CN103820521A - Method for preparing R-o-chloromandelic acid methyl ester through biocatalysis dynamic kinetic resolution - Google Patents

Abstract

The invention relates to the field of bioengineering, and discloses a method for preparing R-o-chloromandelic acid methyl ester by biocatalytic dynamic kinetic resolution. Under the condition of pH 7-8, recombinant racemase and recombinant esterase or combined Use genetically engineered bacteria that can express recombinant racemase and recombinant esterase respectively, and transform racemic o-chloromandelic acid methyl ester as a substrate, wherein the recombinant racemase is recombinant mandelic acid racemase, and the recombinant esterase is Recombinant BioH esterase. The present invention has the advantages of achieving the purpose of preparation through the joint use of recombinant racemase and recombinant esterase or genetically engineered bacteria containing the above-mentioned enzymes. problem and has good application value.

Description

Method for preparing R-o-chloromandelic acid methyl ester by biocatalytic dynamic kinetic resolution

technical field

The invention relates to a bioengineering technology for preparing R-o-chloromandelic acid methyl ester, in particular to a method for preparing R-o-chloromandelic acid methyl ester through biocatalytic dynamic kinetic resolution.

Background technique

Clopidogrel (Clopidogrel), chemical name S-α-(2-chlorophenyl)-6,7-dichlorothieno[3,2-c]pyridine-5(4H)-acetic acid methyl ester, a platelet The coagulation inhibitor was successfully researched and developed by the French company Sanofi-Aventis in 1986. Its sulfate salt, trade name Plavix (Plavix), is mainly used for the treatment of cardiovascular and cerebrovascular diseases such as atherosclerosis. In 2009, the global sales of this drug reached 10 billion US dollars, second only to the blood lipid-lowering drug atorvastatin, and it is called the second best-selling drug in the global drug market. R-methyl o-chloromandelate is an important chiral substance for the synthesis of clopidogrel. The method for synthesizing clopidogrel through sulfonate esterification and nucleophilic substitution has a high reaction yield and basically no racemization of the product. Therefore, research on the chiral synthesis of R-o-chloromandelic acid methyl ester has broad application prospects.

So far, the synthetic route of R-methyl o-chloromandelate mainly includes the following:

(1): Starting from the racemic o-chloromandelic acid ester, the enzymatic hydrolysis resolution method was used to obtain a single configuration of o-chloromandelic acid methyl ester. It has been reported in the prior art that the commercial enzyme CALA can hydrolyze and resolve methyl o-chloromandelate in aqueous phase, but the enantioselectivity of CALA is poor, and only after the substrate is almost completely converted, the ee value of the substrate is 99% . Lee et al. reported that CALA non-aqueous phase resolved methyl o-chloromandelate to prepare optically pure R-methyl o-chloromandelate (ee _s >99%), the product yield was 41%, E=34.7. The theoretical yield of this type of method is only 50%, which causes resource waste and environmental pollution to a certain extent.

(2) Nitrilase catalyzed the hydrolysis reaction of o-chloromandelonitrile. Xu et al. used nitrilase from Labrenziaaggregate as a catalyst to hydrolyze R-o-chloromandelonitrile, with an ee value of 96.5%. Simultaneously, S-o-chloromandelonitrile can spontaneously form a racemate, and continue to be hydrolyzed by nitrilase to produce R-o-chloromandelonitrile, thereby making the theoretical yield reach 100%, but the use of highly toxic hydrocyanic acid increases Response to risk.

(3) Use cyanohydrinase to catalyze the asymmetric synthesis of R-o-chloromandelonitrile from o-chlorobenzaldehyde and hydrocyanic acid, and then generate R-o-chloromandelic acid through acid hydrolysis. For example, van Langen et al. used commercial cyanohydrinase to synthesize R-o-chloromandelonitrile, with a yield of 98% and an ee value of 90%. After Glieder et al. cross-linked and immobilized the cyanohydrinase, the enzyme catalyst could be reused for more than 10 batches. Although the method has high yield and good enantioselectivity of the enzyme, the use of highly toxic hydrocyanic acid also increases the difficulty of operation.

(4) Direct asymmetric reduction of methyl o-chlorobenzoylformate to obtain R-methyl o-chloromandelate. This method can theoretically achieve 100% yield. However, since the asymmetric reduction reaction catalyzed by reductase usually needs to be carried out in the presence of coenzyme, the co-expression of reductase and coenzyme regeneration enzyme can solve the problem of coenzyme regeneration. With the genetically engineered bacterial wet cell or freeze-dried enzyme powder co-expressing recombinant reductase and glucose dehydrogenase as a catalyst, R-o-chloromandelic acid methyl ester can be prepared without adding coenzyme, but the catalytic effect without adding coenzyme It is only about 50% of that when 1mmol/L coenzyme is added, and the instability of the dual-enzyme system also increases the difficulty of industrialization.

Contents of the invention

The present invention aims at the shortcoming that the method for obtaining R-o-chloromandelic acid methyl ester by reducing methyl o-chlorobenzoylformate in the prior art cannot achieve the ideal yield in the absence of coenzyme, and provides a method without coenzyme The method for preparing R-o-chloromandelic acid methyl ester can be realized.

To achieve the above object, the present invention can take the following technical solutions:

Biocatalytic dynamic kinetic resolution method for preparing R-o-chloromandelate methyl ester, under the condition of pH 7-8, combined use of recombinant racemase and recombinant esterase or combined use can express recombinant racemase and recombinant ester respectively The genetically engineered bacterium of the enzyme transforms racemic o-chloromandelic acid methyl ester as a substrate, wherein the recombinant racemase is recombinant mandelic acid racemase, and the recombinant esterase is recombinant BioH esterase. Optionally, the above-mentioned transformation can also be used in the co-existence of the combined recombinant racemase and recombinant esterase or the genetically engineered bacteria containing the above-mentioned combined recombinant racemase and recombinant esterase.

Optionally, the recombinant mandelic acid racemase described in the above-mentioned technical scheme is derived from Pseudomonas putida (Pseudomonasputida), and the amino acid sequence of the recombinant mandelic acid racemase is as shown in SEQ ID NO: 1 in the sequence listing, or, It can also be obtained by changing (the change can include insertion, deletion or substitution) at least one amino acid in the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing under the premise of maintaining the catalytic activity of the racemase New variant amino acid sequences.

Optionally, the recombinant BioH esterase used in the above-mentioned technical scheme is derived from Escherichia coli (Escherichiacoli), and the amino acid sequence of the recombinant BioH esterase is shown in SEQ ID NO: 2 in the sequence listing, or it can also be maintained in the esterase Under the premise of catalytic activity, a new variant amino acid sequence obtained by changing (the change may include insertion, deletion or substitution) at least one amino acid in the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing.

Preferably, the concentration of the racemic methyl o-chloromandelate is 10-50 mmol/L.

Preferably, the conversion reaction is carried out in a Tris-HCl buffer solution, and further, the concentration of the Tris-HCl buffer solution is preferably 50-100 mmol/L.

Alternatively, the above transformation reactions are performed under mild conditions of 20-40°C. Preferably, the reaction temperature of the conversion reaction is 20-30° C., and the reaction time is preferably controlled within 3-4 hours. After the reaction is completed, R-methyl o-chloromandelate can be extracted from the reaction solution.

Alternatively, if the enzyme solution obtained by cultivating the genetically engineered bacteria is used directly, the amount of the mandelate racemase enzyme solution added in every 10ml reaction system is 0.1-1ml, and the amount of the BioH esterase enzyme solution added is The amount is 0.1-2ml, and the above-mentioned enzyme solution may include the isolated enzyme and enzyme-containing bacterium. A further preferred value is that the addition ratio of the recombinant racemase and the recombinant esterase in combination is 1:1-4, preferably 1:2, if the combination can express the genetic engineering of the recombinant racemase and the recombinant esterase respectively Bacteria, the addition ratio is 1:1-4, preferably 1:2.

A recombinant vector containing a base sequence encoding mandelate racemase or a base sequence encoding BioH esterase; wherein,

The base sequence of described encoding mandelic acid racemase is the base sequence of encoding such as the aminoacid sequence shown in SEQ ID NO:1 in the sequence listing;

The base sequence encoding BioH esterase is the base sequence encoding the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing.

Optionally, the recombinant vector can be various conventional vectors in the art, such as commercially available plasmids, cosmids, phages, etc., preferably plasmid pET30a.

Optionally, the 22nd-26th amino acid sequence of the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing is replaced to obtain the amino acid sequence after replacement, and the amino sequence encoding mandelate racemase is encoded after replacement The base sequence of the amino acid sequence; the 123-207th amino acid sequence of the amino acid sequence shown in SEQ ID NO: 2 in the sequence table is replaced to obtain the replaced amino acid sequence, and the base sequence of the encoding BioH esterase is Base sequence encoding the substituted amino acid sequence. Preferably, the 26th Val of the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing is replaced with Ile or Leu, or the 22nd Val is replaced with Ile or Leu; preferably, as in the sequence listing The 123rd Leu of the amino acid sequence shown in SEQ ID NO:2 is replaced with Ala or Val, or the 181st Leu is replaced with Ala or Val, or the 207th Leu is replaced with Val or Phe. All of the above substitutions can obtain the target recombinant mandelate racemase and recombinant BioH esterase. Mutation techniques can be used to perform point mutations on the base sequence encoding recombinant mandelic acid racemase corresponding to the amino acid at the above specific position, so as to obtain the mutated base that can encode recombinant mandelic acid racemase sequence, or point-mutate the base corresponding to the amino acid at the above-mentioned specific position on the base sequence encoding recombinant BioH esterase, so as to obtain a mutated base sequence that can encode recombinant BioH esterase.

The genetically engineered bacterium comprises the above-mentioned recombinant vector.

As a preference, the genetically engineered bacteria can be various conventional microorganisms in the art, as long as they can effectively express the recombinant mandelic acid racemase and recombinant BioH esterase of the present invention, optionally, Escherichia coli, preferably For the recombinant Escherichia coli (E.coli) BL21 (DE3). Existing methods can be used to introduce the above-mentioned recombinant vector containing the base sequence encoding recombinant mandelate racemase or encoding recombinant BioH esterase into the above-mentioned genetically engineered bacteria as host cells.

Application of the above-mentioned genetically engineered bacteria in biocatalytic dynamic kinetic resolution to prepare R-o-chloromandelic acid methyl ester.

The method for cultivating the above-mentioned genetically engineered bacteria comprises inoculating the genetically engineered bacteria according to claim 8 into the LB medium of kanamycin for cultivation, when the optical density OD of the culture solution reaches _0.5-0.7 ( Preferably 0.6), after adding isopropyl-β-D-thiogalactopyranoside (IPTG) at a concentration of 0.1-1mmol/L (preferably 0.5mmol/L), continue to induce for 4-5 hours, and After the fermentation liquid is centrifuged, the wet thallus of the above-mentioned genetically engineered bacteria can be obtained. Wherein, the concentration of kanamycin is 10-200 μg/ml, preferably 50 μg/ml. Further, the above-mentioned wet bacteria can be broken or partially broken by various conventional breaking methods in the art, such as high-pressure homogenization, bead milling, freeze-thawing, etc., preferably ultrasonic breaking, to prepare recombinant mandelic acid disinfectant. Enzyme solution of gyrase or recombinant BioH esterase.

The raw materials or reagents used in the above process are commercially available unless otherwise specified.

The present invention has remarkable technical effect owing to adopted above technical scheme:

Compared with the prior art, the above technical solution has high catalytic efficiency and strong stereoselectivity, completely eliminates the addition of coenzyme, and can still maintain high catalytic efficiency without adding coenzyme. Secondly, it overcomes the instability problem caused by the existing dual-enzyme system, and the combined recombinant racemase and recombinant esterase are respectively expressed by different engineering bacteria, making the preparation easier and more conducive to industrialization. Promote apps. Finally, the above technical solution has low production cost, mild reaction conditions, high product yield and optical purity, environmentally friendly reaction, easy operation, and is especially suitable for industrial applications.

Description of drawings

Figure 1 is a schematic diagram of the mandelate racemase gene target band recovered by using the agarose gel DNA recovery kit.

Fig. 2 is a schematic diagram of the BioH enzyme gene target band recovered by using the agarose gel DNA recovery kit.

Fig. 3 is the liquid phase chromatogram of product R-o-chloromandelate methyl ester.

Figure 4 is a liquid chromatogram of the intermediate product racemic o-chloromandelic acid.

Fig. 5 is a schematic diagram of the reaction process for the preparation of R-o-chloromandelic acid methyl ester by biocatalytic dynamic kinetic resolution.

Detailed ways

The present invention will be further described in detail below in conjunction with the examples. For the experimental methods without specific conditions indicated in the following examples, the conventional conditions or the conditions suggested by the manufacturer are usually followed.

Embodiment 1, to the cloning of mandelate racemase gene

According to the mandelic acid racemase gene sequence (mdla) of Pseudomonas putida in NCBI, the upstream and downstream amplification primers and enzyme cutting sites EcoR I/Xho I were designed (the parts in italics are the enzyme cutting sites and corresponding protection base). Primers were designed as follows:

Primer 1: GGAATTC ATGAGTGAAGTACTGATTACCG

Primer 2: CCGCTCGAGTTTACACCAGATATTTCCCGATTT

PCR amplification was performed using the genomic DNA of Pseudomonas putida (ATCC12633, purchased from the American Type Culture Collection) as a template. The PCR system is 5 μL of 10×DNA polymerase buffer, 4 μL of MgCl ₂ (25mmol/L), 1 μL of dNTPs (10mmol/L), 1 μL of primer 1 (10 μmol/L), 1 μL of primer 2 (10 μmol/L), genome template: about 10ng, Taq DNA polymerase (5U/μL) 0.5μL, add ddH ₂ O (ie redistilled water) to a total volume of 50μl.

The PCR amplification steps are: (1) pre-denaturation at 95°C for 3 minutes, (2) denaturation at 95°C for 45s, (3) annealing at 56°C for 90s, (4) extension at 72°C for 70s; 2)-(4) repeat 35 times, (5) extend at 72°C for 10 minutes, and cool to 4°C. The amplicons of each mandelic acid racemase gene obtained by PCR were purified by agarose gel electrophoresis, and the target band of about 1100 bp was recovered by using an agarose gel DNA recovery kit (as shown in Figure 1). The mandelate racemase gene was obtained.

Embodiment 2, preparation of recombinant plasmid pET30a-MR

The mandelate racemase gene target band recovered in Example 1 was double-digested with restriction endonuclease EcoR I/Xho I at 37°C for 12 hours, purified by agarose gel electrophoresis, and purified by agarose gel DNA The recovery kit recovers the target band. Under the action of T4 DNA ligase, the target fragment was ligated with the plasmid pET30a that had also been digested with EcoR I/Xho I at 4°C overnight to obtain the recombinant plasmid pET30a-MR.

Embodiment 3, the construction of recombinant MR mutant strain

Using the recombinant MR obtained in Example 2 as a template, use the QuickChange method to perform site-directed mutagenesis at the 22 or 26 position. The PCR amplification steps are: (1) pre-denaturation at 98°C for 1 min, (2) at 98°C Under the condition of ℃, denature for 30s, (3) anneal at 56℃ for 90s, (4) extend at 72℃ for 7min; repeat steps (2)-(4) 20 times, (5) extend at 72℃ for 5min, cool to 4℃. The obtained PCR product was cleaned and digested with Dpn I to eliminate the methylated template, then retransformed into E.coli BL21 (DE3) competent cells, and spread onto LB plates containing kanamycin. Cultured upside down at 37°C overnight, single clones were picked and sequenced for verification, and recombinant MR mutants were obtained.

Embodiment 4, to the cloning of esterase BioH gene

According to the esterase of E. coli K-12 (Escherichia coli K-12) in NCBI, design upstream and downstream amplification primers and restriction sites Kpn I/Hind III (the parts in italics are restriction sites and corresponding protected bases) . Primers were designed as follows:

Primer 1: GGGGTACCAGGATGAATAACATCTGGTG

Primer 2: CCCAAGCTTCACCTACACCCCTCTGCTTC

PCR amplification was performed using the genomic DNA of Escherichia coli K-12 (Escherichia coli K-12) (ATCC29425, purchased from the American Type Culture Collection) as a template. PCR system: 10×DNA polymerase buffer 5μL, MgCl ₂ (25mmol/L) 4μL, dNTPs (10mmol/L) 1μL, primer 1 (50μmol/L) 1μL, primer 2 (50μmol/L) 1μ, genome template: about 10pmol, polymerase (5U/μL) 0.5 μL, add ddH ₂ O to a total volume of 50 μl.

PCR amplification steps are: (1) 95°C, pre-denaturation for 3 minutes, (2) 95°C, denaturation for 45s, (3) 56°C annealing for 90s, (4) 72°C extension for 70s; steps (2)-(4) repeat 35 times, (5) Continue extending at 72°C for 10 minutes, and cool to 4°C. The PCR product was purified by agarose gel electrophoresis, and the target band of about 750 bp was recovered with the agarose gel DNA recovery kit (as shown in Figure 2), namely the BioH esterase gene.

Embodiment 5, preparation of recombinant plasmid pET30a-BioH

The BioH esterase gene target band recovered in Example 1 was double-digested with restriction endonuclease KpnI/Hind III at 37°C for 12 hours, purified by agarose gel electrophoresis, and the target was recovered using an agarose gel DNA recovery kit Bands. Under the action of T4 DNA ligase, the target fragment was ligated with the plasmid pET30a that had also been digested with KpnI/Hind III at 4°C overnight to obtain the recombinant plasmid pET30a-BioH.

Embodiment 6, the construction of recombinant BioH mutant strain

Using the recombinant BioH obtained in Example 2 as a template, use the QuickChange method to perform site-directed mutagenesis at positions 123, 181 or 207. The PCR amplification steps are: (1) pre-denature at 98°C for 1 min, (2) Denaturation at 98°C for 30 seconds, (3) annealing at 56°C for 90 seconds, (4) extension at 72°C for 7 minutes; steps (2)-(4) repeated 20 times, (5) extension at 72°C for 5 minutes, and cooling to 4°C , that is, the PCR product was obtained for cleaning, and digested with Dpn I to eliminate the methylated template, and then re-transformed into E.coli BL21 (DE3) competent cells, and the transformation was spread on the LB plate containing kanamycin, Cultured upside down at 37°C overnight, single clones were picked and sequenced for verification, and recombinant BioH mutants were obtained.

Embodiment 7, the preparation of recombinant bacterial enzyme liquid

Inoculate the recombinant MR mutant strain obtained in Example 3 or the recombinant BioH mutant strain obtained in Example 6 into LB medium containing kanamycin, shake overnight at 37°C, and inoculum at 2% (V/V) Insert 100ml of LB medium (peptone 10g/L, yeast powder 5g/L, NaCl10g/L, adjust the pH to 7.2) into a 500ml Erlenmeyer flask, and shake it overnight at 37°C and 200rpm. When the culture medium When the OD ₆₀₀ reached 0.6, IPTG with a final concentration of 0.5mmol/L was added as an inducer, and after induction at 37°C and 200rpm for 4-5h, the culture medium was centrifuged to collect the cells, and washed with PBS (NaCl8g/L, KCl0. 2g/L, Na ₂ HPO ₄ 12H ₂ O 3.63g/L, KH ₂ PO ₄ 0.24g/L, pH 7.4) wash the cells twice, and ultrasonically disrupt the recombinant mandelic acid racemase enzyme solution and recombinant BioH Esterase Enzyme Solution. It is determined that after the cells are completely broken, the concentration of racemase in the enzyme solution can reach 1.6-3.5mg/ml, and the concentration of esterase BioH can reach 0.6-2mg/ml.

Example 8, Recombinant Mandelic Acid Racemase and Recombinant BioH Esterase Enzyme Liquid Catalyzed O-Chloromandelic Acid Methyl Ester to Prepare R-O-Chloromandelic Acid Methyl Ester

The reaction process is shown in Figure 5, specifically: (1) Take 0.1-1ml of the mandelate racemase enzyme solution obtained in Example 7, and simultaneously take 0.1-2ml of the BioH esterase enzyme solution obtained in Example 7 (As the reaction progresses, the amount of enzyme used is uniformly reduced successively until it is 0, but the ratio of the amount of racemase enzyme liquid to the amount of esterase enzyme liquid is 1:1-1:4, preferably, in a ratio of 1:2 Preferably), add to 10ml Tris-Hcl buffer solution with pH 7.0-8.0, the initial concentration of the substrate racemic o-chloromandelic acid methyl ester is 10-50mmol/L, and react at 20-40°C with 200rpm shaking for 3 -4h. (2) Extract with ethyl acetate after the completion of the reaction, extract twice, combine the extracts, and distill under reduced pressure to remove ethyl acetate to obtain R-methyl o-chloromandelic acid. The results of liquid chromatography are as shown in Figure 3. The peak is R-o-chloromandelic acid methyl ester. (2) The extracted lower aqueous phase (containing racemic o-chloromandelic acid, the results of liquid chromatography are shown in Figure 4, and the peak is racemic o-chloromandelic acid) is re-esterified by chemical method This produces methyl o-chloromandelate. (3) After repeating the above steps (1)-(2) for 5-10 times, the yield of R-o-chloromandelic acid methyl ester can be as high as 92%.

In order to fully characterize the impact of the various reactants of the present embodiment on the yield of the final R-o-chloromandelic acid methyl ester, the present embodiment was repeated using different experimental conditions, and the results obtained are shown in Table 1 below:

Table 1: Preparation of R-methyl o-chloromandelate according to Example 6

In a word, the above descriptions are only preferred embodiments of the present invention, and all equivalent changes and modifications made according to the scope of the patent application of the present invention shall fall within the scope of the patent of the present invention.

Claims (10)

1. A method for preparing R-methyl o-chloromandelate by biocatalytic dynamic kinetic resolution is characterized in that under the condition of pH7-8, racemic methyl o-chloromandelate is used as a substrate for conversion by combining recombinant racemase and recombinant esterase or combining genetic engineering bacteria capable of respectively expressing the recombinant racemase and the recombinant esterase, wherein the recombinant racemase is recombinant mandelate racemase, and the recombinant esterase is recombinant BioH esterase.

2. The method of claim 1, wherein the concentration of racemic methyl o-chloromandelate is 10 to 50 mmol/L.

3. The method of claim 1, wherein the conversion reaction is carried out in a Tris-HCl buffer solution.

4. A recombinant vector comprising a base sequence encoding mandelic acid racemase or a base sequence encoding BioH esterase; wherein,

the base sequence of the mandelic acid racemase is a base sequence of an amino acid sequence shown as SEQ ID NO. 1 in a coding sequence table;

the base sequence of the BioH esterase is a base sequence of an amino acid sequence shown as SEQ ID NO. 2 in a coding sequence table.

5. The recombinant vector according to claim 4, wherein the recombinant vector is plasmid pET30 a.

6. The recombinant vector according to claim 4, wherein the amino acid at position 22-26 of the amino acid sequence shown as SEQ ID NO. 1 in the sequence Listing is substituted to obtain a substituted amino acid sequence, and the amino acid sequence encoding mandelic acid racemase is a base sequence encoding the substituted amino acid sequence; the 123-.

7. A genetically engineered bacterium comprising the recombinant vector according to any one of claims 4 to 6.

8. The genetically engineered bacterium of claim 7, wherein the genetically engineered bacterium is Escherichia coli.

9. The use of the genetically engineered bacteria of any one of claims 7 to 8 in the preparation of R-chloromandelic acid methyl ester by biocatalytic dynamic kinetic resolution.

10. A method for culturing the genetically engineered bacterium according to claim 8, wherein the genetically engineered bacterium according to claim 8 is inoculated into LB medium containing kanamycin and cultured, and the optical density OD of the culture solution is obtained₆₀₀When the concentration reaches 0.5-0.7, adding isopropyl-beta-D-thiogalactopyranoside with the concentration of 0.1-1mmol/L, and then continuing to induce for 4-5 hours.

Images