CN106085984B - A kind of novel phospholipase D and its method for preparing phosphatidic acid, phosphatidylserine - Google Patents

A kind of novel phospholipase D and its method for preparing phosphatidic acid, phosphatidylserine Download PDF

Info

Publication number
CN106085984B
CN106085984B CN201610402557.7A CN201610402557A CN106085984B CN 106085984 B CN106085984 B CN 106085984B CN 201610402557 A CN201610402557 A CN 201610402557A CN 106085984 B CN106085984 B CN 106085984B
Authority
CN
China
Prior art keywords
phospholipase
mutant
pichia pastoris
carrier
high vigor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201610402557.7A
Other languages
Chinese (zh)
Other versions
CN106085984A (en
Inventor
刘逸寒
路福平
刘浩
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin University of Science and Technology
Original Assignee
Tianjin University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin University of Science and Technology filed Critical Tianjin University of Science and Technology
Priority to CN201910528115.0A priority Critical patent/CN110129299B/en
Priority to CN201910528114.6A priority patent/CN110129298B/en
Priority to CN201910527208.1A priority patent/CN110218712B/en
Priority to CN201910528146.6A priority patent/CN110283803B/en
Priority to CN201610402557.7A priority patent/CN106085984B/en
Priority to CN201910528141.3A priority patent/CN110129300B/en
Publication of CN106085984A publication Critical patent/CN106085984A/en
Application granted granted Critical
Publication of CN106085984B publication Critical patent/CN106085984B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C12N15/75—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for Bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/06—Alanine; Leucine; Isoleucine; Serine; Homoserine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6436—Fatty acid esters
    • C12P7/6445—Glycerides
    • C12P7/6481—Phosphoglycerides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P9/00—Preparation of organic compounds containing a metal or atom other than H, N, C, O, S or halogen
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/04—Phosphoric diester hydrolases (3.1.4)
    • C12Y301/04004—Phospholipase D (3.1.4.4)

Abstract

The invention belongs to the gene engineering technology fields of enzyme, and in particular to a kind of phospholipase D mutant and its preparation and application.Its technical solution is to carry out rite-directed mutagenesis to wild type phospholipase D using recombinant DNA technology, obtain the higher phospholipase D of vigor, then by high vigor phospholipase D in bacillus subtilis expression system, expression in pichia yeast expression system (including Pichia pastoris dissociate expression system and Pichia pastoris surface display system), obtain producing the recombinant bacterial strain of high vigor phospholipase D, after expression, the specific enzyme activity for detecting high vigor phospholipase D improves 38-140% compared with wild type phospholipase D, high vigor phospholipase D is in bacillus subtilis expression system, pichia yeast expression system, fermentation enzyme activity peak is respectively 36.8U/ml in Pichia pastoris surface display system, 48.1U/ml, 140.2U/ (g dry cell weight).

Description

A kind of novel phospholipase D and its method for preparing phosphatidic acid, phosphatidylserine
Technical field:
The invention belongs to the gene engineering technology fields of enzyme, and in particular to be obtained by overlapping pcr lactam enzyme by directional anagenesis in vitro The phospholipase D mutant that specific enzyme activity improves is obtained, and provides and phosphatidic acid and phosphatidylserine is prepared by high vigor phospholipase D catalysis Method.
Background technique:
Phospholipase D (PLD) is widely distributed, is present in various animals and plants and microorganism.PLD is to the phosphinylidyne in phospholipid molecule Oxygen key P-O works, and biocatalysis is mainly reflected in two kinds of reactions: (1) the terminal phosphate ester bond on hydrolytic phosphatide is raw At phosphatidic acid and hydroxy compounds；(2) in the presence of the compound for having another hydroxyl, phosphatidyl can be catalyzed and tied with it It closes, forms new phosphatide, i.e. phosphatidyl transfer reaction.
Phosphatidic acid (Phosphatidic acid, PA) is a kind of simple and common phosphatide, is widely present in animals and plants It is the basis of animal and plant cells biomembrane in cell.PA is by glycerol backbone, the fatty acid group of 1 or No. 2 position, No. 3 positions Phosphate composition.PA is the direct product of PLD effect, and PA is able to drive Ca2+Activation or synergistic activation various enzymes into the cell, with this Meanwhile PA may additionally facilitate cell mitogen, the formation for promoting intracellular superoxide, the contraction for causing muscle, promote hormone Secretion induces the effects of platelet aggregation.Based on the above effect, PA can be applicable to the side such as food industry, medical industry, cosmetics Face.
Phosphatidylserine (phosphatidylserine, PS) is a kind of generally existing phosphatide, is usually located at cell Film inner layer is the important component of cell membrane, due to participating in a series of film functional responses, especially in the nervous system of human body In, be one of the important component of brain cell film, to improve memory, relieve stress, repairs brain damage, treat children it is more The effects of moving disease, depression and prevention senile dementia significant effect.But there is certain purity phosphatidylserine nature Middle content is rare, therefore prepares with high purity, high-quality phosphatidylserine product and be of great significance.
Enzyme process prepares phosphatidic acid or phosphatidylserine refers under certain condition, is reacted with PLD catalysis substrate (such as PC) Phosphatidic acid or phosphatidylserine are generated, this method is compared to chemical synthesis with reaction condition is mild, by-product is few, product yield The advantages that high, high-quality.The difference of production phosphatidic acid or phosphatidylserine is that PLD catalysis reaction type is different, the former Belong to hydrolysis, the latter is then phosphatidyl transfer (transphosphatidylation) reaction by using PLD, right The head base of phosphatide is modified.
Enzyme molecule lactam enzyme by directional anagenesis in vitro belongs to the nonideal explosives of protein, belongs to the scope of protein engineering.Usual hand Section is the diversity for createing molecule in molecular level using molecular biology method, in conjunction with sensitive, high-throughput screening technique, So as to obtain ideal mutant in a short time.It is not required to understand the space structure of protein in advance, active site, urge The factors such as change mechanism, but special evolution conditions are artificially created, natural evolution mechanism is simulated, enzyme gene is transformed in vitro, Obtaining, there are certain expected features to change structure enzyme, unlike this, need to understand in advance the space structure of protein, active site, The factors such as catalyst mechanism, and shot the arrow at the target according to these factors and to do that be transformed to its DNA is rite-directed mutagenesis.
Rite-directed mutagenesis, also known as design and rational are exactly the insertion, deletion or substitution certain length in known DNA sequence dna Nucleotide sequence, as it rapidly, the efficient character and characterization for improving destination protein expressed by DNA, be gene studies A kind of highly useful means in work.Overlapping pcr used in the present invention is one kind of site-directed mutagenesis technique, the technology Two or more genetic fragments simple, can be carried out quickly to the splicing of outer-gene by termini-complementary, overlap-extension PCR.Weight Folded round pcr can obtain the product being difficult to by digestion with restriction enzyme, and fast and easy, carry out large fragment The rite-directed mutagenesis of gene, genetic fragment, which are deleted, and multiple coded sequences are fitting to connection has exclusive advantage.
Bacillus subtilis belongs to gram-positive bacteria.Use of many bacillus subtilises in fermentation industry is existing suitable Long history, no pathogenicity do not generate any endotoxin, and belong to human enteric bacteria and promote to grow beneficial to anaerobic bacteria, and produce The organic acids such as lactogenesis acid reduce gut pH, inhibit other pathogenic bacteria to grow indirectly, furthermore it can efficiently be secreted various Protein, in Microbial Genetics field, bacillus background research it is also fully aware of, codon-bias is unobvious, Fermentation is simple, growth rapidly, to culture medium without particular/special requirement the advantages that.
Pichia pastoris belongs to unicellular lower eukaryotes, is the more satisfactory tool of expression alien gene.It is in addition to tool Having prokaryotes to be easy to, culture, breeding is fast, is convenient for except the characteristics such as genetic engineering operation and high density fermentation, also as containing spy Strong AOX (alcohol oxidase gene) promoter having, can strictly regulate and control the expression of foreign gene with methanol.In addition, training Support at low cost, product is easily separated.Fermentation medium used is very cheap, and general carbon source is glycerol or glucose and methanol, remaining For inorganic salts.Foreign protein genes can be carried out stablizing heredity, and as eukaryotic expression system, Pichia pastoris is raw with eukaryon The subcellular structure of object has the posttranslational modifications machining functions such as glycosylation, fatty acylated, protein phosphorylation.Same saccharomyces cerevisiae Compared Deng tradition eukaryotic expression system, pichia yeast expression system have become modern molecular biology study most important tool and Model.In addition, Pichia pastoris surface display system not only has the post translational processing ability of foreign gene and the folding of albumen The advantages that being superimposed work and appropriateness glycosylation, moreover, the whole-cell catalyst obtained through the system can reuse to reduce Production cost.
In the present invention, high vigor phospholipase D and its mutant gene are respectively in bacillus subtilis expression system Expressed in pichia yeast expression system, obtain producing high vigor phospholipase D, after purification with substrate reactions, catalysis prepare phosphatidic acid, Phosphatidylserine.
Summary of the invention:
The purpose of the present invention is to provide a kind of high vigor phospholipase Ds, and prepare phosphatidic acid and phosphatidyl silk ammonia using it The method of acid.
To achieve the goals above, one of technical solution provided by the invention are as follows: a kind of phospholipase D mutant, is to be based on Phospholipase D amino acid sequence shown in SEQ ID No.2, at least one of 139th, 209,256,388,519 therein Amino acid is replaced into following amino acid: the 139th: Asp139Ile；209th: Asn209Ile；256th: Asp256Thr；388th: Gln388Cys；519th: Asp519Val；
The gene of the mutant is with 21102 gene of Hao Shi streptomycete (Streptomyces halstedii) TCCC Group is template, after cloning phospholipase D wild type gene plD (as shown in SEQ ID NO:1), is constructed by digestion, connection etc. Recombinant vector carries out rite-directed mutagenesis to wild type phospholipase D by overlapping pcr later, obtains mutant gene and (be shown in Table 1)。
To achieve the goals above, the two of technical solution provided by the invention are as follows: rebuild above-mentioned mutant gene Recombinant vector, and the high efficient expression in bacillus subtilis WB600 and Pichia pastoris GS115 obtain producing high vigor phospholipase D Recombinant bacterial strain, obtain high vigor phospholipase D by the technologies such as fermenting, extracting.
To achieve the goals above, the three of technical solution provided by the invention are as follows: use high vigor phosphorus prepared by the present invention Lipase D be catalyzed respectively phosphatidyl choline prepare phosphatidic acid, catalysis phosphatidyl choline and serine prepare phosphatidylserine.
It uses and such as gives a definition in the present invention:
1. the nomenclature of amino acid and DNA nucleic acid sequence
Using the generally acknowledged IUPAC nomenclature of amino acid residue, with three-letter codes form.DNA nucleic acid sequence is using generally acknowledged IUPAC nomenclature.
2. the mark of phospholipase D mutant
The amino acid being mutated in phospholipase D mutant is indicated using " amino acid of Original amino acid position replacement ".Such as Asn209Ile indicates that the amino acid of position 209 is substituted for Ile by the Asn of wild type phospholipase D.The number of position corresponds to The variation of the amino acid sequence number nucleotide of phospholipase D equally uses " original nucleic acid position replacement in SEQ ID NO:2 Nucleotide " indicate, Position Number corresponds to the nucleotides sequence column number of wild type phospholipase D in SEQ ID NO:1.
In the present invention, plD indicates the amino acid sequence of wild type phospholipase D, i.e. original series (such as SEQ ID NO:2 It is shown).Each mutant is indicated with the mode of plDm addend word x, and x is respectively 139,209,256,388,519, wherein 139 generations The 139th amino acid of table is substituted for Ile by Asp, and 209, which represent the 209th amino acids, is substituted for Ile by Asn, and 256 represent the 256th Amino acid is substituted for Thr by Asp, and 388, which represent the 388th amino acids, is substituted for Cys by Gln, and 519 represent the 519th amino acids Val is substituted for by Asp；X is also possible to xm-…-xnForm, indicate the combination mutant in several sites, such as plDm139-209 Indicate that the 139th amino acid is substituted for Ile by Asp, the 209th amino acids are substituted for the mutant of Ile by Asn.Each mutant Encoding gene is then indicated with the italic of its amino acid representation, if the encoding gene of mutant plDm139 is plDm139.
In the present invention, the combinatorial mutagenesis of amino acid, comprising as follows:
plDm139-209、plDm139-256、plDm139-388、plDm139-519、plDm209-256、plDm209- 388、plDm209-519、plDm256-388、plDm256-519、plDm388-519、plDm139-209-256、plDm139- 209-388、plDm139-209-519、plDm139-256-388、plDm139-256-519、plDm139-388-519、 plDm209-256-388、plDm209-256-519、plDm209-388-519、plDm256-388-519、plDm139-209- 256-388、plDm139-209-256-519、plDm139-209-388-519、plDm139-256-388-519、plDm209- 256-388-519,plDm139-209-256-388-519；
Table 1: sequence control table
The expressive host of the phospholipase D and its mutant is bacillus subtilis WB600, and expression vector is pBSA43；
The expressive host of the phospholipase D and its mutant is Pichia pastoris GS115, and expression vector is pPIC 9K；
The host cell of the phospholipase D mutant is Pichia pastoris GS115, display carrier pPIC9K-Flo.
Experimental procedure of the invention is specific as follows:
1, a kind of process for constructing high vigor phospholipase D mutant code gene includes the following steps:
(1) the wild type phospholipase D of Hao Shi streptomycete (Streptomyces halstedii) TCCC 21102 will be come from Gene is connect with carrier pUC-T, construction recombination plasmid pUC-T-plD, passes through over-lap PCR rite-directed mutagenesis wild type phospholipase D base Cause obtains high vigor phospholipase D mutant code gene；
(2) pUC-T-plDmx containing high vigor phospholipase D mutant code gene is saved.
2, one plant containing high vigor phospholipase D bacillus subtilis recombinant bacterial strain and high vigor phosphatide is prepared with this The process of enzyme D includes the following steps:
(1) pUC-T-plDmx containing high vigor phospholipase D mutant code gene of preservation is subjected to digestion, will To high vigor phospholipase D mutant code gene pass through with carrier bacillus coli-bacillus subtilis shuttle plasmid pBSA43 Connection has obtained new recombinant vector；
(2) recombinant vector is transformed into bacillus subtilis WB600, obtains recombinant bacterial strain, later sends out recombinant bacterial strain Ferment obtains high vigor phospholipase D.
3, one plant containing high vigor phospholipase D Pichia pastoris recombinant bacterial strain and high vigor phospholipase D is prepared with this Process include the following steps:
(1) pUC-T-plDmx containing high vigor phospholipase D mutant code gene of preservation is subjected to digestion, will To high vigor phospholipase D mutant code gene and expression vector pPIC 9K by connection obtain new recombinant vector；
(2) recombinant vector is transformed into Pichia pastoris GS115, obtained recombinant bacterial strain is screened by Geneticin and phosphorus The enzyme activity determination of lipase D obtains the superior strain of high vigor phospholipase D；
(3) it ferments after, prepares high vigor phospholipase D.
4, one plant containing high vigor phospholipase D Pichia pastoris surface display recombinant bacterial strain and high vigor is prepared with this The process of phospholipase D whole-cell catalyst includes the following steps:
(1) pUC-T-plDmx containing high vigor phospholipase D mutant code gene of preservation is subjected to digestion, will To high vigor phospholipase D mutant code gene and Pichia pastoris display carrier pPIC9K-Flo by connection obtain new weight Group carrier；
(2) recombinant vector is transformed into host strain Pichia pastoris GS115, obtains Pichia pastoris surface display phosphorus Lipase D recombinant bacterial strain.
(3) the high vigor phospholipase D whole-cell catalyst of yeast cell surface display is prepared after recombinant bacterial strain fermenting.
5, the method for phospholipase D of the present invention production phosphatidic acid, phosphatidylserine is utilized.
The utility model has the advantages that
1, the present invention using overlapping pcr to wild type phospholipase D progress rite-directed mutagenesis (plDm139, plDm209, plDm256、plDm388、plDm519、plDm139-209、plDm139-256、plDm139-388、plDm139-519、 plDm209-256、plDm209-388、plDm209-519、plDm256-388、plDm256-519、plDm388-519、 plDm139-209-256、plDm139-209-388、plDm139-209-519、plDm139-256-388、plDm139-256- 519、plDm139-388-519、plDm209-256-388、plDm209-256-519、plDm209-388-519、plDm256- 388-519、plDm139-209-256-388、plDm139-209-256-519、plDm139-209-388-519、plDm139- 256-388-519, plDm209-256-388-519, plDm139-209-256-388-519), high vigor phospholipase D is obtained, At 37 DEG C, above-mentioned high vigor phospholipase D at least improves 38.2% than wild type phospholipase D enzyme activity.
2, the present invention has used bacillus subtilis expression system, pichia yeast expression system, Pichia pastoris surface respectively Display systems, high vigor phospholipase D ferment in each expression system enzyme activity peak be respectively 36.8U/ml, 48.1U/ml, 140.2U/ (g dry cell weight) improves 140% or so compared with wild type.
3, the present invention is respectively 72.4% using the conversion ratio of high vigor phospholipase D production phosphatidic acid and phosphatidylserine With the utilization of 78.5%, especially yeast display systems, phospholipase D is showed in yeast surface, yeast cells is in production phosphatide Fixation support is acted as while enzyme again, greatly reduces cost.
Detailed description of the invention:
Fig. 1 is the PCR amplification electropherogram of wild type phospholipase D of the present invention
Wherein: M is DNA Marker, and 1 is phospholipase D；
Fig. 2 is recombinant plasmid pBSA43-plDmx digestion verification figure of the present invention
Wherein: M is DNA Marker, and 1 is pBSA43-plDmx through BamHI and HindIII double digestion；
Fig. 3 is recombinant plasmid pPIC9K-plDmx digestion verification figure of the present invention
Wherein: M is DNA Marker, and 1 is pPIC 9K-plDmx through EcoRI and NotI double digestion；
Fig. 4 is recombinant plasmid pPIC 9K-Flo-plDmx digestion verification figure of the present invention
Wherein: M is DNA Marker, and 1 passes through SnaBI and EcoRI double digestion for pPIC 9K-Flo, and 2 be pPIC 9K- Flo passes through SnaBI single endonuclease digestion, and 3 pass through SnaBI and EcoRI double digestion for pPIC 9K-Flo-plDmx.
Specific embodiment:
Technology contents of the invention are described further below with reference to embodiment, but the present invention is not limited solely to these implementations Example cannot be limited the scope of protection of the present invention with following embodiments.
Embodiment 1: the acquisition of wild type phospholipase D
1. wild type phospholipase D comes from Hao Shi streptomycete (Streptomyces halstedii) TCCC 21102, Extract its genomic DNA.
Wherein the extraction step of Hao Shi streptomyces gene group DNA is as follows:
(1) it is inoculated in 50mL appropriate culture medium from one ring bacterium of picking on the plate of culture thallus, 26 DEG C, 150r/min training Support 2-3d.
(2) take 1mL culture solution in 1.5mL EP pipe after, 8000r/min is centrifuged 20min, and supernatant, molten with 200 μ L Liquid I or aqua sterilisa are resuspended.
(3) plus the 50mg/mL lysozyme of 20-50 μ L digests 0.5-1h at 37 DEG C.
(4) the 2%SDS solution of 100 μ L is added, sufficiently reaction to bacteria suspension is presented thick.
(5) isometric Tris balance phenol: chloroform=1:1 is added, is uniformly mixed, 12000rpm is centrifuged 5min, by supernatant It is transferred in another EP pipe.
(6) it extracts repeatedly twice, it is finally primary with isometric chloroform again up to the appearance of no albumin layer.
(7) isometric isopropanol precipitating DNA, 12000r/min centrifugation 5min is added, discards supernatant, with 500 μ L 75% Ethanol washing 2 times, 12000r/min is centrifuged 5min after piping and druming every time.
(8) EP pipe is inverted in filter paper or be placed in 55 DEG C of metal baths, with TE buffer or gone out after drying to alcohol-free taste The dissolution of bacterium water, -20 DEG C of preservations.
2. sequence is as follows by the amplimer of phospholipase D design wild type phospholipase D:
Upstream P1 (SEQ ID NO:5): ATGATCAAGGTTGGTGGTGTTGCTG
Downstream P2 (SEQ ID NO:6): TTAACCCTGACACAAACCTCTAGCGTAATCGT
The reaction system of PCR amplification is 50 μ L, consisting of:
2×LA buffer 25μL
dNTPs(2.5mmol/L) 2μL
Upstream primer P1 (20 μm of ol/L) 5μL
Downstream primer P2 (20 μm of ol/L) 5μL
Hao Shi streptomyces gene group DNA 2μL
LA Taq archaeal dna polymerase 0.5μL
ddH2O 10.5μL
Total volume 50μL
The setting of amplification program are as follows:
A. initial denaturation: 95 DEG C of 5min；
B. it is denaturalized: 95 DEG C of 30s；
C. it anneals: 70 DEG C 45；
D. extend: 72 DEG C of 90s；
E.b-d reacts 30 circulations；
F. extend: 72 DEG C of 10min.
PCR product is subjected to agarose gel electrophoresis, it can be seen that the band of wild type phospholipase D, total 1683bp (see Fig. 1), then PCR product is recycled by miniprep dna QIAquick Gel Extraction Kit, obtain wild type phospholipase D, i.e. plD.
Embodiment 2: obtaining high vigor phospholipase D, by taking Asn209Ile single amino acids mutant as an example, final ammonia Base acid sequence is as shown in table 1.
1. wild type phospholipase D is attached with carrier T.
PlD after purification and pUC-T carrier is attached, and then recombinant plasmid is transferred in bacillus coli DH 5 alpha, is led to EcoRI, MluI double digestion are crossed, good authentication wild type phospholipase D has been cloned into carrier T.
2. carrying out the rite-directed mutagenesis of single site by overlapping pcr
Rite-directed mutagenesis is carried out based on overlapping pcr, to obtain high vigor phospholipase D, design primer is as follows:
Upstream P1 (SEQ ID NO.5): ATGATCAAGGTTGGTGGTGTTGCTG
Downstream P2 (SEQ ID NO.6): TTAACCCTGACACAAACCTCTAGCGTAATCGT
Overlapping primers P3 (SEQ ID NO.7): ATGGAAGCAACGATCAAAGTGATGTTAGCAGCAGCA
Overlapping primers P4 (SEQ ID NO.8): TGCTGCTGCTAACATCACTTTGATCGTTGCTTCCAT
Overlapping primers P3 and P4 contain the mutation to 209 amino acids residues.
By recombinant plasmid pUC-T-plD, i.e. the recombinant vector that connect with pUC-T carrier of wild type phospholipase D is mould Plate carries out PCR amplification；
PCR1, reaction system are 50 μ L, consisting of:
2×LA buffer 25μL
dNTPs(2.5mmol/L) 2μL
Upstream primer P1 (20 μm of ol/L) 5μL
Downstream primer P4 (20 μm of ol/L) 5μL
Recombinant plasmid pUC-T-plD 2μL
LA Taq DNA polymerase 0.5μL
ddH2O 10.5μL
Total volume 50μL
PCR2, reaction system are 50 μ L, consisting of:
2×LA buffer 25μL
dNTPs(2.5mmol/L) 2μL
Upstream primer P3 (20 μm of ol/L) 5μL
Downstream primer P2 (20 μm of ol/L) 5μL
Recombinant plasmid pUC-T-plD 2μL
LA Taq DNA polymerase 0.5μL
ddH2O 10.5μL
Total volume 50μL
The setting of PCR1 and PCR2 amplification program are as follows:
A. initial denaturation: 95 DEG C of 5min；
B. it is denaturalized: 95 DEG C of 30s；
C. it anneals: 68 DEG C of 30s；
D. extend: 72 DEG C of 45s；
E.b-d reacts 10 circulations；
F. extend: 72 DEG C of 10min.
PCR3, reaction system are as follows:
The setting of PCR3 amplification program are as follows:
A. initial denaturation: 95 DEG C of 5min；
B. it is denaturalized: 95 DEG C of 30s；
C. it anneals: 70 DEG C of 45s；
D. extend: 72 DEG C of 90s；
E.b-d reacts 10 circulations；
F. extend: 72 DEG C of 10min.
PCR4, reaction system are as follows:
2×buffer 25μL
dNTPs(2.5mmol/L each) 2μL
Upstream primer P1 (20 μm of ol/L) 5μL
Downstream primer P2 (20 μm of ol/L) 5μL
PCR3 product 2μL
LA Taq DNA polymerase 0.5μL
ddH2O 10.5μL
Total volume 50μL
The setting of PCR4 amplification program are as follows:
A. initial denaturation: 95 DEG C of 5min；
B. it is denaturalized: 95 DEG C of 30s；
C. it anneals: 70 DEG C of 45s；
D. extend: 72 DEG C of 90s；
E.b-d reacts 30 circulations；
F. extend: 72 DEG C of 10min.
(Beijing Hua Da bio-engineering corporation) is sequenced in finally obtained PCR product, the results showed that, amplification obtains at this time The phospholipase D segment plDm209 of Asn209Ile.
Embodiment 3: the phospholipase D variant of multiple amino acid mutations is obtained, on the basis of single amino acids mutation with weight Folded round pcr carries out Asp139Ile, Asp256Thr, Gln388Cys, Asp519Val on the basis of Asn209Ile mutant For mutation, final amino acid sequence is as shown in SEQ ID NO:4.
Specific strategy is: first realizing double mutation on the basis of single mutation, then carries out third, the 4th and the 5th ammonia The mutation of base acid.
The mutation of Asp519Val is realized on the basis of Asn209Ile first, step and embodiment 2 are consistent, and design overlapping is drawn Object, as follows:
Upstream P1 (SEQ ID NO.5): ATGATCAAGGTTGGTGGTGTTGCTG
Downstream P2 (SEQ ID NO.6): TTAACCCTGACACAAACCTCTAGCGTAATCGT
Overlapping primers P5 (SEQ ID NO.9): CAACAACGTAACCGAAGACTTGCAACCAGGATGGG
Overlapping primers P6 (SEQ ID NO.10): CCCATCCTGGTTGCAAGTCTTCGGTTACGTTGTTG
Overlapping primers P5 and P6 contain the mutation to 519 amino acids residues.
By recombinant plasmid pUC-T-plDm209, i.e. the weight that is connect with pUC-T carrier of the gene of encoding mutant body plDm209 Group carrier carries out PCR amplification for template；
PCR1, reaction system are 50 μ L, consisting of:
2×LA buffer 25μL
dNTPs(2.5mmol/L) 2μL
Upstream primer P1 (20 μm of ol/L) 5μL
Downstream primer P6 (20 μm of ol/L) 5μL
Recombinant plasmid pUC-T-plDm209 2μL
LA Taq DNA polymerase 0.5μL
ddH2O 10.5μL
Total volume 50μL
PCR2, reaction system are 50 μ L, consisting of:
2×LA buffer 25μL
dNTPs(2.5mmol/L) 2μL
Upstream primer P5 (20 μm of ol/L) 5μL
Downstream primer P2 (20 μm of ol/L) 5μL
Recombinant plasmid pUC-T-plDm209 2μL
LA Taq DNA polymerase 0.5μL
ddH2O 10.5μL
Total volume 50μL
The setting of PCR1 and PCR2 amplification program are as follows:
A. initial denaturation: 95 DEG C of 5min；
B. it is denaturalized: 95 DEG C of 30s；
C. it anneals: 68 DEG C of 30s；
D. extend: 72 DEG C of 45s；
E.b-d reacts 10 circulations；
F. extend: 72 DEG C of 10min.
PCR3, reaction system are as follows:
2×buffer 25μL
dNTPs(2.5mmol/L each) 2μL
PCR1 product 1μL
PCR2 product 1μL
LA Taq DNA polymerase 0.5μL
ddH2O 20.5μL
Total volume 50μL
The setting of PCR3 amplification program are as follows:
A. initial denaturation: 95 DEG C of 5min；
B. it is denaturalized: 95 DEG C of 30s；
C. it anneals: 70 DEG C of 45s；
D. extend: 72 DEG C of 90s；
E.b-d reacts 10 circulations；
F. extend: 72 DEG C of 10min.
PCR4, reaction system are as follows:
2×buffer 25μL
dNTPs(2.5mmol/L each) 2μL
Upstream primer P1 (20 μm of ol/L) 5μL
Downstream primer P2 (20 μm of ol/L) 5μL
PCR3 product 2μL
LA Taq DNA polymerase 0.5μL
ddH2O 10.5μL
Total volume 50μL
The setting of PCR4 amplification program are as follows:
A. initial denaturation: 95 DEG C of 5min；
B. it is denaturalized: 95 DEG C of 30s；
C. it anneals: 70 DEG C of 45s；
D. extend: 72 DEG C of 90s；
E.b-d reacts 30 circulations；
F. extend: 72 DEG C of 10min.
(Beijing Hua Da bio-engineering corporation) is sequenced in finally obtained PCR product, the results showed that, amplification obtains at this time The phospholipase D segment plDm209-519 of the bis- mutation of Asn209Ile and Asp519Val, sequence are as shown in table 1.
It is consistent with embodiment 2 or/and 3 step of embodiment to continue other each mutagenesis steps, all mutant primers Sequence see the table below, and above-mentioned steps are pressed on the basis of plDm209-519, and only according to the form below replaces primer, successively carry out The point mutation of Asp139Ile, Asp256Thr, Gln388Cys, and give to sequencing company and be sequenced, it is prominent that confirmation obtains 5 amino acid The phospholipase D segment plDm139-209-256-388-519 of height, amino acid sequence is as shown in SEQ ID NO.4, nucleosides Acid sequence is as shown in SEQ ID NO.3.
Mutant The end F primer The end R primer
plDm139 P7:SEQ ID NO.11 P8:SEQ ID NO.12
plDm209 P3:SEQ ID NO.7 P4:SEQ ID NO.8
plDm256 P9:SEQ ID NO.13 P10:SEQ ID NO.14
plDm388 P11:SEQ ID NO.15 P12:SEQ ID NO.16
plDm519 P5:SEQ ID NO.9 P6:SEQ ID NO.10
Embodiment 4: the building of the high vigor phospholipase D recombinant bacterium of bacillus subtilis
1. the building of expression vector pBSA43
Using bacillus coli-bacillus subtilis shuttle cloning vector pBE2 as skeleton, it is cloned into a strong bacillus Constitutive promoter P43 and the levansucrase signal sequence sacB that recombinant protein can be made directly to be secreted into culture medium are obtained Obtained expression vector pBSA43.It has AmprAnd KmrGene, can in Escherichia coli using amicillin resistance as Selection markers, while again can be in bacillus subtilis, bacillus licheniformis using kalamycin resistance as selection markers.
2. constructing high vigor phospholipase D expression vector pBSA43-plDmx
By the high vigor phospholipase D of over-lap PCR building and bacillus subtilis expression vector pBSA43 all through BamHI It with HindIII double digestion, is then attached, building obtains recombinant plasmid pBSA43-plDmx, conversion to bacillus coli DH 5 alpha Competent cell selects positive transformant, extracts plasmid and carries out digestion verification and be sequenced, determination constructs successfully, that is, is recombinated Bacterial strain pBSA43-plDmx.
3. expression vector pBSA43-plDmx converts bacillus subtilis WB600
It is added in 60 μ L competent cells and 1 μ L (50ng/ μ L) pBSA43-plDmx, mixes into the 1mm electricity revolving cup of pre-cooling Even and ice bath 5min is arranged parameter (25 μ F, 200 Ω, 4.5-5.0ms), and electric shock is primary, and 1mL recovery culture is immediately added Base (LB+0.5mol/L sorbierite+0.5mol/L mannitol) draws 37 DEG C of shaking table shake cultures into 1.5mlEP pipe after mixing 3h leaves and takes 200 μ L recovery objects and is coated on resistant LB plate after centrifugation, 37 DEG C are cultivated for 24 hours, picking transformant, upgrading Grain, digestion verification (as shown in Figure 2), obtain bacillus subtilis recombinant bacterial strain WB600/pBSA43-plDmx.
Embodiment 5: the free expression recombinant bacterium of the building high vigor phospholipase D of Pichia pastoris
1. the building of high vigor phospholipase D Expression vector pPIC9K-plDmx
Over-lap PCR purified product and yeast expression vector pPIC 9K are passed through into EcoRI and NotI double digestion, then It is attached, converts into bacillus coli DH 5 alpha competent cell, select AmprPositive transformant, upgrading after bacterium colony culture Grain, digestion verification succeed (as shown in Figure 3) to get recombinant expression carrier pPIC 9K-plDmx is arrived.
2. constructing high vigor phospholipase D height expresses recombinant bacterial strain
(1) linearisation of Plasmid DNA
Before converting Pichia pastoris, respectively with SacI and SalI restriction enzyme to recombinant expression plasmid pPIC 9K- PlDmx carries out linearized enzyme digestion.
(2) linearization plasmid pPIC 9K-plDmx electricity goes to Pichia pastoris
1. competent cell and linearization plasmid pPIC 9K-plDmx are added in the centrifuge tube of 1.5mL pre-cooling, piping and druming It mixes, is then added in the electric revolving cup of pre-cooling；
2. to conversion cup ice bath 10min, subsequent electrotransformation；
3. after electric shock, the sorbitol solution of the 1mol/L of 1mL pre-cooling is added immediately in electric revolving cup, and electricity is turned liquid transfer Into new 1.5mL centrifuge tube；
4. 30 DEG C of stationary culture 1-2h, absorption Pichia pastoris GS115 electricity turns 200 μ L of liquid and is coated on MD culture medium.
(3) identification of positive transformant and the screening of phospholipase D superior strain
1. being coated with electricity turns the MD plate of liquid in 30 DEG C of culture 2-3d；
2. picking transformant extracts Yeast genome, carries out PCR as template after 100 times of dilution.Separately to be transferred to empty plasmid The Pichia pastoris GS115 of pPIC 9K/pPIC 9K determines positive transformant as control.
3. first picking single colonie on the plate of geneticin resistant containing various concentration is bigger after determining positive transformant High geneticin resistant transformant then measures the phospholipase D enzyme activity for the transformant picked out, to obtain phospholipase D respectively Superior strain GS115/pPIC 9K-plDmx.
Embodiment 6: the building of the high vigor phospholipase D recombinant bacterium of Pichia pastoris surface display
1. the building of recombinant plasmid pPIC9K-Flo-plDmx
By over-lap PCR purified product and Pichia pastoris surface display expression vector pPIC 9K-Flo by SnaBI and EcoRI double digestion, is then attached, and converts into bacillus coli DH 5 alpha competence, selects AmprPositive transformant, bacterium colony Upgrading grain after culture, digestion verification succeed (as shown in Figure 4) to get recombinant expression carrier pPIC 9K-Flo-plDmx is arrived.
2. the building of Pichia pastoris recombinant bacterium
By the correct recombinant expression carrier pPIC 9K-Flo-plDmx of sequence verification after SalI is linearized, electrotransformation is used Method converts Pichia pastoris GS115, and MD plate screening recon obtains the high vigor phospholipase D weight of Pichia pastoris surface display Group bacterium GS115/pPIC 9K-Flo-plDmx.
Embodiment 7: expression and preparation of the high vigor phospholipase D in bacillus subtilis recombinant bacterium
1. bacillus subtilis recombinant bacterial strain WB600/pBSA43-plDmx is inoculated in and receives mycin (50 μ g/mL) LB containing card In fluid nutrient medium, 37 DEG C, 220r/min overnight incubation；
2. 37 DEG C, 220r/min cultivates 48h to get high vigor is arrived by the switching of 1% inoculum concentration in the LB culture medium of 50mL Phospholipase D crude enzyme liquid；
3. then using salt fractionation method precipitate zymoprotein, collect protein precipitation, after dissolution, dialyse desalination, then through from After sub- displacement chromatography, gel chromatography, the pure enzyme enzyme powder of high vigor phospholipase D is made in freeze-drying.
Embodiment 8: expression and preparation of the high vigor phospholipase D in the free expression recombinant bacterium of Pichia pastoris
1. the Pichia pastoris recombinant bacterium GS115/pPIC 9K-plDmx on picking YPD plate is seeded to the YPD liquid of 50ml In culture medium, 30 DEG C, 250r/min culture for 24 hours；
2. being forwarded in BMGY culture medium with 1% inoculum concentration, 30 DEG C, 250r/min is cultivated about for 24 hours, subsequent 4000r/ Min centrifugation 5min obtains thallus, is forwarded to BMMY culture medium；
3. continuing to cultivate, 30 DEG C, 250r/min, every adding 250 μ L methanol for 24 hours.After culture 5 days, it is centrifuged to obtain supernatant, Obtain the crude enzyme liquid of phospholipase D；
4. then using salt fractionation method precipitate zymoprotein, collect protein precipitation, after dissolution, dialyse desalination, then through from After sub- displacement chromatography, gel chromatography, the pure enzyme enzyme powder of high vigor phospholipase D is made in freeze-drying.
Embodiment 9: the preparation of the high vigor phospholipase D whole-cell catalyst of Pichia pastoris surface display
1. the high vigor phospholipase D recombinant bacterium GS115/pPIC of Pichia pastoris surface display on picking YPD plate 9K-Flo-plDmx is seeded in the YPD fluid nutrient medium of 50ml, 30 DEG C, 250r/min culture for 24 hours；
2. being transferred in fresh BMGY culture medium with 1% inoculum concentration, 30 DEG C, 250r/min is cultivated about for 24 hours, then 4000r/min centrifugation 5min obtains thallus, is forwarded to BMMY culture medium；
3. continuing to cultivate, 30 DEG C, 250r/min, every adding 250 μ L methanol for 24 hours.After culture 5 days, it is collected by centrifugation and takes Thallus, used film water rinse 1-2 times, and Pichia pastoris surface display height is made through vacuum freeze drying after addition protective agent and lives Power phospholipase D cell catalyst.
Embodiment 10: phospholipase D vitality test
1. phospholipase D enzyme activity determination principle
Carry out Activity determination using enzyme-linked colorimetric method: phospholipase D catalyzing hydrolysis L- α-lecithin generates choline, and choline is in gallbladder Generate hydrogen peroxide under the action of alkali oxidizing ferment, hydrogen peroxide under the action of peroxidase with 4- amino antipyrine and benzene Phenol generates quinone imines substance that show color, has light absorption value under 500nm wavelength.
2. phospholipase D enzyme activity determination method
(1) lecithin emulsions: 0.345g lecithin, 2ml ether, 3ml7.5%TritanX-100,20mlH2O, it is sufficiently mixed It is even.
(2) reaction terminating liquid: 1M Tris-HCl, 0.5M EDTA, pH8.0
The determination step of phospholipase D:
1.15ml lecithin emulsions, 0.1ml 100mM Tris-HCl, 0.05ml CaCl are added in 10ml test tube2, 0.1ml crude enzyme liquid, 37 DEG C of water-bath 10min are then added 0.2ml reaction terminating liquid, boil 5min, be cooled to room temperature.Then It is added containing 2U containing choline oxidase, 4U peroxidase, 2mg 4- antipyrine, 1mg phenol, 20mg Tritan X-100 4ml 10mM Tris-HCl, 37 DEG C of reaction 20min then survey light absorption value at 500nm.
Blank sample is returned to zero with the enzyme solution in water substitution reaction with this.
Enzyme activity definition: when pH=8.0, T=37 DEG C, catalyzing hydrolysis L- α-lecithin discharges 1.0 μ in phospholipase D 1min Enzyme amount required for the choline of mol.
The enzyme activity of phospholipase D enzyme activity determination, the high vigor phospholipase D that measurement fermentation obtains is listed as follows:
Embodiment 11: phosphatidic acid is prepared with high vigor phospholipase D
Substrate is 1g soybean lecithin (PC content 90%), is dissolved in the phosphate buffer of 10ml pH7.0, by every milliliter Reaction system 3U high vigor phospholipase D is added, wherein high vigor phospholipase D is that prepare (can be by any by 7-9 of the embodiment of the present invention Mutant ferments to obtain, and enzyme powder additive amount reaches 3U/ml when catalysis).40 DEG C of reaction temperature, make in magnetic stirrer With lower reaction 12h, phosphatidic acid is then obtained by 30ml chloroform/methanol (2:1) extraction, the conversion ratio for preparing phosphatidic acid is 72.4%.
Embodiment 12: phosphatidylserine is prepared with high vigor phospholipase D
Substrate is the serine of 1g soybean lecithin (PC content 90%) and 2.5g, is dissolved in the acetic acid-of 5ml pH5.5 respectively It in sodium acetate buffer, finally mixes, until making total volume 10ml, 6U high vigor phosphatidase is added by every milliliter of reaction system D, wherein high vigor phospholipase D is that 7-9 of the embodiment of the present invention is prepared and (can be fermented to obtain by any mutant, enzyme powder adds when catalysis Dosage reaches 6U/ml).40 DEG C of reaction temperature, 12h is reacted under magnetic stirrer effect, then passes through 30ml chlorine Imitative/methanol (2:1) extraction obtains phosphatidyl serine, and the conversion ratio for preparing phosphatidylserine is 78.5%.

Claims (6)

1. a kind of phospholipase D mutant, which is characterized in that it is based on phospholipase D amino acid sequence shown in SEQ ID No.2, In the 139th, 209,256,388,519 amino acids be replaced into following amino acid:
139th: Asp139Ile；
209th: Asn209Ile；
256th: Asp256Thr；
388th: Gln388Cys；
519th: Asp519Val.
2. the encoding gene of phospholipase D mutant described in claim 1.
3. the encoding gene of phospholipase D mutant as claimed in claim 2, which is characterized in that such as sequence table SEQ ID No.3 It is shown.
4. the purposes of phospholipase D mutant or gene as claimed in claim 2 described in claim 1, which is characterized in that be used for phosphorus The preparation of resin acid and phosphatidylserine.
5. a kind of carrier or host cell comprising gene as claimed in claim 2, which is characterized in that the host cell is withered Careless Bacillus sp WB600, carrier pBSA43；Or the host cell is Pichia pastoris GS115, carrier pPIC9K；Or Host cell described in person is Pichia pastoris GS115, carrier pPIC9K-Flo.
6. the preparation method of phospholipase D mutant described in claim 1, which is characterized in that steps are as follows:
(1) digestion will be carried out after gene PCR as claimed in claim 2 amplification, connect to have obtained new recombinant vector with carrier；
(2) recombinant vector is transformed into host cell, obtains recombinant bacterial strain, recombinant bacterial strain ferments later, obtain high vigor Phospholipase D；
The carrier is pBSA43, and host cell is bacillus subtilis WB600；Or the carrier is pPIC9K, Su Zhuxi Born of the same parents are Pichia pastoris GS115；Or carrier is pPIC9K-Flo, host cell is Pichia pastoris GS115.
CN201610402557.7A 2016-06-02 2016-06-02 A kind of novel phospholipase D and its method for preparing phosphatidic acid, phosphatidylserine Active CN106085984B (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
CN201910528115.0A CN110129299B (en) 2016-06-02 2016-06-02 Phospholipase D and application thereof
CN201910528114.6A CN110129298B (en) 2016-06-02 2016-06-02 Phospholipase D mutant and application thereof
CN201910527208.1A CN110218712B (en) 2016-06-02 2016-06-02 Phospholipase D mutant and application thereof in preparation of phosphatidic acid and phosphatidylserine
CN201910528146.6A CN110283803B (en) 2016-06-02 2016-06-02 Phospholipase D and method for preparing phosphatidic acid and phosphatidylserine by using phospholipase D
CN201610402557.7A CN106085984B (en) 2016-06-02 2016-06-02 A kind of novel phospholipase D and its method for preparing phosphatidic acid, phosphatidylserine
CN201910528141.3A CN110129300B (en) 2016-06-02 2016-06-02 Phospholipase D

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610402557.7A CN106085984B (en) 2016-06-02 2016-06-02 A kind of novel phospholipase D and its method for preparing phosphatidic acid, phosphatidylserine

Related Child Applications (5)

Application Number Title Priority Date Filing Date
CN201910528141.3A Division CN110129300B (en) 2016-06-02 2016-06-02 Phospholipase D
CN201910528115.0A Division CN110129299B (en) 2016-06-02 2016-06-02 Phospholipase D and application thereof
CN201910527208.1A Division CN110218712B (en) 2016-06-02 2016-06-02 Phospholipase D mutant and application thereof in preparation of phosphatidic acid and phosphatidylserine
CN201910528146.6A Division CN110283803B (en) 2016-06-02 2016-06-02 Phospholipase D and method for preparing phosphatidic acid and phosphatidylserine by using phospholipase D
CN201910528114.6A Division CN110129298B (en) 2016-06-02 2016-06-02 Phospholipase D mutant and application thereof

Publications (2)

Publication Number Publication Date
CN106085984A CN106085984A (en) 2016-11-09
CN106085984B true CN106085984B (en) 2019-07-19

Family

ID=57227467

Family Applications (6)

Application Number Title Priority Date Filing Date
CN201610402557.7A Active CN106085984B (en) 2016-06-02 2016-06-02 A kind of novel phospholipase D and its method for preparing phosphatidic acid, phosphatidylserine
CN201910528141.3A Active CN110129300B (en) 2016-06-02 2016-06-02 Phospholipase D
CN201910527208.1A Active CN110218712B (en) 2016-06-02 2016-06-02 Phospholipase D mutant and application thereof in preparation of phosphatidic acid and phosphatidylserine
CN201910528115.0A Active CN110129299B (en) 2016-06-02 2016-06-02 Phospholipase D and application thereof
CN201910528146.6A Active CN110283803B (en) 2016-06-02 2016-06-02 Phospholipase D and method for preparing phosphatidic acid and phosphatidylserine by using phospholipase D
CN201910528114.6A Active CN110129298B (en) 2016-06-02 2016-06-02 Phospholipase D mutant and application thereof

Family Applications After (5)

Application Number Title Priority Date Filing Date
CN201910528141.3A Active CN110129300B (en) 2016-06-02 2016-06-02 Phospholipase D
CN201910527208.1A Active CN110218712B (en) 2016-06-02 2016-06-02 Phospholipase D mutant and application thereof in preparation of phosphatidic acid and phosphatidylserine
CN201910528115.0A Active CN110129299B (en) 2016-06-02 2016-06-02 Phospholipase D and application thereof
CN201910528146.6A Active CN110283803B (en) 2016-06-02 2016-06-02 Phospholipase D and method for preparing phosphatidic acid and phosphatidylserine by using phospholipase D
CN201910528114.6A Active CN110129298B (en) 2016-06-02 2016-06-02 Phospholipase D mutant and application thereof

Country Status (1)

Country Link
CN (6) CN106085984B (en)

Families Citing this family (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106085984B (en) * 2016-06-02 2019-07-19 天津科技大学 A kind of novel phospholipase D and its method for preparing phosphatidic acid, phosphatidylserine
CN106957850B (en) * 2017-05-12 2020-06-12 南京工业大学 Genetically engineered bacterium for producing phospholipase D and construction method and application thereof
CN107312756A (en) * 2017-07-10 2017-11-03 江苏诚信药业有限公司 It is a kind of to catalyze and synthesize biology enzyme of phosphatidylserine and its preparation method and application
CN107365755A (en) * 2017-09-01 2017-11-21 天津科技大学 A kind of novel lipase and its gene, engineering bacteria and preparation method
CN107384893A (en) * 2017-09-01 2017-11-24 天津科技大学 A kind of thermostable lipase and its preparation and application
CN107586764B (en) * 2017-09-26 2020-06-09 天津科技大学 Glutamine transaminase mutant, gene, engineering bacteria and preparation method thereof
CN109957520B (en) * 2017-12-25 2022-12-09 丰益(上海)生物技术研发中心有限公司 Pichia pastoris strain for exogenous gene expression
CN108159421B (en) * 2018-02-05 2021-05-18 苏州大学 Application of phosphatidylserine blocking agent in preparation of medicine for treating diseases related to platelet quantity reduction
CN108103115B (en) * 2018-03-02 2021-07-06 江苏中酶生物科技有限公司 Method for preparing phosphatidic acid by micro-aqueous phase
CN108795837B (en) * 2018-07-06 2021-01-29 江南大学 Bacillus subtilis engineering bacterium for efficiently expressing phospholipase D
CN108841770A (en) * 2018-07-06 2018-11-20 江南大学 A kind of bacillus subtilis engineering bacteria that can express phospholipase D
CN111051505B (en) * 2018-12-29 2023-11-03 邦泰生物工程(深圳)有限公司 Phospholipase D mutant, application thereof and method for preparing phosphatidylserine by using phospholipase D mutant
CN110004124A (en) * 2019-02-28 2019-07-12 江南大学 A kind of encoding gene of phospholipase D and its expression and application
CN114891765B (en) * 2019-11-21 2023-12-19 天津科技大学 Phospholipase and application thereof
CN111363733B (en) * 2020-03-10 2022-04-08 天津科技大学 Heat-resistant phospholipase D mutant and preparation method thereof and method for synthesizing functional phospholipid
CN112662645B (en) * 2021-01-19 2022-04-22 华南理工大学 Sphingomyelinase D mutant and application thereof
CN112899256B (en) * 2021-01-29 2023-03-21 华南理工大学 Low-temperature-resistant phospholipase D from Antarctic bacteria and preparation method and application thereof
CN113801862B (en) * 2021-08-20 2023-06-20 华南理工大学 Marine streptomycete phospholipase D mutant and preparation method of recombinant expression strain thereof
CN116790553B (en) * 2023-08-25 2023-11-10 中国海洋大学 Phospholipase D-PKV-S109L and application thereof

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101426918A (en) * 2004-03-08 2009-05-06 戴弗萨公司 Phospholipases, nucleic acids encoding them and methods for making and using them
CN101558154A (en) * 2006-09-21 2009-10-14 维莱尼姆公司 Phospholipases, nucleic acids encoding them and methods for making and using them
CN101875929A (en) * 2010-04-30 2010-11-03 大连理工大学 Strain for generating phospholipase D with high and stable yield by utilizing physical and chemical mutation
CN102277394A (en) * 2011-07-22 2011-12-14 天津科技大学 Method for preparing phosphatidylserine in presence of cell-surface display phospholipase D yeast whole cell catalyst
CN102286440A (en) * 2011-07-22 2011-12-21 天津科技大学 Preparation of high-activity phospholipids enzyme D and cell surface display phospholipids enzyme D yeast whole cell catalysts
CN104004797A (en) * 2014-06-20 2014-08-27 天津科技大学 Method for preparing phosphatidylserine with docosahexaenoic acid at sn-2 bit
CN104017786A (en) * 2014-06-20 2014-09-03 天津科技大学 Phospholipase A2 mutant and preparation method thereof

Family Cites Families (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
MA24811A1 (en) * 1997-10-23 1999-12-31 Procter & Gamble WASHING COMPOSITIONS CONTAINING MULTISUBSTITUTED PROTEASE VARIANTS
AU6410599A (en) * 1998-09-30 2000-04-17 Millennium Pharmaceuticals, Inc. Novel protein phosphatase molecules and uses therefor
RU2235775C2 (en) * 1998-11-27 2004-09-10 Новозимс А/С Method for preparing lipolytic enzyme variant and lipolytic enzyme (variants)
AU2003203139B2 (en) * 2002-01-16 2007-11-08 Novozymes A/S Lipolytic enzyme variants and method for their production
PT1497418E (en) * 2002-04-19 2013-01-25 Dsm Ip Assets Bv Phospholipases, nucleic acids encoding them and methods for making and using them
BRPI0410820B1 (en) * 2003-06-19 2016-04-26 Novozymes As use of at least one isolated polypeptide, method for producing a polypeptide, animal feed additive, and animal feed composition.
IL158139A0 (en) * 2003-09-25 2004-09-27 Enzymotec Ltd Stabilized formulations of phosphatidyl serine
WO2007044993A2 (en) * 2005-10-12 2007-04-19 Genencor International, Inc. Use and production of storage-stable neutral metalloprotease
JP5156951B2 (en) * 2006-02-02 2013-03-06 国立大学法人名古屋大学 New phospholipase D
CN101410513B (en) * 2006-03-10 2011-09-21 三菱化学食品株式会社 Novel phospholipase C
BRPI0922084B1 (en) * 2008-11-11 2020-12-29 Danisco Us Inc. subtilisin variant isolated from a bacillus subtilisin and its cleaning composition
WO2011010485A1 (en) * 2009-07-22 2011-01-27 石川県 Process for production of eicosanoid, eicosanoid biosynthesis gene derived from marchantia polymorpha, and use of the gene
WO2011088196A2 (en) * 2010-01-14 2011-07-21 Yale University Inhibitors of receptor tyrosine kinases (rtk) and methods of use thereof
PL2553090T3 (en) * 2010-03-26 2019-08-30 Novozymes A/S Thermostable phytase variants
EP2638135B1 (en) * 2010-11-12 2017-01-11 Novozymes A/S Polypeptides having phospholipase c activity and polynucleotides encoding same
EP2649053B1 (en) * 2010-12-06 2015-11-04 Glaxo Group Limited Pyrimidinone compounds for use in the treatment of diseases or conditions mediated by lp-pla2
US20140187468A1 (en) * 2011-08-31 2014-07-03 Danisco Us Inc. Compositions and Methods Comprising a Lipolytic Enzyme Variant
MY188956A (en) * 2011-12-27 2022-01-14 Commw Scient Ind Res Org Processes for producing lipids
US9518980B2 (en) * 2012-10-10 2016-12-13 Howard Hughes Medical Institute Genetically encoded calcium indicators
BR112015010620A2 (en) * 2012-11-08 2017-07-11 Pfizer heteroaromatic compounds and their uses as dopamine d1 binders
EA034757B1 (en) * 2012-12-10 2020-03-17 Байоджен Ма Инк. Anti-blood dendritic cell antigen 2 antibodies and uses thereof
CN106085984B (en) * 2016-06-02 2019-07-19 天津科技大学 A kind of novel phospholipase D and its method for preparing phosphatidic acid, phosphatidylserine

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101426918A (en) * 2004-03-08 2009-05-06 戴弗萨公司 Phospholipases, nucleic acids encoding them and methods for making and using them
CN101558154A (en) * 2006-09-21 2009-10-14 维莱尼姆公司 Phospholipases, nucleic acids encoding them and methods for making and using them
CN101875929A (en) * 2010-04-30 2010-11-03 大连理工大学 Strain for generating phospholipase D with high and stable yield by utilizing physical and chemical mutation
CN102277394A (en) * 2011-07-22 2011-12-14 天津科技大学 Method for preparing phosphatidylserine in presence of cell-surface display phospholipase D yeast whole cell catalyst
CN102286440A (en) * 2011-07-22 2011-12-21 天津科技大学 Preparation of high-activity phospholipids enzyme D and cell surface display phospholipids enzyme D yeast whole cell catalysts
CN104004797A (en) * 2014-06-20 2014-08-27 天津科技大学 Method for preparing phosphatidylserine with docosahexaenoic acid at sn-2 bit
CN104017786A (en) * 2014-06-20 2014-09-03 天津科技大学 Phospholipase A2 mutant and preparation method thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BAB72230.1;Genbank;《Genbank》;20050324;全文

Also Published As

Publication number Publication date
CN110283803B (en) 2021-08-03
CN110129300A (en) 2019-08-16
CN110218712A (en) 2019-09-10
CN110129299B (en) 2021-08-03
CN110283803A (en) 2019-09-27
CN110218712B (en) 2021-08-03
CN106085984A (en) 2016-11-09
CN110129299A (en) 2019-08-16
CN110129300B (en) 2021-08-03
CN110129298B (en) 2021-08-03
CN110129298A (en) 2019-08-16

Similar Documents

Publication Publication Date Title
CN106085984B (en) A kind of novel phospholipase D and its method for preparing phosphatidic acid, phosphatidylserine
CN103502266B (en) There is the filamentous fungi of viscosity-modifying phenotype
CN109576244B (en) Novel lipase, preparation and application thereof
US20220162543A1 (en) Pichia pastoris mutant strain for expressing exogenous gene
CN103502431B (en) There is the filamentous fungi of viscosity-modifying phenotype
Fekete et al. Identification of a permease gene involved in lactose utilisation in Aspergillus nidulans
CN110157654B (en) Bacillus natto recombinant strain and construction method and application thereof
CN101450964A (en) Genetic engineering antibiotic peptides as well as preparation method and application thereof
CN108795837A (en) A kind of bacillus subtilis engineering bacteria of high efficient expression phospholipase D
CN113201054B (en) Application of protein FoUPE1 in regulation and control of pathogenicity of banana vascular wilt
CN113528362A (en) Recombinant acid-tolerant yeast with inhibited glycerol production and method for producing lactic acid using the same
CN107353327A (en) Phytase is expressed in aspergillus niger
CN115161303B (en) Phospholipase mutant and method for synthesizing glycerophospholipids by using phospholipase mutant
CN106701800B (en) A kind of Aureobasidium pullulans polyketide synthases gene and its application
CN112010953B (en) Wheat powdery mildew resistance related protein Pm24, and coding gene and application thereof
CN101525580B (en) Amphiploid histidine auxotroph saccharomyces cerevisiae and constructing method thereof
EP1642977B1 (en) Gene involved in growth-promoting function of acetic acid bacteria and uses thereof
WO2003078635A1 (en) Gene participating in acetic acid tolerance, acetic acid bacterium bred using the gene, and process for producing vinegar with the use of the acetic acid bacterium
CN108587933A (en) Form induction type Yeast engineering bacteria and its construction method
CN113201055A (en) Protein POX01387 and related biological material and application thereof
KR101392968B1 (en) Novel autonomously replicating sequence and uses thereof
CN107475212A (en) Method, recombinant bacterium and its application of secreting, expressing glucose oxidase
WO2008081291A2 (en) Yeast, recombinant pig lactoferrin, expression vector of recombinant pig lactoferring gene, recombinant pig lactoferrin and production processes thereof.
JP2005046071A (en) Gene involved in acetic acid tolerance

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP02 Change in the address of a patent holder

Address after: No.9, 13th Street, economic and Technological Development Zone, Binhai New Area, Tianjin

Patentee after: Tianjin University of Science and Technology

Address before: 300222 No. 1038 South Dagu Road, Tianjin, Hexi District

Patentee before: Tianjin University of Science and Technology

CP02 Change in the address of a patent holder