CN103820521B

CN103820521B - Living things catalysis Dynamic Kinetic Resolution prepares the method for R-o-chloromandelic acid methyl ester

Info

Publication number: CN103820521B
Application number: CN201310624324.8A
Authority: CN
Inventors: 于洪巍; 顾佳黎; 胡建波
Original assignee: Zhejiang University ZJU; Wenzhou University
Current assignee: Zhejiang University ZJU; Wenzhou University
Priority date: 2013-11-27
Filing date: 2013-11-27
Publication date: 2016-12-07
Anticipated expiration: 2033-11-27
Also published as: CN103820521A

Abstract

The present invention relates to bioengineering field, disclose a kind of method that living things catalysis Dynamic Kinetic Resolution prepares R o-chloromandelic acid methyl ester, under conditions of pH7 8, combination restructuring racemase and Recombinant esterase or combination can express restructuring racemase and the genetic engineering bacterium of Recombinant esterase respectively, convert with raceme o-chloromandelic acid methyl ester for substrate, wherein, restructuring racemase is restructuring mandelate racemase, and Recombinant esterase is restructuring BioH esterase.It is an advantage of the current invention that by combination restructuring racemase and Recombinant esterase or the genetic engineering bacterium containing above-mentioned enzyme, reach to prepare purpose, simple process, transformation efficiency is high, and overcomes the unstable problem that double enzyme system is brought, and has preferable using value.

Description

Method for preparing R-o-chloromandelic acid methyl ester by biocatalysis dynamic kinetic resolution

Technical Field

The invention relates to a bioengineering technology for preparing R-methyl o-chloromandelate, in particular to a method for preparing R-methyl o-chloromandelate by biocatalysis dynamic kinetic resolution.

Background

Clopidogrel (Clopidogrel) with the chemical name S-alpha- (2-chlorophenyl) -6, 7-dichlorothieno [3,2-c ] pyridine-5 (4H) -acetic acid methyl ester, a platelet aggregation inhibitor, has been studied and developed successfully in 1986 by Senofura-Anthrate France, and the sulfate thereof is clinically used with the name of Plavix (Boravil) and is mainly used for treating cardiovascular and cerebrovascular diseases such as atherosclerosis. In 2009 this drug was sold worldwide for $ 100 billion, second only to the hypolipidemic drug atorvastatin, known as the second best-selling drug of the global drug market. The R-methyl o-chloromandelate is an important chiral substance for synthesizing clopidogrel, and the method for synthesizing clopidogrel through sulfonation and nucleophilic substitution has high reaction yield and basically no racemization of the product. Therefore, the research on the chiral synthesis of R-o-chloromandelic acid methyl ester has wide application prospect.

So far, the synthetic route of R-o-chloromandelic acid methyl ester mainly comprises the following steps:

(1): starting from racemic o-chloromandelic acid esterified substance, an enzymatic hydrolysis resolution method is adopted to obtain o-chloromandelic acid methyl ester with a single configuration. The prior art has reported that the commercial enzyme CALA can hydrolyze and separate methyl o-chloromandelate in an aqueous phase, but the enantioselectivity of CALA is poor, and the ee value of a substrate is 99% only after the substrate is almost completely converted. Lee et al report the preparation of optically pure R-methyl o-chloromandelate (ee) by CALA non-aqueous resolution of methyl o-chloromandelate_s>99%), yield 41%, E ═ 34.7. The theoretical yield of the method is only 50%, and resource waste and environmental pollution are caused to a certain extent.

(2) Nitrilase catalyzes the hydrolysis reaction of o-chloromandelonitrile, Xu et al uses nitrilase from Labrenzia aggregatate as a catalyst to hydrolyze and obtain R-o-chloromandelonitrile, and the ee value reaches 96.5%. Meanwhile, S-o-chloromandelonitrile can spontaneously form a racemate, and R-o-chloromandelonitrile is continuously hydrolyzed by nitrilase, so that the theoretical yield reaches 100%, but the use of virulent hydrocyanic acid increases the reaction risk.

(3) The method comprises the steps of catalyzing o-chlorobenzaldehyde and hydrocyanic acid by cyanohydrin oxidase to asymmetrically synthesize R-o-chloromandelic acid, and performing acid hydrolysis to generate the R-o-chloromandelic acid. For example, van Langen et al, synthesized R-o-chloromandelonitrile with a yield of 98% and an ee value of 90% using a commercial cyanohydrin enzyme. After cross-linking immobilization of the oxynitrilase by Glieder et al, the enzyme catalyst can be reused for more than 10 batches. Although the method has high yield and good enzyme enantiomer selectivity, the use of the same virulent hydrocyanic acid increases the operation difficulty.

(4) The method can realize 100% yield theoretically by directly and asymmetrically reducing o-chlorobenzoyl methyl formate to obtain R-o-chloromandelic acid methyl ester. However, since the reductase catalyzes the asymmetric reduction reaction and usually needs to be carried out in the presence of coenzyme, it is possible to solve the coenzyme regeneration problem by coexpression of the reductase and the coenzyme-regenerating enzyme. The wet thalli or freeze-dried enzyme powder of genetically engineered bacteria co-expressing recombinant reductase and glucose dehydrogenase is used as a catalyst, R-methyl o-chloromandelate can be prepared without adding coenzyme, but the catalytic effect is only about 50% of that of the case of adding 1mmol/L coenzyme without adding coenzyme, and the instability of a double-enzyme system also increases the industrialization difficulty.

Disclosure of Invention

Aiming at the defect that the prior art cannot achieve ideal yield under the condition of lacking coenzyme by a method for obtaining R-o-chloromandelic acid methyl ester by reducing o-chlorobenzoyl methyl formate, the invention provides a method for preparing R-o-chloromandelic acid methyl ester without coenzyme.

In order to achieve the purpose, the invention can adopt the following technical scheme:

a method for preparing R-methyl o-chloromandelate by biocatalytic dynamic kinetic resolution comprises the steps of combining recombinant racemase and recombinant esterase or combining genetic engineering bacteria capable of expressing the recombinant racemase and the recombinant esterase respectively under the condition of pH7-8, and converting by using racemic o-chloromandelate methyl ester as a substrate, wherein the recombinant racemase is recombinant mandelate racemase, and the recombinant esterase is recombinant BioH esterase. Alternatively, the transformation may be carried out in the presence of a recombinant racemase and a recombinant esterase in combination or in the presence of a genetically engineered bacterium containing the recombinant racemase and the recombinant esterase in combination.

Alternatively, the recombinant mandelic acid racemase described in the above technical scheme is derived from Pseudomonas putida (Pseudomonas putida), and the amino acid sequence of the recombinant mandelic acid racemase is represented by SEQ ID NO:1 in the sequence Listing, or a new variant amino acid sequence may be obtained by modifying (the modification may include insertion, deletion, or substitution) at least one amino acid in the amino acid sequence represented by SEQ ID NO:1 in the sequence Listing, while maintaining the catalytic activity of the racemase.

Alternatively, the recombinant BioH esterase used in the above technical scheme is derived from Escherichia coli (Escherichia coli), and the amino acid sequence of the recombinant BioH esterase is represented by SEQ ID NO:2 in the sequence table, or a new variant amino acid sequence obtained by modifying (the modification may include insertion, deletion or substitution) at least one amino acid in the amino acid sequence represented by SEQ ID NO:2 in the sequence table, provided that the catalytic activity of the esterase is maintained.

Preferably, the concentration of the racemic methyl o-chloromandelate is 10 to 50 mmol/L.

Preferably, the conversion reaction is carried out in a Tris-HCl buffer solution, and further, the concentration of the Tris-HCl buffer solution is preferably 50 to 100 mmol/L.

Alternatively, the above conversion reaction is carried out under mild conditions of 20 to 40 ℃. Preferably, the reaction temperature of the conversion reaction is 20-30 ℃, the reaction time is controlled to be 3-4 hours, and after the reaction is finished, the R-methyl o-chloromandelate can be extracted from the reaction solution.

Alternatively, if the enzyme solution obtained by culturing the genetically engineered bacteria is used as it is, the amount of the mandelic acid racemase enzyme solution added is 0.1 to 1ml and the amount of the BioH esterase enzyme solution added is 0.1 to 2ml per 10ml of the reaction system, the enzyme solution may include the enzyme obtained by separation and the enzyme-containing cells. Further preferably, the ratio of the recombinant racemase to the recombinant esterase is 1:1-4, preferably 1:2, and if a genetically engineered bacterium capable of expressing the recombinant racemase and the recombinant esterase respectively is used, the ratio of the recombinant racemase to the recombinant esterase is 1:1-4, preferably 1: 2.

A recombinant vector comprising a base sequence encoding a mandelic acid racemase or comprising a base sequence encoding a BioH esterase; wherein,

the base sequence of the mandelic acid racemase is a base sequence of an amino acid sequence shown as SEQ ID NO. 1 in a coding sequence table;

the base sequence of the BioH esterase is a base sequence of an amino acid sequence shown as SEQ ID NO. 2 in a coding sequence table.

Alternatively, the recombinant vector may be any vector conventionally used in the art, such as a commercially available plasmid, cosmid, phage, etc., and is preferably plasmid pET30 a.

Optionally, amino acids at positions 22-26 of the amino acid sequence shown as SEQ ID NO. 1 in the sequence list are replaced to obtain a replaced amino acid sequence, and the amino sequence coding for mandelic acid racemase is a base sequence coding for the replaced amino acid sequence; the amino acid sequence of the 125 th-channel 209 th amino acid of the amino acid sequence shown as SEQ ID NO. 2 in the sequence table is replaced to obtain the replaced amino acid sequence, and the base sequence coding the BioH esterase is the base sequence coding the replaced amino acid sequence. Preferably, Val at position 26 of the amino acid sequence shown as SEQ ID NO. 1 in the sequence table is replaced by Ile or Leu, or Val at position 22 is replaced by Ile or Leu; preferably, Leu at position 125 of the amino acid sequence shown as SEQ ID NO. 2 in the sequence Listing is replaced by Ala or Val, or Leu at position 183 is replaced by Ala or Val, or Leu at position 209 is replaced by Val or Phe. The target recombinant mandelic acid racemase and the recombinant BioH esterase can be obtained by the replacement. The base corresponding to the amino acid at the specific position on the base sequence encoding the recombinant mandelic acid racemase may be subjected to point mutation using a mutation technique to obtain a mutated base sequence encoding the recombinant mandelic acid racemase, or the base corresponding to the amino acid at the specific position on the base sequence encoding the recombinant BioH esterase may be subjected to point mutation to obtain a mutated base sequence encoding the recombinant BioH esterase.

The genetically engineered bacterium comprises the recombinant vector.

Preferably, the genetically engineered bacterium may be any microorganism conventionally used in the art, as long as it is sufficient to efficiently express the recombinant mandelic acid racemase and the recombinant BioH esterase of the present invention, and may alternatively be escherichia coli, preferably recombinant escherichia coli (e.coli) BL21(DE 3). A recombinant vector containing the nucleotide sequence encoding the recombinant mandelic acid racemase or the recombinant BioH esterase may be introduced into the genetically engineered bacterium as a host cell by a conventional method.

The genetic engineering bacteria are applied to the preparation of R-o-chloromandelic acid methyl ester by biocatalysis dynamic kinetic resolution.

A method for culturing the above genetically engineered bacteria, comprising inoculating the genetically engineered bacteria of claim 8 into LB medium containing kanamycin, and culturing the bacteria when the optical density OD of the culture solution is₆₀₀When the concentration reaches 0.5-0.7 (preferably 0.6), adding isopropyl- β -D-thiogalactopyranoside (IPTG) with the concentration of 0.1-1mmol/L (preferably 0.5mmol/L), continuously inducing for 4-5 hours, centrifuging the fermentation liquor to obtain the wet thallus of the genetic engineering bacteria, wherein the concentration of kanamycin is 10-200 mug/ml, preferably 50 mug/ml, and further, crushing or partially crushing the wet thallus by various conventional crushing methods in the field, such as high pressure homogenization, bead milling, freeze-thaw method and the like, preferably ultrasonic crushing, so as to prepare the enzyme solution for preparing the recombinant mandelic acid racemase or the recombinant BioH esterase.

The starting materials or reagents used in the above procedures are all commercially available except as specifically described.

Due to the adoption of the technical scheme, the invention has the remarkable technical effects that:

compared with the prior art, the technical scheme has high catalytic efficiency and strong stereoselectivity, completely eliminates the addition of coenzyme, and can still maintain higher catalytic efficiency under the condition of not adding the coenzyme. And secondly, the problem of instability caused by the existing double-enzyme system is solved, the combined recombinant racemase and recombinant esterase are respectively expressed by different engineering bacteria, the preparation is simpler and more convenient, and the industrial popularization and application are facilitated. Finally, the technical scheme has the advantages of low generation cost, mild reaction conditions, high product yield and optical purity, environment-friendly reaction and simple and convenient operation, and is particularly suitable for industrial application.

Drawings

FIG. 1 is a schematic diagram of a target band of a mandelate racemase gene recovered by an agarose gel DNA recovery kit.

FIG. 2 is a schematic diagram showing a target band of a BioH enzyme gene recovered by an agarose gel DNA recovery kit.

FIG. 3 is a liquid chromatography spectrum of the product R-o-chloromandelic acid methyl ester.

FIG. 4 is a liquid chromatography spectrum of racemic o-chloromandelic acid as an intermediate product.

FIG. 5 is a schematic diagram of the reaction flow of preparing R-chloromandelic acid methyl ester by dynamic catalytic kinetic resolution.

Detailed Description

The present invention will be described in further detail with reference to examples. The experimental procedures, in which specific conditions are not noted in the examples below, are generally carried out under conventional conditions, or under conditions recommended by the manufacturer.

EXAMPLE 1 cloning of the mandelate racemase Gene

According to the mandelic acid racemase gene sequence (mdla) of Pseudomonas putida in NCBI, upstream and downstream amplification primers and enzyme cutting sites EcoR I/Xho I (the italic part is the enzyme cutting site and corresponding protection base) are designed. Primers were designed as follows:

primer 1: GGAATTC ATGAGTGAAGTACTGATTACCG

Primer 2: CCGCTCGAG TTTACACCAGATATTTCCCGATTT

PCR amplification was performed using genomic DNA of Pseudomonas putida (ATCC12633, available from American Standard culture Collection) as a template, and the PCR system was 10 × DNA polymerase buffer 5. mu.L and MgCl₂4. mu.L (25mmol/L), 1. mu.L dNTPs (10mmol/L), 1. mu.L primer 1 (10. mu. mol/L), 1. mu.L primer 2 (10. mu. mol/L), genomic template: about 10ng, 0.5. mu.L of Taq DNA polymerase (5U/. mu.L), plus ddH₂O (i.e., redistilled water) to a total volume of 50. mu.l.

The PCR amplification step is as follows: (1) pre-denaturing at 95 ℃ for 3min, (2) denaturing at 95 ℃ for 45s, (3) annealing at 56 ℃ for 90s, and (4) extending at 72 ℃ for 70 s; repeating the steps (2) to (4) 35 times, continuing the extension at 72 ℃ for 10min, and cooling to 4 ℃. And (3) carrying out agarose gel electrophoresis purification on the PCR product of the obtained amplicon of each mandelic acid racemase gene by PCR, and recovering a target band of about 1100bp (as shown in figure 1) by using an agarose gel DNA recovery kit to obtain the mandelic acid racemase gene.

Example 2 preparation of recombinant plasmid pET30a-MR

The target band of the mandelate racemase gene recovered in example 1 was digested with restriction enzymes EcoRI/Xho I at 37 ℃ for 12h, purified by agarose gel electrophoresis, and recovered using an agarose gel DNA recovery kit. The target fragment was ligated with the EcoRI/Xho I-digested plasmid pET30a by T4DNA ligase overnight at 4 ℃ to give recombinant plasmid pET30 a-MR.

Example 3 construction of recombinant MR mutants

Site-directed mutagenesis was performed at 22 or 26 sites using the recombinant MR obtained in example 2 as a template by the QuickChange method, and the PCR amplification step was: (1) pre-denaturing at 98 ℃ for 1min, (2) denaturing at 98 ℃ for 30s, (3) annealing at 56 ℃ for 90s, and (4) extending at 72 ℃ for 7 min; repeating the steps (2) - (4) for 20 times, continuing to extend at 72 ℃ for 5min, and cooling to 4 ℃. And (3) cleaning the obtained PCR product, carrying out enzyme digestion by Dpn I, removing a methylated template, then re-transforming into E.coli BL21(DE3) competent cells, transforming and coating on an LB plate containing kanamycin, carrying out inverted culture at 37 ℃ overnight, and picking out monoclonal sequencing for verification to obtain the recombinant MR mutant strain.

Example 4 cloning of esterase BioH Gene

According to esterase of Escherichia coli K-12(Escherichia coli K-12) in NCBI, upstream and downstream amplification primers and enzyme cutting sites Kpn I/Hind III (the italic part is the enzyme cutting sites and corresponding protection bases) are designed. Primers were designed as follows:

primer 1: GGGGTACCAGGATGAATAACATCTGGTG

Primer 2: CCCAAGCTTCACCTACACCCTCTGCTTC

PCR amplification was performed using genomic DNA of Escherichia coli K-12 (ATCC 29425, available from American Standard culture Collection) as a template, and the PCR system was 10 × DNA polymerase buffer 5. mu.L, MgCl₂4. mu.L (25mmol/L), 1. mu.L dNTPs (10mmol/L), 1. mu.L primer 1 (50. mu. mol/L), 1. mu.L primer 2 (50. mu. mol/L), genomic template: about 10pmol, polymerase (5U/. mu.L) 0.5. mu.L, plus ddH₂O to a total volume of 50. mu.l.

The PCR amplification step is as follows: (1) pre-denaturation at 95 ℃ for 3min, (2) denaturation at 95 ℃ for 45s, (3) annealing at 56 ℃ for 90s, and (4) extension at 72 ℃ for 70 s; repeating the steps (2) to (4) 35 times, continuing the extension at 72 ℃ for 10min, and cooling to 4 ℃. The PCR product was purified by agarose gel electrophoresis, and a target band of about 750bp (shown in FIG. 2), i.e., the BioH esterase gene, was recovered using an agarose gel DNA recovery kit.

Example 5 preparation of recombinant plasmid pET30a-BioH

The BioH esterase gene target band recovered in example 1 was digested simultaneously with restriction enzymes Kpn I/Hind III at 37 ℃ for 12 hours, purified by agarose gel electrophoresis, and the target band was recovered using an agarose gel DNA recovery kit. The target fragment was ligated with plasmid pET30a, which was also cleaved with Kpn I/Hind III by a Kpn I/Hind III double-restriction enzyme by T4DNA ligase overnight at 4 ℃ to give recombinant plasmid pET30 a-BioH.

Example 6 construction of recombinant BioH mutant strains

Site-directed mutagenesis was performed at position 123, 181 or 207 using the recombinant BioH obtained in example 2 as a template and the QuickChange method, and PCR amplification steps were: (1) pre-denaturing at 98 ℃ for 1min, (2) denaturing at 98 ℃ for 30s, (3) annealing at 56 ℃ for 90s, and (4) extending at 72 ℃ for 7 min; repeating the steps (2) to (4) for 20 times, (5) continuing to extend for 5min at 72 ℃, cooling to 4 ℃ to obtain a PCR product, cleaning, carrying out enzyme digestion by Dpn I, removing a methylated template, then retransforming to E.coli BL21(DE3) competent cells, transforming and coating the competent cells on an LB plate containing kanamycin, carrying out inverted culture at 37 ℃ overnight, and selecting a monoclonal for sequencing verification to obtain the recombinant BioH mutant strain.

Example 7 preparation of recombinant fungal enzyme solution

The recombinant MR mutant strain obtained in example 3 or the recombinant BioH mutant strain obtained in example 6 was inoculated into LB medium containing kanamycin, shaken overnight at 37 ℃ and inoculated into a medium containing 100ml of LB (peptone 10g/L, yeast powder 5g/L, N) at an inoculum size of 2% (V/V)aCl 10g/L, pH adjusted to 7.2), shaking overnight at 200rpm in a 500ml Erlenmeyer flask at 37 ℃ when OD of the culture solution is₆₀₀When the concentration reaches 0.6, IPTG with final concentration of 0.5mmol/L is added as inducer, after inducing at 37 deg.C and 200rpm for 4-5h, the culture solution is centrifuged, cells are collected, and PBS (NaCl 8g/L, KCl 0.2g/L, Na) is added₂HPO₄·12H₂O 3.63g/L，KH₂PO₄0.24g/L, pH 7.4), and ultrasonically crushing to obtain recombinant mandelic acid racemase enzyme solution and recombinant BioH esterase enzyme solution. Through determination, after the cells are completely broken, the concentration of the racemase enzyme in the enzyme solution can reach 1.6-3.5mg/ml, and the concentration of the esterase BioH enzyme can reach 0.6-2 mg/ml.

Example 8 preparation of R-methyl O-chloromandelate by catalysis of O-chloromandelate with recombinant mandelic acid racemase and recombinant BioH esterase enzyme solutions

The reaction scheme is shown in fig. 5, and specifically comprises the following steps: (1) 0.1 to 1ml of the mandelic acid racemase enzyme solution obtained in example 7 and 0.1 to 2ml of the BioH esterase enzyme solution obtained in example 7 (the amount of enzyme used is gradually and uniformly decreased to 0 as the reaction proceeds, but the ratio of the amount of the racemase enzyme solution to the amount of the esterase enzyme solution is 1:1 to 1:4, preferably 1: 2) are added to 10ml of Tris-HCl buffer solution with pH of 7.0 to 8.0, the initial concentration of the substrate racemic o-chloromandelic acid methyl ester is 10 to 50mmol/L, and the reaction is carried out at 20 to 40 ℃ for 3 to 4 hours under 200rpm shaking. (2) After the reaction, ethyl acetate is used for extraction, extraction is carried out twice, the extract liquor is combined, the ethyl acetate is removed through reduced pressure distillation, and then R-o-chloromandelic acid methyl ester is obtained, and the result of liquid chromatography is shown in figure 3, wherein the peak value is R-o-chloromandelic acid methyl ester. (2) The extracted lower aqueous phase (containing racemic o-chloromandelic acid, the peak of which is racemic o-chloromandelic acid, as shown in fig. 4) was chemically re-esterified to produce methyl o-chloromandelate. (3) After repeating the steps (1) to (2) for 5 to 10 times, the yield of the R-o-chloromandelic acid methyl ester can reach 92 percent.

In order to be able to fully characterize the effect of the various reactants of this example on the final yield of methyl R-o-chloromandelate, this example was repeated using different experimental conditions, the results of which are shown in Table 1 below:

table 1: preparation of R-O-chloromandelic acid methyl ester according to example 6

In summary, the above-mentioned embodiments are only preferred embodiments of the present invention, and all equivalent changes and modifications made in the claims of the present invention should be covered by the claims of the present invention.

Claims

1. A method for preparing R-methyl o-chloromandelate by biocatalytic dynamic kinetic resolution is characterized in that under the condition of pH7-8, racemic o-chloromandelate methyl ester is used as a substrate for conversion by combining recombinant racemase and recombinant esterase or combining genetic engineering bacteria capable of respectively expressing the recombinant racemase and the recombinant esterase, wherein the recombinant racemase is recombinant mandelate racemase, and the recombinant esterase is recombinant BioH esterase; the base sequence of the mandelic acid racemase is a base sequence obtained by substituting amino acid at a specific site of an amino acid sequence shown as SEQID NO. 1 in a coding sequence table; the replacement is to replace Val at position 26 of an amino acid sequence shown as SEQ ID NO. 1 in a sequence table with Ile or Leu, or replace Val at position 22 with Ile or Leu;

the base sequence of the coding BioH esterase is a base sequence obtained by substituting amino acid at a specific site of an amino acid sequence shown as SEQ ID NO. 2 in a coding sequence table; the replacement is as follows: the Leu at position 125 of the amino acid sequence shown as SEQ ID NO. 2 in the sequence table is replaced by Ala or Val, or the Leu at position 183 is replaced by Ala or Val, or the Leu at position 209 is replaced by Val or Phe.

2. The method of claim 1, wherein the concentration of racemic methyl o-chloromandelate is 10 to 50 mmol/L.

3. The method of claim 1, wherein the conversion reaction is carried out in a Tris-HCl buffer solution.

4. A recombinant vector comprising a base sequence encoding mandelic acid racemase or a base sequence encoding BioH esterase; wherein,

the base sequence of the coded mandelic acid racemase is shown as SEQ ID NO 1 in a coding sequence table

The base sequence of the amino acid sequence after the amino acid substitution of the specific site of the amino acid sequence; the replacement is as follows: replacing Val at position 26 of an amino acid sequence shown as SEQ ID NO. 1 in a sequence table with Ile or Leu, or replacing Val at position 22 with Ile or Leu;

the base sequence of the coding BioH esterase is a base sequence obtained by substituting amino acid at a specific site of an amino acid sequence shown as SEQ ID NO. 2 in a coding sequence table; the replacement is as follows:

the Leu at position 125 of the amino acid sequence shown as SEQ ID NO. 2 in the sequence table is replaced by Ala or Val, or the Leu at position 183 is replaced by Ala or Val, or the Leu at position 209 is replaced by Val or Phe.

5. The recombinant vector according to claim 4, wherein the recombinant vector is plasmid pET30 a.

6. A genetically engineered bacterium comprising the recombinant vector according to any one of claims 4 to 5.

7. The genetically engineered bacterium of claim 6, wherein the genetically engineered bacterium is Escherichia coli.

8. The use of the genetically engineered bacteria of any one of claims 6 to 7 in the preparation of R-chloromandelic acid methyl ester by biocatalytic dynamic kinetic resolution.

9. A method for culturing the genetically engineered bacterium according to claim 7, wherein the genetically engineered bacterium according to claim 7 is inoculated into LB medium containing kanamycin and cultured, and the optical density OD of the culture solution is obtained₆₀₀When the concentration reaches 0.5-0.7, adding 0.1-1mmol/L isopropyl- β -D-thiogalactopyranoside, and continuing to induce for 4-5 hours.