ID No.7) obtained by optimizing pichia pastoris codon of the lipase mutant encoding gene mpcl is connected with a pichia pastoris display carrier pPIC 9K-Flo to obtain a new recombinant plasmid;

(2) and transferring the recombinant plasmid into a host strain pichia pastoris GS115 to obtain a pichia pastoris cell surface display lipase recombinant strain.

(3) Fermenting the recombinant strain to prepare the lipase whole-cell catalyst with improved alkali resistance.

The enzymatic properties of the lipase mutant N157F are as follows:

(1) enzyme activity: the lipase activity of the bacillus subtilis expression system is 5000-6000U/mL; the lipase activity of the Pichia pastoris free expression system is 6000-7000U/mL; the lipase activity of the pichia pastoris surface display expression system is 2000-3000U/g.

(2) Optimum reaction temperature: 23-27 ℃.

(3) Optimum reaction pH: 9.5-10.5.

(4) pH stability: keeping the temperature at 30 ℃ for 120min under the conditions that the pH values are 9, 10 and 11 respectively, wherein the residual enzyme activities of the mutant lipase are 72%, 82% and 70% respectively; compared with the wild type, the residual enzyme activities of the wild type are 54%, 61% and 47%, respectively.

The invention also provides application of the lipase mutant N157F and a coding gene thereof.

Has the advantages that:

1. the invention utilizes error-prone PCR technology to carry out random mutation on wild lipase to obtain mutant N157F with improved alkali resistance, and the mutant lipase is found to have improved stability along with the increase of the heat preservation time compared with the wild lipase after heat preservation is respectively carried out for 40 min, 80 min and 120min at 30 ℃ when the pH is respectively 9, 10 and 11. When the pH value is 9, after the temperature is preserved for 120min, the residual enzyme activity of the mutant lipase is improved by 18 percent compared with that of the wild enzyme; when the pH value is 10, after the temperature is preserved for 120min, the residual enzyme activity of the mutant lipase is improved by 21 percent compared with that of the wild enzyme; when the pH value is 11, after the temperature is preserved for 120min, the residual enzyme activity of the mutant lipase is improved by 23 percent compared with that of the wild type lipase.

2. According to the invention, a bacillus subtilis expression system, a pichia pastoris expression system and a pichia pastoris surface display system are respectively used, so that the efficient expression of the lipase mutant with improved alkali resistance in different modes is realized.

Description of the drawings:

FIG. 1 is a PCR amplification electrophoretogram of wild-type lipase gene of the present invention

Wherein: m is a DNA Marker, and 1 is a lipase gene;

FIG. 2 is the restriction enzyme digestion verification map of recombinant plasmid pBSA43-Bsmpcl of the present invention

Wherein: m is DNA Marker, 1 is pBSA43-Bsmpcl, and is subjected to double enzyme digestion by BamH I and Hind III;

FIG. 3 is the restriction enzyme digestion verification diagram of the recombinant plasmid pPIC 9K-Pmppcl of the present invention

Wherein: m is DNA Marker, 1 is pPIC 9K-Pmpclr and is subjected to double enzyme digestion by EcoR I and Not I;

FIG. 4 is the restriction enzyme digestion verification diagram of the recombinant plasmid pPIC 9K-Flo-Pmpcll of the invention

Wherein: m is DNA Marker, 1 is pPIC 9K-Flo-Pmpcll, and the double digestion is carried out by SnaB I and EcoR I.

The specific implementation mode is as follows:

the technical content of the present invention is further illustrated by the following examples, but the present invention is not limited to these examples, and the following examples should not be construed as limiting the scope of the present invention.

The culture medium used in the examples of the present invention was as follows:

PDA medium (100 mL): 100mL of potato juice, 2.0g of glucose.

LB medium (g/L): 5.0 yeast extract, 10.0 tryptone and 10.0 NaCl.

MD Medium (g/L): YNB 13.4, glucose 20, biotin 4X 10^-4。

YPD medium (g/L): yeast extract 10, peptone 20, glucose 20.

BMGY medium (g/L): YNB 13.4, YeastExtract 10, peptone 20, glycerol 10, biotin 4X 10^-4，pH 6.0。

BMMY medium (g/L): YNB 13.4, yeast extract 10, peptone 20, methanol 5g, biotin 4X 10^-4，pH6.0。

The solid culture medium of the above culture medium was supplemented with 2% agar.

Example 1: obtaining wild-type Lipase Gene

1. The wild-type lipase gene is derived from Penicillium cyclopium CICC 41049 strain, and the total RNA of the wild-type lipase gene is extracted.

(1) Strain activation: sucking 100 μ L of stored Penicillium cyclopium spore solution from glycerol tube, uniformly coating in PDA eggplant bottle, and culturing at 28 deg.C for 5 d;

(2) transferring: washing spores in eggplant bottles with sterile water, centrifuging at 12000r/min for 1min, repeatedly cleaning, transferring to 50mL PDA liquid culture medium, placing in a shaking table, culturing at 28 deg.C for 2d at 200 r/min;

(3) and (3) collecting thalli: filtering thallus with double-layer sterilized gauze, washing with sterile water, wringing, placing thallus in mortar, adding liquid nitrogen, and grinding into powder;

(4) adding Trizol: respectively taking a small amount of the ground powder, subpackaging into EP tubes, adding 1mL Trizol reagent into each tube, rotating and shaking at room temperature for 10min, and standing on ice for 15 min;

(5) phenol imitation extraction: adding 0.2 mu L of chloroform into each 1mL of Trizol reagent, shaking for 15s, standing at room temperature for 3min, centrifuging at 12000r/min for 15min at 4 ℃, transferring the supernatant into a new EP tube, adding isovolumetric phenol-formaldehyde, centrifuging at 12000r/min for 10min at 4 ℃, taking the supernatant, and repeating the phenol-formaldehyde extraction once;

(6) and (3) settling: adding isopropanol with equal volume, mixing, standing at-70 deg.C for 20min, centrifuging at 4 deg.C at 12000r/min for 10min, and removing supernatant;

(7) cleaning and drying: adding 500 μ L of 75% ethanol, centrifuging at 12000r/min at 4 deg.C for 5min, repeating, wherein the 75% ethanol is prepared by mixing DEPC treated water and ethanol at a certain ratio, separating once, and air drying;

(8) and (3) storage: air drying, adding 50 μ L DEPC treated water, mixing, taking out part, immediately performing spot electrophoresis on 1% agarose gel prepared from DEPC treated water, subjecting the rest part to 55 deg.C water bath for 10min, and storing at-70 deg.C.

2. Reverse transcription

(1) Mu.g of total RNA (2. mu.g) was added with 10mM dNTP, and 1. mu.L each of Oligo dT (0.5. mu.g/. mu.L);

(2) heating at 70 deg.C for 5min, and standing on ice for 2 min;

(3) centrifuging for several seconds to denature the template and the RNA primer and gather at the bottom of the EP tube;

(4) to the same tube were added 10 XPrimerScript Buffer 2. mu.L, RNase inhibitor 1. mu.L, Reverse Transcriptase PrimerScript Reverse Transcriptase Transcriptase (50 unit/. mu.L) 1. mu.L and RNase Free H₂O4.5. mu.L (note: all the above reagents are purchased from Biotech Co., Ltd., Beijing);

(5) gently mixing, and standing at 42 deg.C for 60 min. Then, the mixture was incubated at 70 ℃ for 15 minutes and directly used for PCR.

3. Amplification of wild-type Lipase Gene

Designing amplification primers of wild lipase genes, wherein the sequences are as follows:

upstream P1(SEQ ID No. 8):

CGCGGATCCGCAACTGCTGACGCCGCTGC

downstream P2(SEQ ID No. 9):

CCCAAGCTTTCAGCTCAGATAGCCACAACCAGCA

the reaction system for PCR amplification is 50 μ L, and comprises the following components:

2×LA buffer	25μL
		dNTPs(2.5mmol/L)	2μL
upstream primer P1 (20. mu. mol/L)	5μL
		Downstream primer P2 (20. mu. mol/L)	5μL
Template cDNA	2μL
		LA Taq DNA polymerase	0.5μL
ddH2O	10.5μL
		Total volume	50μL

Note: the above-mentioned required reagents are from Takara, a precious bioengineering Co., Ltd.

The setting of the amplification program is as follows:

a. pre-denaturation at 95 deg.C for 5 min;

b. denaturation: 30s at 95 ℃;

c. annealing: 45s at 70 ℃;

d. extension: 90s at 72 ℃;

e.b-d for 30 cycles;

f. extension at 72 ℃ for 10 min.

Carrying out agarose gel electrophoresis on the PCR product to see the band of the penicillium cyclopium wild-type lipase gene, 774bp (shown in figure 1), recovering the PCR product by using a small amount of DNA recovery kit to obtain the wild-type lipase gene, sending the wild-type lipase gene to a sequencing company for sequencing to obtain a wild-type gene sequence, and carrying out escherichia coli codon optimization by a gene synthesis company to obtain an optimized wild-type gene sequence, namely pcl (shown in SEQ ID NO. 5).

Example 2: obtaining of Lipase mutant N157F

1. The wild-type lipase gene after the codon optimization of the Escherichia coli is connected with a pET-22b (+) vector.

And connecting the purified pcl with a pET-22b (+) vector, then transforming the recombinant plasmid into Escherichia coli DH5 alpha, and successfully verifying that the wild lipase gene optimized by the Escherichia coli codon is cloned to the pET-22b (+) vector through double enzyme digestion of BamH I and Hind III to construct the recombinant plasmid pET-pcl.

2. Error-prone PCR: the recombinant plasmid pET-pcl constructed above is taken as a template, and the reaction system is as follows:

ddH2O	21μL
		recombinant plasmid pET-pcl (5 ng/. mu.L)	1μL
Upstream primer P1 (10. mu. mol/L)	2μL
		Downstream primer P2 (10. mu. mol/L)	2μL
Taq DNA polymerase	0.5μL
		10×Taq buffer	5μL
dATP(10mmol/L)	1μL
		dGTP(10mmol/L)	1μL
dTTP(10mmol/L)	5μL
		dCTP(10mmol/L)	5μL
MgCl2(25mmol/L)	10μL
		MnCl2(10mmol/L)	1.25μL

Note: the above-mentioned required reagents are from Takara, a precious bioengineering Co., Ltd.

After the system is completed, an error-prone PCR reaction is performed, and the program is set as follows:

a. pre-denaturation at 95 deg.C for 5 min;

b. denaturation: 30s at 95 ℃;

c. annealing: 45s at 70 ℃;

d. extension: 90s at 72 ℃;

e.b-d for 35 cycles;

f. extension at 72 ℃ for 10 min.

After the PCR reaction is finished, carrying out double enzyme digestion on the PCR product and the vector plasmid by BamH I and Hind III, purifying and recovering, connecting the error-prone PCR product and the vector plasmid pET-22b (+) which is also subjected to double enzyme digestion, transferring the error-prone PCR product into E.coli BL21(DE3) through transformation, and coating the E.coli BL21(DE3) with Amp^rThe transformant was obtained by static culture in an incubator at 37 ℃ for 12 hours in a solid plate of LB (100. mu.g/mL).

3. The screening method comprises the following steps: p-nitrophenol Ester (p-Nitrophenyl Ester) is a substrate which is most widely applied in the determination of the hydrolysis activity of lipase, pNP generated by the hydrolysis of the lipase shows yellow under the alkaline condition, has a light absorption value under 405nm, has high sensitivity and convenient detection, and is very suitable for the screening of strains. The fermentation supernatant can be directly used for screening because the target protein exists in the fermentation supernatant. 30mg of p-nitrophenol ester is weighed in advance to be added into 10mL of isopropanol to prepare a substrate, and the substrate and 0.05M PBS buffer solution with the pH value of 8.0 are added according to the ratio of 1:9 after the substrate is prepared to prepare the p-nitrophenol ester reaction solution.

4. Screening of mutant libraries: add 200. mu.L of Amp in each well of 96-well plate^r(100. mu.g/mL) of LB liquid medium, and then, a single clone of each transformant was picked up with a sterilized toothpick into a 96-well plate, as much as possible so that just a small amount of the strain was stained each time. Transferring the 96-well plate to a shaking table for culturing at 160r/min and 37 ℃ to OD₆₀₀Reaching 0.6-0.8, at which time IPTG was added to a final concentration of 0.5mM, followed by low temperature induction at 16 ℃ and cultivation at 160r/min for 16 h. After centrifugation at 4000r/min for 10min (at 4 ℃), 50. mu.L of the centrifuged supernatant was added to a 96-well plate containing 200. mu.L of p-nitrophenol ester reaction solution, and after detecting mutants having enzyme activity, the remaining fermented supernatants of these mutants were evenly divided into two identical 96-well plates, 50. mu.L of each well. The plate 1 immediately detects the enzyme activity, 200 mul of reaction liquid is taken by a discharging gun and added into each hole, after accurate reaction is carried out for 10min in a 25 ℃ enzyme labeling instrument, OD is detected₄₀₅. The plate 2 was placed in PBS buffer pH 11.0, incubated at 25 ℃ for 30min, then placed on ice for 10min and the enzyme activity was measured at 25 ℃ in the same manner.

5. Selecting mutants with improved stability under alkaline conditions. According to the conditions of the plate 1 and the plate 2, the residual enzyme activity of each mutant is calculated, the mutant with the alkali resistance performance improved compared with that of a wild type is selected, after repeated experiments of the enzyme activity and the alkali resistance performance are carried out on the selected mutant, the mutant with the alkali resistance performance obviously improved compared with that of the wild type is selected to be connected into a flat plate, and a bacterial sample is sent out for sequencing.

Through the error-prone PCR of the above steps, mutants with improved alkali resistance are selected, and after sequencing, the mutants containing one amino acid mutation, namely N157F (AAC→TTC) Thereby obtaining lipase mutant N157F and its coding gene mpcl (SEQ ID NO. 4).

Example 3: construction of lipase recombinant bacteria with improved alkali resistance of bacillus subtilis

1. Construction of expression vector pBSA43

An expression vector pBSA43 is obtained by taking an escherichia coli-bacillus subtilis shuttle cloning vector pBE2 as a framework and cloning a strong bacillus constitutive promoter P43(SEQ ID No.10) and a levansucrase signal sequence sacB (SEQ ID No.11) which can ensure that a recombinant protein is directly secreted into a culture medium. It carries Amp^rAnd Kana^rThe gene can utilize ampicillin resistance as a selection marker in escherichia coli, and can utilize kanamycin resistance as a selection marker in bacillus subtilis and bacillus licheniformis.

2. Construction of alkaline-resistant lipase expression plasmid pBSA43-Bsmpcl

The lipase mutant gene Bsampcl (SEQ ID No.6) after the codon optimization of the bacillus subtilis and a bacillus subtilis expression vector pBSA43 are subjected to BamHI and HindIII double enzyme digestion, and then are connected to construct a recombinant plasmid pBSA 43-Bsampcl, the recombinant plasmid pBSA 43-Bsampcl is transformed into an escherichia coli DH5 alpha competent cell, a positive transformant is selected, the plasmid is extracted for enzyme digestion verification (shown in figure 2) and sequencing, and the success in construction is determined, namely the recombinant expression plasmid pBSA 43-Bsampcl is obtained.

3. Expression plasmid pBSA43-Bsmpcl for transformation of Bacillus subtilis WB600

Adding 60 mu L of competent cells and 1 mu L (50 ng/mu L) of pBSA43-mpcl into a precooled 1mm electric rotating cup, uniformly mixing and carrying out ice bath for 5min, setting parameters (25 mu F, 200 omega, 4.5-5.0ms), shocking once, immediately adding 1mL of recovery culture medium (LB +0.5mol/L sorbitol +0.5mol/L mannitol), uniformly mixing, sucking into a 1.5mL EP tube, shaking and culturing for 3h at 37 ℃ by a shaking table, leaving 200 mu L of recovery after centrifugation, coating on a resistant LB plate, culturing for 24h at 37 ℃, picking up a transformant, extracting plasmids, and carrying out enzyme digestion verification to obtain the bacillus subtilis recombinant WB600/pBSA 43-Bmpcl.

Example 4: construction of lipase free expression recombinant bacteria with improved alkali resistance of pichia pastoris

1. Construction of lipase expression vector pPIC 9K-mpcl with improved alkali resistance

Carrying out EcoRI and NotI double enzyme digestion on a lipase mutant gene Pmpcl (SEQ ID No.7) optimized by a pichia pastoris codon and a pichia pastoris expression vector pPIC9K, then connecting, transforming into an escherichia coli DH5 alpha competent cell, and selecting Amp^rAnd carrying out colony culture on the positive transformant, then upgrading the plasmid, and successfully carrying out enzyme digestion verification (as shown in figure 3) to obtain the recombinant expression vector pPIC 9K-Pmpcll.

2. Construction of lipase high-expression recombinant strain with improved alkali resistance

(1) Linearization of plasmid DNA

Before transformation of Pichia pastoris GS115, the recombinant expression plasmid pPIC 9K-Pmpcll was linearized with SacI and SalI restriction enzymes, respectively.

(2) Electrotransfer of the linearized plasmid pPIC 9K-Pmpcll to Pichia pastoris

Adding competent cells and linearized plasmid pPIC 9K-Pmpcls into a 1.5mL precooled centrifuge tube, blowing, beating and uniformly mixing, and then adding the mixture into a precooled electric rotor cup;

carrying out ice bath on the transformation cup for 10min, and then carrying out electric transformation;

thirdly, immediately adding 1mL of precooled 1mol/L sorbitol solution into an electrotransfer cup after electric shock, and transferring the electrotransfer solution into a new 1.5mL centrifuge tube;

fourthly, standing and culturing for 1 to 2 hours at the temperature of 30 ℃, and sucking 200 mu L of pichia pastoris GS115 electrotransfer liquid and coating the liquid on an MD culture medium.

(3) Identification of positive transformant and screening of lipase high-yield strain

Culturing an MD flat plate coated with an electrotransfer solution at 30 ℃ for 2-3 d;

secondly, selecting transformants, extracting yeast genomes, diluting by 100 times, and then using the yeast genomes as templates for PCR. Positive transformants were determined by using Pichia pastoris GS115/pPIC 9K, which had been transformed with the empty plasmid pPIC9K, as a control.

And thirdly, after positive transformants are determined, high geneticin resistant transformants with large single colony ratio on geneticin resistant plates with different concentrations are picked, and then lipase enzyme activities of the picked transformants are respectively measured, so that the high-yield strain GS115/pPIC 9K-Pmppcl of the lipase is obtained.

Example 5: construction of lipase recombinant bacteria for displaying alkali resistance improvement on pichia pastoris cell surface

1. Construction of recombinant expression plasmid pPIC 9K-Flo-mpcl

Carrying out double enzyme digestion on a lipase mutant gene Pmpcl (SEQ ID No.7) subjected to codon optimization of pichia pastoris and a pichia pastoris surface display expression vector pPIC 9K-Flo through SnaB I and EcoR I, then connecting, transforming into escherichia coli DH5 alpha competence, and selecting Amp^rAnd carrying out colony culture on the positive transformant, then upgrading the plasmid, and successfully carrying out enzyme digestion verification (as shown in figure 4) to obtain the recombinant expression vector pPIC 9K-Flo-Pmpcll.

2. Construction of recombinant pichia pastoris

After a recombinant expression vector pPIC 9K-Flo-Pmpcl with correct sequencing verification is linearized by Sal I, pichia pastoris GS115 is transformed by an electric transformation method, and recombinants are screened by an MD plate to obtain lipase recombinant bacteria GS115/pPIC 9K-Flo-Pmpcl with improved alkali resistance displayed on the cell surface of the pichia pastoris.

Example 6: expression and preparation of lipase with improved alkali resistance in bacillus subtilis recombinant bacteria

1. Inoculating the recombinant Bacillus subtilis strain WB600/pBSA43-Bsmpcl into LB liquid culture medium containing kanamycin (50. mu.g/mL), and culturing at 37 ℃ and 220r/min overnight;

2. transferring the strain into 50mL LB culture medium according to the inoculum size of 1%, culturing at 37 ℃ at 220r/min for 48h, centrifuging and collecting fermentation supernatant to obtain lipase crude enzyme liquid with improved alkali resistance;

3. then precipitating enzyme protein by using a fractional salting-out method, collecting protein precipitate, dissolving, dialyzing to remove salt, performing ion exchange chromatography and gel chromatography, and freeze-drying to obtain lipase pure enzyme N157F enzyme powder with improved alkali resistance.

Example 7: expression and preparation of lipase with improved alkali resistance in pichia pastoris free expression recombinant bacteria

1. Selecting a Pichia pastoris recombinant strain GS115/pPIC 9K-Pmpcl on the YPD plate, inoculating the Pichia pastoris recombinant strain GS115/pPIC 9K-Pmpcl into 50mL of YPD liquid culture medium, and culturing at 30 ℃ at 250r/min for 24 h;

2. transferring the strain to a BMGY culture medium with the inoculation amount of 1%, culturing at 30 ℃ and 250r/min for about 24h, centrifuging at 4000r/min for 5min to obtain thalli, and transferring the thalli to a BMMY culture medium;

3. continuously culturing at 30 ℃ for 250r/min, supplementing 250 mu L of methanol every 24h, and after culturing for 5d, centrifugally collecting fermentation supernatant to obtain crude enzyme solution of lipase;

4. then precipitating enzyme protein by using a fractional salting-out method, collecting protein precipitate, dissolving, dialyzing to remove salt, performing ion exchange chromatography and gel chromatography, and freeze-drying to obtain the lipase N157F pure enzyme powder with improved alkali resistance.

Example 8: preparation of lipase whole-cell catalyst with improved alkali resistance displayed on pichia pastoris cell surface

1. Picking a recombinant lipase strain GS115/pPIC 9K-Flo-Pmpcl with the surface of a pichia pastoris cell on a YPD plate and showing the improved alkali resistance to be inoculated into 50mL of YPD liquid culture medium, and culturing at 30 ℃ and 250r/min for 24 h;

2. transferring the strain to a fresh BMGY culture medium with the inoculation amount of 1%, culturing at 30 ℃ for about 24h at 250r/min, centrifuging at 4000r/min for 5min to obtain thalli, and transferring the thalli to a BMMY culture medium;

3. the culture was continued at 30 ℃ and 250r/min, and 250. mu.L of methanol was added every 24 hours. After culturing for 5 days, centrifugally collecting thalli, washing with membrane water for 1-2 times, and carrying out vacuum freeze drying to obtain the lipase N157F cell catalyst with the surface of the pichia pastoris cell showing improved alkali resistance.

Example 9: determination of lipase activity and alkali resistance

1. Principle of lipase activity determination

At an oil-water interface, the lipase can hydrolyze natural substrates such as olive oil into glycerides and fatty acids, and the hydrolysis efficiency of the lipase in a certain time can be quantitatively calculated by using NaOH with standard concentration, so that the enzyme activity of the lipase is obtained.

2. Definition of Lipase Activity

1.0g of solid enzyme powder or 1.0mL of liquid enzyme, under certain temperature and pH conditions, 1min hydrolyzes the substrate to generate 1 mu mol of titratable fatty acid, namely 1 enzyme activity unit (U/g or U/mL).

3. Method and step for measuring lipase activity

According to the national standard method (GB-T23535) 2009, the method comprises the following steps: taking two 100mL beakers, adding substrate solution, namely 4.0mL of olive oil emulsion and 5.0mL (pH 10.0) of Gly-NaOH buffer solution into each of blank cup (A) and experimental cup (B), and adding 15mL of 95% ethanol into (A); preheating at 25 ℃ for 5min, adding 1mL of enzyme solution into (A) and (B) respectively, reacting for 10min accurately, and adding 15mL of 95% ethanol into (B) to terminate the reaction; phenolphthalein serving as an indicator is added into each of the two beakers, a rotor is added into each beaker, the beakers are placed on a magnetic stirrer, stirring is carried out, 0.05M standard NaOH is used for titration until the solution is light pink and does not change any more, the consumption volume of the NaOH is recorded, and the enzyme activity is calculated. The samples contained 3 sets of replicates.

4. The results of the enzyme activity measurements are shown in the following table (the crude enzyme solution and cell catalyst of N157F prepared in examples 6, 7 and 8, and the crude enzyme solution and cell catalyst of wild-type lipase prepared in the same way are used as experimental objects):

note: in the preparation of crude enzyme solutions and cell catalysts of wild-type lipases, recombinant strains of wild-type enzymes were first constructed in the same manner as in examples 3, 4 and 5, and then crude enzyme solutions or cell catalysts of wild-type enzymes were prepared in the same fermentation manner as in examples 6, 7 and 8.

5. Detection of alkali resistance

The improvement of the alkali resistance of the lipase is embodied by recording the change of the residual enzyme activity of the wild type and the mutant under different pH values and in different time periods.

The enzyme powder of wild type and mutant with the same enzyme activity is preserved in 0.05M PBS buffer solution with pH of 8.0, and is respectively preserved for 40 min, 80 min and 120min under the conditions of 30 ℃ and pH of 9, 10 and 11 respectively, and the residual enzyme activity is measured once at each time point. The measurement method was carried out according to the national standard method described above. The enzyme activity without treatment is taken as 100 percent, and the residual enzyme activity after treatment is calculated.

The experimental record shows that when the pH value is 9 and the temperature is kept for 120min at 30 ℃, the residual enzyme activity of the Wild Type (WT) is 54 percent, the residual enzyme activity of the N157F mutant is 72 percent, and the residual enzyme activity is improved by 18 percent relative to the wild type; when the pH value is 10, preserving the heat for 120min at 30 ℃, wherein the residual enzyme activity of a Wild Type (WT) is 61 percent, the residual enzyme activity of an N157F mutant is 82 percent, and the residual enzyme activity is improved by 21 percent relative to the wild type; when the pH value is 11, the temperature is kept for 120min at 30 ℃, the residual enzyme activity of the Wild Type (WT) is 47 percent, the residual enzyme activity of the N157F mutant is 70 percent, and the residual enzyme activity is improved by 23 percent compared with the wild type.

Through the comparison, the enzyme activity and the alkali resistance of the N157F mutant are improved to a certain extent compared with those of the wild lipase.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the patent. It should be noted that, for those skilled in the art, various changes, combinations and improvements can be made in the above embodiments without departing from the patent concept, and all of them belong to the protection scope of the patent. Therefore, the protection scope of this patent shall be subject to the claims.

Sequence listing

<110> Tianjin science and technology university

<120> novel lipase, preparation and application thereof

<130> 1

<141> 2018-12-06

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 258

<212> PRT

<213> Penicillium cyclopium CICC 41049)

<400> 1

Ala Thr Ala Asp Ala Ala Ala Phe Pro Asp Leu His Arg Ala Ala Lys

1 5 10 15

Leu Ser Ser Ala Ala Tyr Thr Gly Cys Ile Gly Lys Ala Phe Asp Val

20 25 30

Thr Ile Thr Lys Arg Ile Tyr Asp Leu Val Thr Asp Thr Asn Gly Phe

35 40 45

Val Gly Tyr Ser Thr Glu Lys Lys Thr Ile Ala Val Ile Met Arg Gly

50 55 60

Ser Thr Thr Ile Thr Asp Phe Val Asn Asp Ile Asp Ile Ala Leu Ile

65 70 75 80

Thr Pro Glu Leu Ser Gly Val Thr Phe Pro Ser Asp Val Lys Ile Met

85 90 95

Arg Gly Val His Arg Pro Trp Ser Ala Val His Asp Thr Ile Ile Thr

100 105 110

Glu Val Lys Ala Leu Ile Ala Lys Tyr Pro Asp Tyr Thr Leu Glu Ala

115 120 125

Val Gly His Ser Leu Gly Gly Ala Leu Thr Ser Ile Ala His Val Ala

130 135 140

Leu Ala Gln Asn Phe Pro Asp Lys Ser Leu Val Ser Asn Ala Leu Asn

145 150 155 160

Ala Phe Pro Ile Gly Asn Gln Ala Trp Ala Asp Phe Gly Thr Ala Gln

165 170 175

Ala Gly Thr Phe Asn Arg Gly Asn Asn Val Leu Asp Gly Val Pro Asn

180 185 190

Met Tyr Ser Ser Pro Leu Val Asn Phe Lys His Tyr Gly Thr Glu Tyr

195 200 205

Tyr Ser Ser Gly Thr Glu Ala Ser Thr Val Lys Cys Glu Gly Gln Arg

210 215 220

Asp Lys Ser Cys Ser Ala Gly Asn Gly Met Tyr Ala Val Thr Pro Gly

225 230 235 240

His Ile Ala Ser Phe Gly Val Val Met Leu Thr Ala Gly Cys Gly Tyr

245 250 255

Leu Ser

<210> 2

<211> 774

<212> DNA

<213> Penicillium cyclopium CICC 41049)

<400> 2

gcaactgctg acgccgctgc cttccctgat ctgcaccgtg cagcaaagct ttcttccgct 60

gcctacacag gttgcatcgg aaaggccttc gatgtcacta tcaccaagag gatttatgac 120

ctcgtgaccg acaccaatgg attcgtcgga tactccaccg agaagaagac catcgcggtc 180

atcatgaggg gctcgactac catcaccgac ttcgtgaacg acattgacat tgctctcatc 240

actcctgagc tctcgggcgt gactttcccc tctgatgtga agatcatgag aggtgttcac 300

agaccttggt ccgctgtaca cgacaccatc attactgaag tcaaggctct cattgcgaag 360

taccctgatt acactctgga agcagtcgga cattccctcg gtggtgccct cacatccatt 420

gcccacgttg ccctggccca gaacttcccg gacaagtcac ttgtcagcaa tgcccttaac 480

gccttcccca tcggcaacca agcgtgggcc gactttggta ctgcgcaggc cggtaccttc 540

aaccgcggaa ataacgttct tgacggtgtc cctaacatgt actcgagccc gcttgttaac 600

ttcaagcact atggaaccga atactacagc tctggtaccg aggctagcac cgtgaagtgc 660

gaaggccagc gtgacaagtc ttgctctgcc ggcaatggca tgtacgctgt cactcccggt 720

cacatcgcaa gctttggcgt cgtgatgctt actgctggtt gtggctatct gagc 774

<210> 3

<211> 258

<212> PRT

<213> Artificial sequence ()

<400> 3

Ala Thr Ala Asp Ala Ala Ala Phe Pro Asp Leu His Arg Ala Ala Lys

1 5 10 15

Leu Ser Ser Ala Ala Tyr Thr Gly Cys Ile Gly Lys Ala Phe Asp Val

20 25 30

Thr Ile Thr Lys Arg Ile Tyr Asp Leu Val Thr Asp Thr Asn Gly Phe

35 40 45

Val Gly Tyr Ser Thr Glu Lys Lys Thr Ile Ala Val Ile Met Arg Gly

50 55 60

Ser Thr Thr Ile Thr Asp Phe Val Asn Asp Ile Asp Ile Ala Leu Ile

65 70 75 80

Thr Pro Glu Leu Ser Gly Val Thr Phe Pro Ser Asp Val Lys Ile Met

85 90 95

Arg Gly Val His Arg Pro Trp Ser Ala Val His Asp Thr Ile Ile Thr

100 105 110

Glu Val Lys Ala Leu Ile Ala Lys Tyr Pro Asp Tyr Thr Leu Glu Ala

115 120 125

Val Gly His Ser Leu Gly Gly Ala Leu Thr Ser Ile Ala His Val Ala

130 135 140

Leu Ala Gln Asn Phe Pro Asp Lys Ser Leu Val Ser Phe Ala Leu Asn

145 150 155 160

Ala Phe Pro Ile Gly Asn Gln Ala Trp Ala Asp Phe Gly Thr Ala Gln

165 170 175

Ala Gly Thr Phe Asn Arg Gly Asn Asn Val Leu Asp Gly Val Pro Asn

180 185 190

Met Tyr Ser Ser Pro Leu Val Asn Phe Lys His Tyr Gly Thr Glu Tyr

195 200 205

Tyr Ser Ser Gly Thr Glu Ala Ser Thr Val Lys Cys Glu Gly Gln Arg

210 215 220

Asp Lys Ser Cys Ser Ala Gly Asn Gly Met Tyr Ala Val Thr Pro Gly

225 230 235 240

His Ile Ala Ser Phe Gly Val Val Met Leu Thr Ala Gly Cys Gly Tyr

245 250 255

Leu Ser

<210> 4

<211> 774

<212> DNA

<213> Artificial sequence ()

<400> 4

gcaaccgcag acgcagcagc atttccggat ctgcatcgcg cagcaaaact gagttctgca 60

gcgtataccg gttgcattgg caaagcgttt gacgttacca tcaccaaacg catctacgac 120

ctggttaccg ataccaacgg ttttgttggc tacagcaccg agaaaaagac catcgccgtc 180

attatgcgcg gtagtaccac catcaccgat ttcgtcaacg acatcgacat cgcgctgatt 240

accccggaac tgtctggcgt tacctttccg agcgacgtca aaattatgcg cggcgttcat 300

cgtccgtggt ctgcagttca cgataccatt atcaccgagg tcaaagcgct gattgcgaaa 360

tacccggatt ataccctgga agcagttggt catagtctgg gcggcgcact gacctctatt 420

gcacatgttg cactggcaca gaattttccg gataaaagcc tggttagctt cgcgctgaac 480

gcatttccga ttggtaacca ggcgtgggca gattttggta ccgcacaagc aggcaccttt 540

aatcgcggta ataacgttct ggacggcgtt ccgaatatgt atagcagccc gctggttaac 600

ttcaaacact acggcaccga gtactatagc agcggtaccg aagcatcaac cgttaaatgc 660

gaaggtcagc gcgataaaag ctgttctgct ggtaacggta tgtacgcagt taccccgggt 720

catatcgcga gtttcggcgt agttatgctg acggcaggtt gcggttatct gagt 774

<210> 5

<211> 774

<212> DNA

<213> Artificial sequence ()

<400> 5

gcaaccgcag acgcagcagc atttccggat ctgcatcgcg cagcaaaact gagttctgca 60

gcgtataccg gttgcattgg caaagcgttt gacgttacca tcaccaaacg catctacgac 120

ctggttaccg ataccaacgg ttttgttggc tacagcaccg agaaaaagac catcgccgtc 180

attatgcgcg gtagtaccac catcaccgat ttcgtcaacg acatcgacat cgcgctgatt 240

accccggaac tgtctggcgt tacctttccg agcgacgtca aaattatgcg cggcgttcat 300

cgtccgtggt ctgcagttca cgataccatt atcaccgagg tcaaagcgct gattgcgaaa 360

tacccggatt ataccctgga agcagttggt catagtctgg gcggcgcact gacctctatt 420

gcacatgttg cactggcaca gaattttccg gataaaagcc tggttagcaa cgcgctgaac 480

gcatttccga ttggtaacca ggcgtgggca gattttggta ccgcacaagc aggcaccttt 540

aatcgcggta ataacgttct ggacggcgtt ccgaatatgt atagcagccc gctggttaac 600

ttcaaacact acggcaccga gtactatagc agcggtaccg aagcatcaac cgttaaatgc 660

gaaggtcagc gcgataaaag ctgttctgct ggtaacggta tgtacgcagt taccccgggt 720

catatcgcga gtttcggcgt agttatgctg acggcaggtt gcggttatct gagt 774

<210> 6

<211> 774

<212> DNA

<213> Artificial sequence ()

<400> 6

gcaacagcag atgcggcagc atttccggat ctgcatagag cggcgaaact gagcagcgca 60

gcatatacag gatgcattgg aaaagcgttt gacgtcacga ttacaaaacg catttacgat 120

ctggtgacgg atacgaatgg atttgtcggc tacagcacag aaaaaaaaac gatcgcggtg 180

atcatgcgcg gaagcacaac aatcacggat tttgtcaacg atatcgacat cgcgctgatc 240

acaccggaac tgagcggagt tacatttccg agcgatgtca aaattatgcg cggagtccat 300

cgcccgtggt cagcagtcca cgacacgatc attacggaag tcaaagcgct gatcgcgaaa 360

tatccggatt atacgctgga agcggtgggc catagcctgg gaggagcact gacgagcatc 420

gcacatgtgg cactggcaca aaactttccg gataaaagcc tggtcagctt tgcgctgaat 480

gcgtttccga ttggcaatca ggcgtgggca gattttggaa cagcgcaggc aggcacgttt 540

aatagaggaa acaacgtgct ggatggcgtc ccgaatatgt atagcagccc gctggtcaat 600

tttaaacatt atggaacgga gtactacagc agcggcacgg aagcaagcac agtcaaatgc 660

gaaggacagc gcgataaaag ctgcagcgcg ggaaatggca tgtatgcggt gacaccgggc 720

catattgcga gctttggcgt cgttatgctg acggcaggat gcggatatct gagc 774

<210> 7

<211> 774

<212> DNA

<213> Artificial sequence ()

<400> 7

gctactgctg acgctgctgc ttttccagat ttgcacagag ccgctaagtt gtcttctgct 60

gcttacaccg gttgcattgg taaggctttc gacgtcacca tcaccaagag aatctacgac 120

ttggttaccg acactaacgg tttcgtcggt tactctaccg agaagaagac catcgctgtc 180

atcatgagag gttccaccac tatcaccgac ttcgtcaacg acatcgacat cgctctgatc 240

actcctgagt tgtctggagt taccttccca tctgacgtca agatcatgag aggtgttcac 300

agaccttggt ctgctgttca cgataccatc atcaccgagg ttaaggctct gatcgctaag 360

tacccagact acaccttgga agctgttggt cactctttgg gtggtgcttt gacttccatc 420

gctcacgttg ctttggctca aaacttccca gacaagtcct tggtttcttt cgccctgaac 480

gctttcccaa ttggtaacca agcttgggct gatttcggaa ctgctcaagc tggtaccttc 540

aacagaggta acaacgtcct ggacggagtt ccaaacatgt actcctcccc attggtcaac 600

ttcaagcact acggtaccga gtactactcc tctggtactg aggcttctac cgttaagtgc 660

gaaggtcaga gagacaagtc ctgttctgct ggtaacggta tgtacgcagt tactccaggt 720

cacatcgctt ctttcggagt cgttatgctg actgctggtt gcggatactt gtcc 774

<210> 8

<211> 29

<212> DNA

<213> Artificial sequence ()

<400> 8

cgcggatccg caactgctga cgccgctgc 29

<210> 9

<211> 34

<212> DNA

<213> Artificial sequence ()

<400> 9

cccaagcttt cagctcagat agccacaacc agca 34

<210> 10

<211> 305

<212> DNA

<213> Bacillus ()

<400> 10

gagctcagca ttattgagtg gatgattata ttccttttga taggtggtat gttttcgctt 60

gaacttttaa atacagccat tgaacatacg gttgatttaa taactgacaa acatcaccct 120

cttgctaaag cggccaagga cgctgccgcc ggggctgttt gcgtttttgc cgtgatttcg 180

tgtatcattg gtttacttat ttttttgcca aagctgtaat ggctgaaaat tcttacattt 240

attttacatt tttagaaatg ggcgtgaaaa aaagcgcgcg attatgtaaa atataaagtg 300

atagc 305

<210> 11

<211> 76

<212> DNA

<213> Bacillus subtilis ()

<400> 11

atgaacatca aaaagtttgc aaaacaagca acagtattaa cctttactac cgcactgctg 60

gcaggaggcg caactc 76

Claims (1)

1. A method for improving the alkali resistance of lipase is characterized in that the lipase is obtained by mutating the 157 th Asn to Phe of the lipase sequence shown in SEQ ID No. 1.

Images