CN112961871A - Recombinant plasmid, genetic engineering bacterium containing recombinant plasmid and application of recombinant plasmid in preparation of dimethyl carbonate - Google Patents

Abstract

The application relates to a recombinant plasmid, a genetic engineering bacterium containing the recombinant plasmid and application of the recombinant plasmid in preparation of dimethyl carbonate. The genetically engineered bacterium can express a mutant lipase mutant containing E83V, D92N or both, and has the characteristics of high conversion rate, high selectivity and high universality in catalyzing transesterification reaction of methanol and propylene carbonate or ethylene carbonate to prepare dimethyl carbonate.

Description

Recombinant plasmid, genetic engineering bacterium containing recombinant plasmid and application of recombinant plasmid in preparation of dimethyl carbonate

Technical Field

The invention belongs to the field of biochemical engineering, and particularly relates to a recombinant plasmid, a lipase mutant expressed by the recombinant plasmid and application of the recombinant plasmid in preparation of dimethyl carbonate.

Background

Dimethyl carbonate is DMC, and is a colorless transparent slightly odorous liquid at normal temperature, with melting point of 4 deg.C, boiling point of 90.1 deg.C, and density of 1.0699/cm³It is hardly soluble in water, but is miscible with all organic solvents such as alcohols, ethers, ketones, and the like. Dimethyl carbonate has excellent performance and wide application, and can be used for methylation, carbonylation and carbon-based methoxylation, and can also be used for preparing various derivatives such as high-performance resin, solvent, dye intermediate, medicament, perfume, lubricant additive and the like from DMC. Dimethyl carbonate has the characteristics of no toxicity and small influence on the environment, belongs to a novel green chemical raw material, is called as 'new base stone' organically synthesized in the 21 st century, and has rapidly developed in recent years.

Several existing DMC production processes have the following disadvantages: the phosgene method has serious pollution, and the use of the virulent substances does not meet the requirements of green chemical industry and is eliminated; the oxidative carbonylation method has harsh reaction conditions, large equipment investment, high process operation cost and potential explosion danger due to the introduction of CO; the single-pass conversion rate of the ester exchange method is low, the conversion rate of reactants is improved by large reflux ratio, the energy consumption is high, and in addition, the by-product dihydric alcohol is limited by market conditions, so that the economic benefit is influenced.

As a biocatalyst, enzyme has been widely used in the fields of food production and detection, environmental protection technology, biotechnology, biomedicine, etc. in recent years. Lipase (EC 3.1.1.3) which is the most widely researched and applied at present is a biocatalyst capable of catalyzing transesterification of grease and short-chain alcohol to generate fatty acid methyl ester, and the reaction mediated by the Lipase has the advantages of mild reaction conditions, small alcohol consumption, easy collection and purification of products, no pollutant discharge and the like. At present, lipase used for transesterification research at home and abroad is mainly Novozym435 produced by Novoxin, the lipase is resin immobilized enzyme, a carrier is macroporous acrylic resin, and the price is high, so that the lipase is not beneficial to industrial production of preparing chemical raw materials by an enzyme method. Although patents have reported that the lipase is used to catalyze the transesterification reaction of methanol and ethylene carbonate or methanol and propylene carbonate to prepare dimethyl carbonate, the reaction time is long and the enzyme activity needs to be improved.

Disclosure of Invention

The technical problem to be solved by the invention is to provide the genetically engineered bacterium capable of efficiently catalyzing and preparing the dimethyl carbonate, and the genetically engineered bacterium provided by the invention can express the mutant lipase, so that the efficiency of preparing the dimethyl carbonate is effectively improved, and the application prospect is wide.

In one aspect, the present invention provides a recombinant plasmid comprising a nucleotide sequence between the restriction sites EcoRI and HindIII for expression of a lipase mutant, wherein said sequence is selected from the group consisting of SEQ ID NO: 3. SEQ ID NO: 7 and SEQ ID NO: 9.

in another aspect, the present invention provides a method for preparing the above recombinant plasmid, the method comprising:

1) the gene sequence of PEL with the number of GenBank AF284064.1 is synthesized by whole gene and is connected on a plasmid pET-28a, the restriction enzyme cutting sites are EcoRI and HindIII, and the plasmid pET28a-PEL is obtained;

2) using plasmid pET28a-PEL as a template, high fidelity PCR amplification was performed with one of the following primer pairs:

primer pair 1:

83 Forward: 5 'GCTCTCATCACTCCTGTGCTCTCGGGCGTGACT 3' (SEQ ID NO: 1)

83 reverse 5' AGTCACGCCCGAGAGCACAGGAGTGATGAGAGC 3 (SEQ ID NO: 2);

and (3) primer pair 2:

92 Forward: 5 'ACTTTCCCCTCTAATGTGAAGATCATG 3' (SEQ ID NO: 5)

92 forward: 5 'CATGATCTTCACATTAGAGGGGAAAGT 3' (SEQ ID NO: 6);

3) verifying the size of the PCR product by agarose electrophoresis after PCR, recovering the PCR product by isopropanol precipitation, removing a template by DpnI enzyme digestion, extracting a recombinant plasmid containing E83V or D92N mutant enzyme genes after transforming escherichia coli,

or

The method comprises the following steps: after the above step 3), the steps 2) and 3) are repeated with a primer pair different from the primer pair used in the previous time, that is, if the primer pair 1 is used for the first PCR amplification, the steps 2) and 3) are repeated with the primer pair 2 after the above step 3), and if the primer pair 2 is used for the first PCR amplification, the steps 2) and 3) are repeated with the primer pair 1 after the above step 3), to obtain a recombinant plasmid containing the double mutant enzyme genes of E83V and D92N.

In a specific embodiment, the PCR conditions in step 2) are:

pre-denaturation at 98 ℃ for 5 min; denaturation at 98 ℃ for 10 s; annealing at 55 ℃ for 15 s; extension at 72 ℃ for 6min, 25 cycles, extension at 72 ℃ for 6 min.

In another aspect, the invention provides a genetically engineered bacterium for catalytic preparation of dimethyl carbonate, wherein the genetically engineered bacterium contains the recombinant plasmid.

In a specific embodiment, the genetically engineered bacterium is a plasmid which takes escherichia coli as an original strain and contains an expression lipase mutant,

wherein the lipase mutant has a mutation selected from any one or a combination of the following mutations relative to the lipase of Penicillium expansum PF 898: glutamic acid 83 was mutated to valine (E83V), and aspartic acid 92 was mutated to asparagine (D92N).

In a specific embodiment, the lipase mutant is a lipase mutant which is obtained by carrying out double mutation of E83V and D92N by taking an amino acid sequence (GenBank: AAG22769.1) of penicillium expansum lipase as a template, and has the amino acid sequence shown in SEQ ID NO: 10, or a fragment thereof.

In another aspect, the present invention provides a lipase mutant prepared by liquid fermentation using the above genetically engineered bacterium as a fermentation strain, and comprising a sequence selected from the group consisting of SEQ ID NO: 4. SEQ ID NO: 8 and SEQ ID NO: 10.

In still another aspect, the present invention provides a method for preparing dimethyl carbonate, comprising the step of producing lipase mutants by liquid fermentation using the genetically engineered bacteria to catalytically prepare dimethyl carbonate.

In a specific embodiment, the method comprises the steps of:

1) inoculating the seed liquid of the genetically engineered bacteria into a culture medium according to the inoculation amount of 1.6 percent of the volume of the culture medium, wherein the culture temperature is 37 ℃, the rotation speed of the culture medium is 220rpm, the pH value is 6.0-8.0, then adding an inducer IPTG (isopropyl-beta-thiogalactoside) to the final concentration of 0.2mmol/L, culturing for 7 hours at 30 ℃, and centrifuging for 5min at 8000rpm and 4 ℃ to collect thalli;

2) resuspending the thalli obtained in the step 1) by using an M9 culture medium to obtain a bacterial liquid; and

3) adding methanol and propylene carbonate into the bacterial liquid resuspended in the step 2) according to the molar ratio of 16:1, and reacting for 48 hours at 55 ℃.

Technical effects

Compared with the conditions of low conversion rate, low selectivity, complex process and environmental pollution existing in the prior preparation of the dimethyl carbonate, the invention uses the genetically engineered bacteria to catalyze the transesterification reaction of the methanol and the propylene carbonate or the ethylene carbonate to prepare the dimethyl carbonate, and has the following advantages: high conversion rate, high selectivity, high universality, simple process, mild reaction conditions, reduced cost, environmental friendliness and wide application prospect.

Drawings

FIG. 1 is a map of plasmid pET28a-PELE83V in example 1 of the present application.

FIG. 2 is a map of plasmid pET28a-PELD92N in example 3 of the present application.

FIG. 3 is a map of the plasmid pET28a-PELMUT in example 5 of the present application.

Detailed Description

The technical solutions of the present invention will be described clearly and completely with reference to specific embodiments, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1: site-directed mutagenesis of Lipase E83V

The lipase is derived from Penicillium expansum PF898, the amino acid sequence of the lipase is numbered GenBank: AAG22769.1, and the gene sequence PEL of the lipase is numbered GenBank: AF 284064.1. The gene is synthesized by a whole gene and is connected on a plasmid pET-28a, the restriction sites are EcoRI and HindIII, and the plasmid pET28a-PEL is obtained. The plasmid pET28a-PEL is used as a template, and the high fidelity amplification is carried out by the following primers, and the 83-site amino acid E is mutated into V, namely the A of the corresponding nucleic acid sequence 329 is mutated into T.

83 Forward: 5 'GCTCTCATCACTCCTGTGCTCTCGGGCGTGACT 3' (SEQ ID NO: 1)

83 reverse 5 'AGTCACGCCCGAGAGCACAGGAGTGATGAGAGC 3' (SEQ ID NO: 2)

Pre-denaturation at 98 ℃ for 5 min; denaturation at 98 ℃ for 10 s; annealing at 55 ℃ for 15 s; extension at 72 ℃ for 6min, 25 cycles, extension at 72 ℃ for 6 min. The size of the PCR product was verified by agarose electrophoresis. Recovering PCR products by isopropanol precipitation, carrying out enzyme digestion on DpnI (enzyme digestion at 37 ℃ for 1h) to remove a template, converting escherichia coli, extracting plasmids, sequencing, verifying that mutation is successful, and storing the plasmids pET28a-PELE83V, wherein a plasmid map is shown in figure 1, and a mutant enzyme gene sequence and an amino acid sequence thereof are respectively as follows: SEQ ID NO: 3 and SEQ ID NO: 4.

example 2: dimethyl carbonate catalyzed and synthesized by genetically engineered bacteria BL21(DE3)/pET28a-PELE83V

Plasmids pET28a-PEL and pET28a-PELE83V 2 muL are respectively taken and transferred into a competence BL21(DE3), the resistance of the used plate is Kan, and a control strain BL21(DE3)/pET28a-PEL containing wild-type lipase and a genetic engineering strain BL21(DE3)/pET28a-PELE83V containing mutant lipase (amino acid sequence: SEQ ID NO: 4) are obtained.

Single clones of the strains BL21(DE3)/pET28a-PEL, BL21(DE3)/pET28a-PELE83V were picked, placed in a 50mL shake flask containing 20mL (containing 50. mu.g/mL Kan) of liquid LB medium, placed in a shaker at 37 ℃ and 200rpm, and cultured overnight for activation. Inoculating the activated bacterial liquid into a shake flask with the inoculum size of 2:100, wherein the shake flask specification is 500mL, the liquid LB culture medium (containing 50 mu g/mL Kan) contains 300mL, placing the shake flask in a 37 ℃ shaking table, culturing at 200rpm, and when the OD of the cells is₆₀₀When the concentration reaches 0.6-0.8, IPTG with the final concentration of 200 mu mol/L is added for induction. After IPTG induction, the culture was continued at 30 ℃ and 180rpm, the cells were collected after 7 hours, centrifuged at 4 ℃ and 8000rpm for 5min, and then applied5-10mL M9 medium, resuspended separately and brought to the same OD₆₀₀。

Adding a substrate according to the molar ratio of methanol to propylene carbonate of 16:1, adding the resuspended bacterial liquid to make up to 5mL, and reacting at 55 ℃ for 48 h. The results show that the content of dimethyl carbonate produced by catalysis of BL21(DE3)/pET28a-PELE83V is 1.6 times that of strain BL21(DE3)/pET28 a-PEL.

Example 3: mutation of Lipase D92N

Plasmid PET28a-PEL is used as a template, high fidelity amplification is carried out by using the following primers, and the 92-site amino acid D is mutated into N, namely the G of the corresponding nucleic acid sequence 355 is mutated into A.

92 Forward: 5 'ACTTTCCCCTCTAATGTGAAGATCATG 3' (SEQ ID NO: 5)

92 reverse 5 'CATGATCTTCACATTAGAGGGGAAAGT 3' (SEQ ID NO: 6)

Pre-denaturation at 98 ℃ for 5 min; denaturation at 98 ℃ for 10 s; annealing at 55 ℃ for 15 s; extension at 72 ℃ for 6min, 25 cycles, extension at 72 ℃ for 6 min. The size of the PCR product was verified by agarose electrophoresis. Recovering PCR products by isopropanol precipitation, carrying out enzyme digestion on DpnI (enzyme digestion at 37 ℃ for 1h) to remove a template, converting escherichia coli, extracting plasmids, sequencing, verifying that mutation is successful, and storing the plasmids pET28a-PELD92N, wherein a plasmid map is shown in figure 2, and a mutant enzyme gene sequence and an amino acid sequence thereof are respectively as follows: SEQ ID NO: 7 and SEQ ID NO: 8.

example 4: dimethyl carbonate catalyzed and synthesized by genetically engineered bacteria BL21(DE3)/pET28a-PELD92N

Plasmids pET28a-PEL and pET28a-PELD92N 2 muL are respectively taken and transferred into a competence BL21(DE3), the resistance of the used plate is Kan, and a control strain BL21(DE3)/pET28a-PEL containing wild-type lipase and a genetic engineering strain BL21(DE3)/pET28a-PELD92N containing mutant lipase (amino acid sequence: SEQ ID NO: 8) are obtained.

Single clones of the strains BL21(DE3)/pET28a-PEL, BL21(DE3)/pET28a-PELD92N were picked, placed in a 50mL shake flask containing 20mL (containing 50. mu.g/mL Kan) of liquid LB medium, placed in a shaker at 37 ℃ and 200rpm, and cultured overnight for activation. Respectively mixing the activated bacterial liquid in a ratio of 2: inoculating 100 inoculum sizes into a shake flask with the specification of 500mL and containing 300mL of liquid LB culture mediumThe medium (containing 50. mu.g/mL Kan) was then incubated at 200rpm in a shaker at 37 ℃ until the cells OD₆₀₀When the concentration reaches 0.6-0.8, IPTG with the final concentration of 200 mu mol/L is added for induction. After IPTG induction, the culture is continued at 30 ℃ and 180rpm, the thalli are collected after 7h, centrifuged at 4 ℃ and 8000rpm for 5min, and then 5-10mL of M9 culture medium is used for respectively resuspending the sediment until the same OD is reached₆₀₀。

Adding a substrate according to the molar ratio of methanol to propylene carbonate of 16:1, adding the resuspended bacterial liquid to make up to 5mL, and reacting at 55 ℃ for 48 h. The results show that the content of dimethyl carbonate produced by catalysis of BL21(DE3)/pET28a-PELD92N is 1.9 times of that of strain BL21(DE3)/pET28 a-PEL.

Example 5: mutations in lipases E83V and D92N

Plasmid pET28a-PELE83V is used as a template, high fidelity amplification is carried out by the following primers, and amino acid D at position 92 is mutated into N, namely G of the corresponding nucleic acid sequence 355 is mutated into A.

92 Forward: 5 'ACTTTCCCCTCTAATGTGAAGATCATG 3' (SEQ ID NO: 5)

92 reverse 5 'CATGATCTTCACATTAGAGGGGAAAGT 3' (SEQ ID NO: 6)

Pre-denaturation at 98 ℃ for 5 min; denaturation at 98 ℃ for 10 s; annealing at 55 ℃ for 15 s; extension at 72 ℃ for 6min, 25 cycles, extension at 72 ℃ for 6 min. The size of the PCR product was verified by agarose electrophoresis. Recovering PCR product by isopropanol precipitation, performing enzyme digestion with DpnI (enzyme digestion at 37 ℃ for 1h) to remove a template, converting Escherichia coli, extracting plasmid, sequencing, and storing plasmid pET28a-PELMUT with plasmid map as shown in figure 3 after successful mutation verification, wherein the mutant enzyme gene sequence and amino acid sequence are respectively as follows: SEQ ID NO: 9 and SEQ ID NO: 10.

example 6: dimethyl carbonate catalyzed and synthesized by genetically engineered bacteria BL21(DE3)/pET28a-PELMUT

Plasmids pET28a-PEL and pET28a-PELMUT 2 muL are respectively taken and transferred into competent BL21(DE3), the resistance of the used plate is Kan, and a control strain BL21(DE3)/pET28a-PEL containing wild-type lipase and a gene engineering strain BL21(DE3)/pET28a-PELMUT containing mutant lipase (amino acid sequence: SEQ ID NO: 10) are obtained.

Strains BL21(DE3)/pET28a-PEL, BL21 (D) were pickedE3) A single clone of/pET 28a-PELMUT was placed in a 50mL shake flask containing 20mL (containing 50. mu.g/mL Kan) of liquid LB medium, and activated by overnight culture in a shaker at 37 ℃ and 200 rpm. Inoculating the activated bacterial liquid into a shake flask with the inoculum size of 2:100, wherein the shake flask specification is 500mL, the liquid LB culture medium (containing 50 mu g/mL Kan) contains 300mL, placing the shake flask in a 37 ℃ shaking table, culturing at 200rpm, and when the OD of the cells is₆₀₀When the concentration reaches 0.6-0.8, IPTG with the final concentration of 200 mu mol/L is added for induction. After IPTG induction, the culture is continued at 30 ℃ and 180rpm, the thalli are collected after 7h, centrifuged at 4 ℃ and 8000rpm for 5min, and then 5-10mL of M9 culture medium is used for respectively resuspending the sediment until the same OD is reached₆₀₀。

Adding the resuspended bacteria liquid according to the molar ratio of methanol to propylene carbonate of 16:1 to make up to 5mL, and reacting at 55 ℃ for 48 h. The results show that the content of dimethyl carbonate produced by catalysis of BL21(DE3)/pET28a-PELMUT is 2.9 times of that of strain BL21(DE3)/pET28 a-PEL.

In the process of preparing dimethyl carbonate by catalyzing methanol and ethylene carbonate or methanol and propylene carbonate to react by lipase, the method for analyzing the content of the dimethyl carbonate comprises the following steps: taking 50 mu L of reaction liquid for centrifugal layering, taking 10 mu L of upper layer liquid sample, dissolving with 290 mu L of cyclohexane, shaking up, and then adding 300 mu L of dodecane (2mg/ml) as an internal standard; a sample of 1. mu.L was sampled and the content of dimethyl carbonate in the reaction was determined by gas chromatography. The conversion rate was determined by using a model SP-6890 gas chromatograph from Shandong Lunan chemical plant, and the chromatographic column was SE-54. The specific test conditions were: the column chamber adopts programmed temperature rise: maintaining the temperature at 100 ℃ for 6 minutes, the heating rate at 40 ℃/minute, the temperature at 200 ℃ for 15 minutes, the temperature in a gasification chamber at 320 ℃, and the temperature in a detection chamber at 320 ℃.

The experimental results show that the genetically engineered bacteria obtained by the method can be used for efficiently producing dimethyl carbonate through catalysis. The mutant enzyme has improved catalytic efficiency compared with wild lipase mainly based on the following reasons: the E83V mutation means that the mutation from the polar amino acid with negative charge to the nonpolar amino acid without charge, because the valine is aliphatic nonpolar amino acid, which can help the protein form a more compact hydrophobic core, the protein packaging efficiency is higher, and more salt bridges can be provided for the protein, and the reasons are that the stability and the activity of the protein are improved. Similarly, D92N was mutated from a negatively charged polar amino acid to an uncharged polar amino acid.

The above description is only for the specific embodiments of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art can easily conceive of the changes or substitutions within the technical scope of the present invention, and all the changes or substitutions should be covered within the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.

The specific sequences mentioned above are as follows:

E83V mutant enzyme gene sequence (SEQ ID NO: 3, EcoRI and HindIII restriction sites before and after are italicized, bold is the base of the mutant amino acid)

Amino acid sequence of E83V mutant enzyme (SEQ ID NO: 4, bold and underlined mutant amino acids)

D92N mutant enzyme gene sequence (SEQ ID NO: 7, EcoRI and HindIII restriction sites before and after are italicized, bold is the base of the mutant amino acid)

Amino acid sequence of the D92N mutant enzyme (SEQ ID NO: 8, bold and underlined mutant amino acids)

Gene sequences of E83V and D92N double mutant enzymes (SEQ ID NO: 9, bold base of mutant amino acid)

Amino acid sequence of the E83V and D92N double mutant enzymes (SEQ ID NO: 10, bold and underlined mutant amino acids)

Sequence listing

<110> original Wai-Ke-Xin (Beijing) New Material science and technology Co., Ltd

<120> a recombinant plasmid, genetically engineered bacterium containing the same and application thereof in preparation of dimethyl carbonate

<130> DI20-2121-XC03

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Forward primer

<400> 1

gctctcatca ctcctgtgct ctcgggcgtg act 33

<210> 2

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> reverse primer

<400> 2

agtcacgccc gagagcacag gagtgatgag agc 33

<210> 3

<211> 789

<212> DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of E83V mutant enzyme

<400> 3

gaattcgcaa ctgccgacgc tgctgccttc cctgatctgc accgtgcagc aaagctctct 60

tccgctgcct acacaggttg catcggaaag gccttcgatg tcactatcgc caagaggatt 120

tatgacctcg tgaccgacac caatggattc gtcggatact ccaccgagaa gaagaccatc 180

gcggtcatca tgaggggctc gactaccatc accgacttcg tgaacgacat tgacattgct 240

ctcatcactc ctgtgctctc gggcgtgact ttcccctctg atgtgaagat catgagaggt 300

gttcacagac cttggtccgc tgtacacgac accatcatta ctgaagtcaa ggctctcatt 360

gcgaagtacc ctgattacac tctggaagca gtcggacatt ccctcggtgg tgccctcaca 420

tccattgccc acgttgccct ggcccagaac ttcccggaca agtcacttgt cagcaatgcc 480

cttaacgcct tccccatcgg caaccaagcg tgggccgact ttggtactgc gcaggccggt 540

accttcaacc gcggaaataa cgttcttgac ggtgtcccta acatgtactc gagcccgctt 600

gttaacttca agcactatgg aaccgaatac tacagctctg gtaccgaggc tagcaccgtg 660

aagtgcgaag gccagcgtga caagtcttgc tctgccggca atggcatgta cgctgtcact 720

cccggtcaca tcgccagctt tggcgtcgtg atgcttactg ctggttgtgg ctatctgagc 780

tgaaagctt 789

<210> 4

<211> 258

<212> PRT

<213> Artificial sequence

<220>

<223> amino acid sequence of E83V mutant enzyme

<400> 4

Ala Thr Ala Asp Ala Ala Ala Phe Pro Asp Leu His Arg Ala Ala Lys

1 5 10 15

Leu Ser Ser Ala Ala Tyr Thr Gly Cys Ile Gly Lys Ala Phe Asp Val

20 25 30

Thr Ile Ala Lys Arg Ile Tyr Asp Leu Val Thr Asp Thr Asn Gly Phe

35 40 45

Val Gly Tyr Ser Thr Glu Lys Lys Thr Ile Ala Val Ile Met Arg Gly

50 55 60

Ser Thr Thr Ile Thr Asp Phe Val Asn Asp Ile Asp Ile Ala Leu Ile

65 70 75 80

Thr Pro Val Leu Ser Gly Val Thr Phe Pro Ser Asp Val Lys Ile Met

85 90 95

Arg Gly Val His Arg Pro Trp Ser Ala Val His Asp Thr Ile Ile Thr

100 105 110

Glu Val Lys Ala Leu Ile Ala Lys Tyr Pro Asp Tyr Thr Leu Glu Ala

115 120 125

Val Gly His Ser Leu Gly Gly Ala Leu Thr Ser Ile Ala His Val Ala

130 135 140

Leu Ala Gln Asn Phe Pro Asp Lys Ser Leu Val Ser Asn Ala Leu Asn

145 150 155 160

Ala Phe Pro Ile Gly Asn Gln Ala Trp Ala Asp Phe Gly Thr Ala Gln

165 170 175

Ala Gly Thr Phe Asn Arg Gly Asn Asn Val Leu Asp Gly Val Pro Asn

180 185 190

Met Tyr Ser Ser Pro Leu Val Asn Phe Lys His Tyr Gly Thr Glu Tyr

195 200 205

Tyr Ser Ser Gly Thr Glu Ala Ser Thr Val Lys Cys Glu Gly Gln Arg

210 215 220

Asp Lys Ser Cys Ser Ala Gly Asn Gly Met Tyr Ala Val Thr Pro Gly

225 230 235 240

His Ile Ala Ser Phe Gly Val Val Met Leu Thr Ala Gly Cys Gly Tyr

245 250 255

Leu Ser

<210> 5

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Forward primer

<400> 5

actttcccct ctaatgtgaa gatcatg 27

<210> 6

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> reverse primer

<400> 6

catgatcttc acattagagg ggaaagt 27

<210> 7

<211> 789

<212> DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of D92N mutant enzyme

<400> 7

gaattcgcaa ctgccgacgc tgctgccttc cctgatctgc accgtgcagc aaagctctct 60

tccgctgcct acacaggttg catcggaaag gccttcgatg tcactatcgc caagaggatt 120

tatgacctcg tgaccgacac caatggattc gtcggatact ccaccgagaa gaagaccatc 180

gcggtcatca tgaggggctc gactaccatc accgacttcg tgaacgacat tgacattgct 240

ctcatcactc ctgagctctc gggcgtgact ttcccctcta atgtgaagat catgagaggt 300

gttcacagac cttggtccgc tgtacacgac accatcatta ctgaagtcaa ggctctcatt 360

gcgaagtacc ctgattacac tctggaagca gtcggacatt ccctcggtgg tgccctcaca 420

tccattgccc acgttgccct ggcccagaac ttcccggaca agtcacttgt cagcaatgcc 480

cttaacgcct tccccatcgg caaccaagcg tgggccgact ttggtactgc gcaggccggt 540

accttcaacc gcggaaataa cgttcttgac ggtgtcccta acatgtactc gagcccgctt 600

gttaacttca agcactatgg aaccgaatac tacagctctg gtaccgaggc tagcaccgtg 660

aagtgcgaag gccagcgtga caagtcttgc tctgccggca atggcatgta cgctgtcact 720

cccggtcaca tcgccagctt tggcgtcgtg atgcttactg ctggttgtgg ctatctgagc 780

tgaaagctt 789

<210> 8

<211> 258

<212> PRT

<213> Artificial sequence

<220>

<223> amino acid sequence of D92N mutant enzyme

<400> 8

Ala Thr Ala Asp Ala Ala Ala Phe Pro Asp Leu His Arg Ala Ala Lys

1 5 10 15

Leu Ser Ser Ala Ala Tyr Thr Gly Cys Ile Gly Lys Ala Phe Asp Val

20 25 30

Thr Ile Ala Lys Arg Ile Tyr Asp Leu Val Thr Asp Thr Asn Gly Phe

35 40 45

Val Gly Tyr Ser Thr Glu Lys Lys Thr Ile Ala Val Ile Met Arg Gly

50 55 60

Ser Thr Thr Ile Thr Asp Phe Val Asn Asp Ile Asp Ile Ala Leu Ile

65 70 75 80

Thr Pro Glu Leu Ser Gly Val Thr Phe Pro Ser Asn Val Lys Ile Met

85 90 95

Arg Gly Val His Arg Pro Trp Ser Ala Val His Asp Thr Ile Ile Thr

100 105 110

Glu Val Lys Ala Leu Ile Ala Lys Tyr Pro Asp Tyr Thr Leu Glu Ala

115 120 125

Val Gly His Ser Leu Gly Gly Ala Leu Thr Ser Ile Ala His Val Ala

130 135 140

Leu Ala Gln Asn Phe Pro Asp Lys Ser Leu Val Ser Asn Ala Leu Asn

145 150 155 160

Ala Phe Pro Ile Gly Asn Gln Ala Trp Ala Asp Phe Gly Thr Ala Gln

165 170 175

Ala Gly Thr Phe Asn Arg Gly Asn Asn Val Leu Asp Gly Val Pro Asn

180 185 190

Met Tyr Ser Ser Pro Leu Val Asn Phe Lys His Tyr Gly Thr Glu Tyr

195 200 205

Tyr Ser Ser Gly Thr Glu Ala Ser Thr Val Lys Cys Glu Gly Gln Arg

210 215 220

Asp Lys Ser Cys Ser Ala Gly Asn Gly Met Tyr Ala Val Thr Pro Gly

225 230 235 240

His Ile Ala Ser Phe Gly Val Val Met Leu Thr Ala Gly Cys Gly Tyr

245 250 255

Leu Ser

<210> 9

<211> 789

<212> DNA

<213> Artificial sequence

<220>

<223> nucleotide sequences of E83V and D92N mutant enzymes

<400> 9

gaattcgcaa ctgccgacgc tgctgccttc cctgatctgc accgtgcagc aaagctctct 60

tccgctgcct acacaggttg catcggaaag gccttcgatg tcactatcgc caagaggatt 120

tatgacctcg tgaccgacac caatggattc gtcggatact ccaccgagaa gaagaccatc 180

gcggtcatca tgaggggctc gactaccatc accgacttcg tgaacgacat tgacattgct 240

ctcatcactc ctgtgctctc gggcgtgact ttcccctcta atgtgaagat catgagaggt 300

gttcacagac cttggtccgc tgtacacgac accatcatta ctgaagtcaa ggctctcatt 360

gcgaagtacc ctgattacac tctggaagca gtcggacatt ccctcggtgg tgccctcaca 420

tccattgccc acgttgccct ggcccagaac ttcccggaca agtcacttgt cagcaatgcc 480

cttaacgcct tccccatcgg caaccaagcg tgggccgact ttggtactgc gcaggccggt 540

accttcaacc gcggaaataa cgttcttgac ggtgtcccta acatgtactc gagcccgctt 600

gttaacttca agcactatgg aaccgaatac tacagctctg gtaccgaggc tagcaccgtg 660

aagtgcgaag gccagcgtga caagtcttgc tctgccggca atggcatgta cgctgtcact 720

cccggtcaca tcgccagctt tggcgtcgtg atgcttactg ctggttgtgg ctatctgagc 780

tgaaagctt 789

<210> 10

<211> 258

<212> PRT

<213> Artificial sequence

<220>

<223> amino acid sequences of E83V and D92N mutant enzymes

<400> 10

Ala Thr Ala Asp Ala Ala Ala Phe Pro Asp Leu His Arg Ala Ala Lys

1 5 10 15

Leu Ser Ser Ala Ala Tyr Thr Gly Cys Ile Gly Lys Ala Phe Asp Val

20 25 30

Thr Ile Ala Lys Arg Ile Tyr Asp Leu Val Thr Asp Thr Asn Gly Phe

35 40 45

Val Gly Tyr Ser Thr Glu Lys Lys Thr Ile Ala Val Ile Met Arg Gly

50 55 60

Ser Thr Thr Ile Thr Asp Phe Val Asn Asp Ile Asp Ile Ala Leu Ile

65 70 75 80

Thr Pro Val Leu Ser Gly Val Thr Phe Pro Ser Asn Val Lys Ile Met

85 90 95

Arg Gly Val His Arg Pro Trp Ser Ala Val His Asp Thr Ile Ile Thr

100 105 110

Glu Val Lys Ala Leu Ile Ala Lys Tyr Pro Asp Tyr Thr Leu Glu Ala

115 120 125

Val Gly His Ser Leu Gly Gly Ala Leu Thr Ser Ile Ala His Val Ala

130 135 140

Leu Ala Gln Asn Phe Pro Asp Lys Ser Leu Val Ser Asn Ala Leu Asn

145 150 155 160

Ala Phe Pro Ile Gly Asn Gln Ala Trp Ala Asp Phe Gly Thr Ala Gln

165 170 175

Ala Gly Thr Phe Asn Arg Gly Asn Asn Val Leu Asp Gly Val Pro Asn

180 185 190

Met Tyr Ser Ser Pro Leu Val Asn Phe Lys His Tyr Gly Thr Glu Tyr

195 200 205

Tyr Ser Ser Gly Thr Glu Ala Ser Thr Val Lys Cys Glu Gly Gln Arg

210 215 220

Asp Lys Ser Cys Ser Ala Gly Asn Gly Met Tyr Ala Val Thr Pro Gly

225 230 235 240

His Ile Ala Ser Phe Gly Val Val Met Leu Thr Ala Gly Cys Gly Tyr

245 250 255

Leu Ser

Claims (9)

1. A recombinant plasmid comprising a nucleotide sequence for expression of a lipase mutant between the restriction sites EcoRI and HindIII, wherein said sequence is selected from the group consisting of SEQ ID NO: 3. SEQ ID NO: 7 and SEQ ID NO: 9.

2. a method of making the recombinant plasmid of claim 1, the method comprising:

1) the gene sequence of PEL with the number of GenBank AF284064.1 is synthesized by whole gene and is connected on a plasmid pET-28a, the restriction enzyme cutting sites are EcoRI and HindIII, and the plasmid pET28a-PEL is obtained;

2) using plasmid pET28a-PEL as a template, high fidelity PCR amplification was performed with one of the following primer pairs:

primer pair 1:

forward 5 'GCTCTCATCACTCCTGTGCTCTCGGGCGTGACT 3' (SEQ ID NO: 1) reverse 5 'AGTCACGCCCGAGAGCACAGGAGTGATGAGAGC 3' (SEQ ID NO: 2);

and (3) primer pair 2:

forward 5 'ACTTTCCCCTCTAATGTGAAGATCATG 3' (SEQ ID NO: 5) reverse 5 'CATGATCTTCACATTAGAGGGGAAAGT 3' (SEQ ID NO: 6);

3) verifying the size of the PCR product by agarose electrophoresis after PCR, recovering the PCR product by isopropanol precipitation, removing a template by DpnI enzyme digestion, extracting a recombinant plasmid containing E83V or D92N mutant enzyme genes after transforming escherichia coli,

or

The method comprises the following steps: after the above step 3), the steps 2) and 3) were further repeated with a primer pair different from the primer pair used at the previous time to obtain a recombinant plasmid containing the E83V and D92N double mutant enzyme genes.

3. The method of claim 2, wherein the PCR conditions in step 2) are: pre-denaturation at 98 ℃ for 5 min; denaturation at 98 ℃ for 10 s; annealing at 55 ℃ for 15 s; extension at 72 ℃ for 6min, 25 cycles, extension at 72 ℃ for 6 min.

4. A genetically engineered bacterium for the production of dimethyl carbonate, said genetically engineered bacterium comprising the recombinant plasmid of claim 1.

5. The genetically engineered bacterium of claim 4, wherein the genetically engineered bacterium is a plasmid which takes Escherichia coli as an original strain and contains an expression lipase mutant,

wherein the lipase mutant has a mutation selected from any one or a combination of the following mutations relative to the lipase of Penicillium expansum PF 898: glutamic acid 83 was mutated to valine (E83V), and aspartic acid 92 was mutated to asparagine (D92N).

6. A lipase mutant comprising a sequence selected from the group consisting of SEQ ID NOs: 4. SEQ ID NO: 8 and SEQ ID NO: 10.

7. A method for preparing dimethyl carbonate, which comprises the step of producing a lipase mutant by liquid fermentation using the genetically engineered bacterium of claim 4 to catalytically prepare dimethyl carbonate.

8. The method according to claim 7, wherein the method comprises the steps of:

1) inoculating the seed liquid of the genetic engineering bacteria to a culture medium according to the inoculation amount of 1.6 percent of the volume of the culture medium, then adding an inducer IPTG (isopropyl-beta-thiogalactoside) to the final concentration of 0.2mmol/L, and collecting thalli after culturing;

2) resuspending the thalli obtained in the step 1) by using an M9 culture medium to obtain a bacterial liquid; and

3) adding substrate methanol and propylene carbonate/ethylene carbonate into the bacterial liquid re-suspended in the step 2) for reaction.

9. The process of claim 8, wherein in step 3) the substrates methanol and propylene carbonate/ethylene carbonate are added in a molar ratio of 16: 1.

Images