CN112226451A

CN112226451A - Bacillus subtilis expression system and method for producing alpha-L-AFs by using same

Info

Publication number: CN112226451A
Application number: CN202011143233.9A
Authority: CN
Inventors: 孙俊松; 纪明华; 段海燕; 刘云辉; 史吉平
Original assignee: Shanghai Advanced Research Institute of CAS
Current assignee: Shanghai Advanced Research Institute of CAS
Priority date: 2020-10-23
Filing date: 2020-10-23
Publication date: 2021-01-15

Abstract

The invention discloses a bacillus subtilis expression system and a method for producing alpha-L-AFs by using the same. The Bacillus subtilis expression system was established by inserting the xylose-induced T7RNA polymerase expression system at the aprE site of the Bacillus subtilis genome. The method for producing the alpha-L-arabinofuranosidase by using the bacillus subtilis expression system comprises the following steps: synthesizing a plasmid pMK4-T7 with a sequence shown as SEQ ID NO. 2, inserting an alpha-L-arabinofuranosidase encoding gene into the plasmid pMK4-T7 to obtain an expression plasmid pMK 4-T7-arbf; transforming the expression plasmid pMK4-T7-arbf into the Bacillus subtilis expression system of claim 1 to obtain Bacillus subtilis T7-arbf; the bacillus subtilis T7-arbf is fermented, cultured and secreted to produce alpha-L-arabinofuranosidase. The invention can efficiently express protein by taking cheap bran as an inducer; in a fermentation experiment, the highest enzyme activity of the alpha-L-arabinofuranosidase can reach 194.8 +/-4.1U/mL.

Description

Bacillus subtilis expression system and method for producing alpha-L-AFs by using same

Technical Field

The invention belongs to the technical field of construction of a bacillus subtilis expression system, and particularly relates to a bacillus subtilis expression system and a method for producing alpha-L-arabinofuranosidase by using the same.

Background

Bacillus subtilis, a GRAS (generally recognized As safe) species, is widely used in bioengineering As a basal disc cell, and is particularly useful for expressing food-related enzymes. Nevertheless, promoter tools in B.subtilis remain limited. The most widely used promoter is P43. Several new promoters have been reported in recent years, but their efficiency is still not superior to that of the T7 promoter in the T7 expression system. The T7 promoter was first used in E.coli and initiated to transcribe DNA sequences downstream of it with high efficiency by the action of T7RNA polymerase. In recent years, the T7 expression system has been reported to function in Bacillus, but it has not been reported in Bacillus subtilis ATCC6051 a. Compared with Bacillus subtilis model bacterium 168 and derivative strains thereof used in laboratory research, the Bacillus subtilis ATCC6051a also called A164 strain has better effect of secreting and expressing heterologous proteins, can grow faster in a culture medium containing peptone and has better potential for industrial application.

alpha-L-arabinofuranosidases (EC 3.2.1.55; alpha-L-arabinofuranosidases; alpha-L-AFs) can act specifically on alpha-L-arabinofuranosides, arabinoxylans or arabinogalactans, and can hydrolyze the (1,3) and/or (1,5) -position bonds, trimming the side chains containing alpha-L-arabinosyl groups. alpha-L-AFs can be used in a variety of industrial processes, such as the production of sugars or pharmaceutical compounds using biomass, the improvement of beverage flavor, bread storage, animal feed processing, and pulp delignification. According to sequence similarity and evolutionary relationship, the alpha-L-AFs can be divided into 5 glycosyl hydrolase families (GHs), namely GH3, GH43, GH51, GH54, GH62 and the like. Some α -L-AFs have been identified and overexpressed in E.coli, A.niger or Pichia pastoris, but secretory expression of α -L-AFs in B.subtilis has not been reported.

Disclosure of Invention

The invention aims to provide a bacillus subtilis expression system and a method for producing alpha-L-arabinofuranosidase by using the same.

The technical scheme adopted by the invention for realizing the purpose is as follows:

the invention provides a bacillus subtilis expression system which is established by inserting a T7RNA polymerase expression system induced by xylose into an aprE site of a bacillus subtilis genome.

As a preferred embodiment, the Bacillus subtilis is Bacillus subtilis 164S, which is obtained by integrating one copy of comk at the nprE site of Bacillus subtilis ATCC6051 a.

As a preferred embodiment, the DNA sequence of the expression system of T7RNA polymerase is shown in SEQ ID NO. 1.

The invention also provides application of the bacillus subtilis expression system in biotransformation or expression of enzyme protein. Specifically, the invention provides application of the bacillus subtilis expression system in production of alpha-L-arabinofuranosidase.

The invention also provides a method for producing alpha-L-arabinofuranosidase by using the bacillus subtilis expression system, which comprises the following steps:

step 1, synthesizing a plasmid pMK4-T7 with a sequence shown as SEQ ID NO. 2, inserting an alpha-L-arabinofuranosidase encoding gene into the plasmid pMK4-T7 to obtain an expression plasmid pMK 4-T7-arbf;

step 2, transforming the expression plasmid pMK4-T7-arbf into the Bacillus subtilis expression system of claim 1 to obtain Bacillus subtilis T7-arbf;

and 3, fermenting, culturing and secreting the bacillus subtilis T7-arbf to produce the alpha-L-arabinofuranosidase.

As a preferred embodiment, the DNA sequence of plasmid pMK4-T7-arbf in step 1 is shown in SEQ ID NO 3.

As a preferred embodiment, the amino acid sequence of the alpha-L-arabinofuranosidase in the step 1 is shown as SEQ ID NO. 4.

As a preferred embodiment, the Bacillus subtilis T7-arbf in the step 3 is subjected to fermentation culture in LB medium under the induction of xylose, xylan or bran.

As a preferred embodiment, the culture medium for fermentation culture of the bacillus subtilis T7-arbf is: LB medium + 3% (m/V) bran.

Compared with the prior art, the invention has the beneficial effects that:

1, the T7 expression system of the invention is different from other systems applied to bacillus, and the invention uses GFP and a high-efficiency synthetic promoter P43 as a control to verify the recombinant production of foreign proteins based on a T7 promoter.

2, the T7 expression system designed by the invention can efficiently express foreign proteins in bacillus subtilis due to unique genome integration sites, high transformation efficiency of host cells and high expression efficiency of T7RNA polymerase; the protein can be efficiently expressed by taking cheap bran as an inducer, and the highest enzyme activity of the alpha-L-arabinofuranosidase can reach 194.8 +/-4.1U/mL in a fermentation experiment.

3, the bacillus subtilis expression system has good application prospect in the aspects of protein expression, biotransformation and the like.

Drawings

FIG. 1 is a schematic diagram of the construction of recombinant Bacillus subtilis 164T7P according to the present invention.

FIG. 2 is a schematic representation of plasmid pMK4-T7 of the present invention.

FIG. 3 is a graph showing the data of the results of expressing GFP in the xylose-induced T7 expression system and the P43 expression system, respectively, in example 2 of the present invention.

FIG. 4 is a schematic representation of plasmid pMK4-T7-arbf of the present invention.

FIG. 5 is a graph showing the temperature-dependent change in the activity of recombinant Arbf expressed by Bacillus subtilis T7-Arbf in example 3 of the present invention.

FIG. 6 is a graph showing the pH-dependent activity of recombinant Arbf expressed by Bacillus subtilis T7-Arbf in example 3 of the present invention.

FIG. 7 is a graph comparing the expression results of recombinant Arbf obtained by using xylose and bran of the present invention as inducers, respectively.

Detailed Description

The technical solution of the present invention will be described in detail with reference to examples. The operations under the conditions not specified in the examples were carried out under the conventional conditions or the conditions recommended by the manufacturer. The reagents and biomaterials used below were all commercial products unless otherwise specified.

The sources of biomaterial used in the following examples are as follows:

bacillus subtilis 164S is derived from a laboratory deposited species, Bacillus subtilis ATCC6051a (also known as A164): one copy of comk was integrated at the nprE site of B.subtilis A164. Bacillus subtilis ATCC6051a is a model strain of American type culture collection (American type culture collection), and 6051a is a collection number thereof and is commercially available from American ATCC (American type culture Collection).

Coli BL21(DE3) was purchased from Biotechnology engineering (Shanghai) GmbH. The pMK4-P43-gfp was constructed from the literature "cloning and validation of a Bacillus neutral protease promoter" (DOI: 10.13386/j. issn 1002-0306.2016.13.030). pMK4-T7 is a synthetic plasmid (sequence shown in SEQ ID NO: 2), the T7 promoter, multiple cloning site and T7 terminator are inserted into the Pst I and Nde I sites of pMK 4. DNA synthesis and sequencing annotation work was performed by Biotechnology engineering (Shanghai) Inc. pMD19T is a cloning plasmid of engineering bioengineering, Inc.

2X Phanta Master Mix (cat # P511-01) used in the examples,

II One Step Cloning Kit (cat # C115-01) available from Biotech Inc. of Nanjing Novowed Zan; the SDS-PAGE gel kit is purchased from Biotechnology engineering (Shanghai) GmbH, and the restriction enzyme is purchased from TaKaRa; erythromycin (cat # E808819), chloramphenicol (cat # C804169), and D-xylose (cat # D856756) were purchased from Shanghai Mike4-Nitrophenyl-alpha-L-arabinofuranoside (pNPA, 4-nitrophenyl alpha-L-arabinofuranoside, cat # 6892-58-6) was purchased from Kyoto Kaiseii, pharmaceutical science, Inc.

Example 1: construction of recombinant Bacillus subtilis 164T7P

Bacillus subtilis 164T7P is an integrated T7RNA polymerase expression sequence at the aprE site of Bacillus subtilis 164S. The aprE site of Bacillus subtilis 164S is a more desirable integration site because the gene expresses alkaline protease, and alternative integration of the gene can reduce degradation of foreign proteins by the host cell. The invention integrates a complete overexpression sequence (shown as SEQ ID NO: 1) containing T7RNA polymerase into the site, simultaneously knocks out the gene, and then obtains 164T7P by eliminating erythromycin resistance gene, and FIG. 1 is a construction schematic diagram of recombinant bacillus subtilis 164T 7P. The specific construction method of the bacillus subtilis 164T7P is as follows:

(1) construction of integration plasmid pMD19T-T7P

First, a T7RNA polymerase-encoding gene fragment (T7RNAP) was amplified using a primer set of F77-F (5'-atgaacacgattaacatcgctaagaacgac-3') (shown in SEQ ID NO: 5)/F77-R (5'-catgctgcagaaaagaagcaggtatggaggaacctgcttctttttactattacgcgaacg cgaagtccgactc-3') (shown in SEQ ID NO: 6) and using a template of E.coli BL21(DE3) genome. The xylose promoter PxylA was then amplified using the primer pair Fxy-F (5'-atcgctgcagctaacttataggggtaacacttaaaaaagaatc-3') (shown in SEQ ID NO: 7)/Fxy-R (5'-gtcgttcttagcgatgttaatcgtgttcatattatggcctcctttggatcccatttc-3') (shown in SEQ ID NO: 8) and using the genomic DNA of template Bacillus subtilis 6051 a.

The 2 DNA fragments (T7RNAP and PxylA) were amplified using 2X Phanta Master Mix, and the PCR method was performed using the method described in 2X Phanta Master Mix. After the amplified PCR product is treated by using Dpn I as a template, the AxyPrep PCR cleaning kit is adopted for cleaning and recovering DNA, and finally, the concentration of the cleaned DNA fragment is determined by Nanodrop.

The two fragments are connected by using a fusion PCR method, which comprises the following steps:

first, PCR was performed in a system of 10. mu.L 2 × Phanta Master Mix, 200ng each of 2 fragments, and ddH was added₂O to system 20. mu.L. Performing a first round of PCR reaction under the conditions of pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 15S, annealing at 60 ℃ for 15S, extension at 72 ℃ for 3min, and cycle number of 10.

Second, the PCR reaction configuration system was 25. mu.L of 2 XPphanta Master Mix, 2.5. mu.L of primer Fxy-F (10. mu.M), 2.5. mu.L of primer F77-R (10. mu.M), 1. mu.L of the first round PCR reaction product, 19. mu.L of ddH₂And O. The PCR reaction conditions were pre-denaturation at 95 ℃ for 5min, followed by denaturation at 95 ℃ for 15S, annealing at 55 ℃ for 15S, extension at 72 ℃ for 3min, and cycle number 30.

And (3) detecting by gel electrophoresis, amplifying 2 fragment fusion products by PCR in the second step, carrying out clean recovery on DNA by adopting an AxyPrep PCR clean kit, and determining the concentration by using Nanodrop. By using

II, constructing a One Step Cloning Kit by ligation, and connecting the PCR fusion product to XmaI and Kpn I sites of pMD19T, wherein the construction method is a Kit instruction method. The constructed plasmid is identified and verified by the production sequencing and is named as pMD 19T-T7P.

(2) Transformation and resistance to pMD19T-T7P

The plasmid pMD19T-T7P is treated by using restriction enzyme ApaL I to be linearized, then the linearized pMD19T-T7P is transformed into bacillus subtilis 164S, the bacillus subtilis 164S is evenly coated on a resistant plate containing 10 mu g/mL erythromycin, the resistant plate is placed in a 37 ℃ incubator for overnight culture, and a single colony grown out is identified by colony PCR, and a positive transformant is a strain which is successfully transformed. The resistance is eliminated through a Cre/lox system carried by a transformant and a passage method, the grown transformant is stamped on a 10 mu g/mL chloramphenicol resistant plate and a 10 mu g/mL erythromycin resistant plate at the same time, the grown transformant cannot grow on the two resistant plates, and a recombinant bacterium for knocking out an erythromycin resistance gene ermC is identified through colony PCR (polymerase chain reaction) to form the constructed bacillus subtilis 164T 7P.

Example 2 expression System of T7 expression GFP

(1) Construction of plasmid pMK4-T7-GFP and Bacillus subtilis T7-GFP

The plasmid pMK4-T7 was synthesized artificially, see FIG. 2, as a schematic representation of the plasmid pMK 4-T7. Carrying out enzyme digestion on the synthesized plasmid pMK4-T7 by using restriction enzymes BamH I and EcoR I to linearize the plasmid, and then cleaning and recovering DNA by adopting an AxyPrep PCR cleaning kit; meanwhile, gfp is amplified, a primer pair used for amplifying gfp is gfp-F (5'-gtttaactttaagaaaggaggatataccatgagtaaaggcgaagaacttttcac-3') (shown as SEQ ID NO: 9)/gfp-R (5'-gcttcctttcgggctttgttagcaggaattcttatttgtatagttcatccatgcc-3') (shown as SEQ ID NO: 10), a template is used for amplifying plasmid pMK4-P43-gfp, and after an amplification product is treated by using restriction enzyme Dpn I as a template, an AxyPrep PCR cleaning kit is adopted for cleaning and recovering DNA; then, a cloning technology based on fusion PCR is used for constructing a plasmid pMK4-T7-gfp, and the specific operation is as follows:

and (3) PCR reaction system: gfp fragment 200ng, linearized plasmid pMK 4-T7500 ng, 2 × Phanta Master Mix25 μ L, addition of ddH₂O to the reaction system was 50. mu.L. The PCR reaction conditions were pre-denaturation at 95 ℃ for 5min, followed by denaturation at 95 ℃ for 15S, annealing at 55 ℃ for 15S, extension at 72 ℃ for 4min, and cycle number 30.

And finally, transforming the bacillus subtilis 164T7P with a 10 mu LPCR reaction product, uniformly coating the incubated product on a resistant plate containing 10 mu g/mL chloramphenicol, placing the resistant plate in a thermostat at 37 ℃ for overnight culture, identifying a grown single colony through colony PCR (polymerase chain reaction), wherein a positive transformant is a successfully transformed strain, randomly selecting a single clone to extract a plasmid, transferring the plasmid to a biological company for sequencing, identifying a completely correct plasmid as the plasmid pMK4-T7-GFP, and naming the corresponding recombinant bacterium as the bacillus subtilis T7-GFP.

(2) Construction of Bacillus subtilis P43-GFP

10 mu L of plasmid pMK4-P43-GFP is taken to transform bacillus subtilis 164T7P, after incubation, the bacillus subtilis is evenly coated on a resistant plate containing 10 mu g/mL chloramphenicol, the plate is placed in a thermostat at 37 ℃ for overnight culture, and a single grown colony is identified by colony PCR, and a positive transformant is a successfully transformed strain and is named as bacillus subtilis P43-GFP.

(3) Determination of GFP (green fluorescent protein) expression by fermentation of bacillus subtilis

Unless otherwise specified, the following media all contained 10. mu.g/mL chloramphenicol. Shake flask fermentation experiments were performed using Bacillus subtilis T7-GFP and P43-GFP: firstly, selecting a single clone to be cultured in a test tube filled with 3mL of LB culture medium (the formula is 10g/L peptone, 10g/L NaCl and 5g/L yeast powder), and shaking the test tube at the constant temperature of 200rpm and 37 ℃ for overnight culture; then transferring 300 mu L of culture into a 250mL shake flask filled with 30mL LB culture medium, and carrying out shake culture at constant temperature of 37 ℃ at 200 rpm; to grow for 4h or OD₆₀₀Adding xylose with the final concentration of 1% (m/V) into the culture medium for induction when the concentration is about 1 percent; sampling every 12h, and determining OD by use of enzyme-labeling instrument₆₀₀And fluorescence intensity.

The experimental results are shown in FIG. 3, which is a graph comparing the data of the expression of GFP in the xylose-induced T7 expression system and the P43 expression system, respectively. The results in FIG. 3 show that: the T7 expression system has more than 10 times higher efficiency than promoter P43 in Bacillus subtilis, and has great application potential.

Example 3 expression of alpha-L-arabinofuranosidase with xylose as inducer

(1) Construction of plasmid pMK4-T7-Arbf and Bacillus subtilis T7-Arbf

arbf encodes a bacterial type temperature resistance, the sequence of which is obtained by sequence alignment analysis using bioinformatics tools, the amino acid sequence is shown as SEQ ID NO. 4, and then is obtained by gene synthesis. The function of the sequence before exogenous expression of the gene is not well defined. Through whole genome sequencing and annotation, the gene arbf is found, and the energy of the gene arbf is presumed.

Chemically synthesized DNA coding for alpha-L-arabinofuranosidase is used as a template, PCR amplification of linear DNA is carried out, primers F used are arbf-F (5'-taattttgtttaactttaagaaaggaggatataccatgactgtacacaaagcgaagatg-3') (shown as SEQ ID NO: 11)/arbf-R and arbf-R (5'-gccaactcagcttcctttcgggctttgttagcaggaattcttattgtttcttcattctgatcacattcc-3') (shown as SEQ ID NO: 12), and the amplification product is subjected to template elimination treatment by restriction enzyme Dpn I and then is subjected to DNA cleaning recovery by adopting an AxyPrep PCR cleaning kit. The DNA fragments of the plasmid pMK4-T7 and the gene arbf were linearized, and the plasmid pMK4-T7-arbf was constructed by the cloning technique of fusion PCR, which was performed in the same manner as in example 2. See FIG. 4 for a schematic representation of plasmid pMK 4-T7-arbf.

10 mu L of plasmid pMK4-T7-Arbf is taken to transform bacillus subtilis 164T7P, after incubation, the bacillus subtilis is evenly coated on a resistant plate containing 10 mu g/mL chloramphenicol, the plate is placed in a thermostat at 37 ℃ for overnight culture, and a positive transformant is a successfully transformed strain through colony PCR identification on a single grown colony, which is named as bacillus subtilis T7-Arbf.

(2) Fermentation experiment of Bacillus subtilis T7-Arbf

Unless otherwise specified, the following media all contained 10. mu.g/mL chloramphenicol. The shake flask fermentation experiment was performed using Bacillus subtilis T7-Arbf: firstly, picking a single clone into a test tube filled with 3mL of LB culture medium, and culturing the single clone in a constant temperature shaking table at 200rpm and 37 ℃ overnight; then transferring 300 mu L of culture into a 250mL shake flask filled with 30mL LB culture medium, and carrying out shake culture at constant temperature of 37 ℃ at 200 rpm; to grow for 4h or OD₆₀₀Adding xylose with the final concentration of 1% (m/V) into the culture medium for induction when the concentration is about 1 percent; sampling every 12h, determining OD₆₀₀And the activity and the characterization of the alpha-L-arabinofuranosidase.

The method for measuring the activity of the alpha-L-arabinofuranosidase comprises the following steps: alpha-L-arabinofuranosidase hydrolyze one molecule of pNPA (4-nitrophenyl alpha-L-arabinofuranoside) to produce one molecule of p-nitrophenol (4-nitrophenol), and the amount of enzyme required to hydrolyze the substrate per minute to produce 1. mu. mol of p-nitrophenol is defined as 1 activity unit. The enzyme activity was calculated by measuring the production of the product. Firstly, 50 mul of pNPA solution is taken, 100 mul of diluted enzyme solution is added, and the mixture is incubated for 5min in water bath at 40 ℃; then 150. mu.l of 10% Na was added₂CO₃The reaction was stopped in solution and the absorbance was measured at 410nm (note: dilution of enzyme to control the final OD measured)₄₁₀Between 0.2 and 0.8). And (3) measuring the temperature and pH curves of the recombinant Arbf enzyme, wherein the temperature range is 25-65 ℃, and the pH range is 3.5-9.0. And simultaneously determining the enzymological characteristic parameters of the recombinant Arbf.

The fermentation results show that: the recombinant Arbf enzyme may be secreted extracellularly, as shown in FIGS. 5 and 6, expressedAnd (3) a graph of the activity of the recombinant Arbf enzyme along with the change of temperature and pH. As can be seen from fig. 5 and 6: the optimum temperature is 45 ℃ and the optimum pH is 6.5. The Km value of the recombinant Arbf enzyme is 1.4 +/-0.1 mM, and the kcat is 139.4s^-1. The highest enzyme activity of the recombinant alpha-L-arabinofuranosidase expressed by the fermentation of the bacillus subtilis T7-Arbf in an LB culture medium under the induction of xylose is 141.4 +/-4.8U/mL.

Example 4 expression of alpha-L-arabinofuranosidase Using bran as inducer

The bran is a byproduct of wheat processing, and is rich in arabinoxylan. Through experiments, the following results are found: the bacillus subtilis can hydrolyze xylose residues in the bran by XynA and XynC per se. This section differs from the fermentation process of example 3 only in that the inducer xylose is replaced by cheap bran and the other process steps are the same. The specific fermentation method comprises the following steps:

unless otherwise specified, the following media all contained 10. mu.g/mL chloramphenicol. The shake flask fermentation experiment was performed using Bacillus subtilis T7-Arbf: firstly, picking a single clone into a test tube filled with 3mL of LB culture medium, and culturing the single clone in a constant temperature shaking table at 200rpm and 37 ℃ overnight; then transferring 300 μ L of the culture into a 250mL shake flask containing 30mL LB + 3% bran (m/V) medium, culturing at 200rpm and 37 deg.C in a constant temperature shaking table, sampling every 12h, and determining OD₆₀₀And the activity and the characterization of the alpha-L-arabinofuranosidase.

Referring to fig. 7, a graph comparing the expression results of recombinant Arbf obtained for xylose and bran as inducers, respectively. When xylose is used as an inducer, the highest enzyme activity of the Arbf enzyme expressed by the fermentation of the bacillus subtilis T7-Arbf in LB culture medium is 141.4 +/-4.8U/mL. When bran is used as an inducer, the highest enzyme activity of the fermented and expressed Arbf enzyme is 194.8 +/-4.1U/mL, which is 1.4 times of that of xylose used as the inducer.

The above description is only a part of the preferred embodiments of the present invention, and the present invention is not limited to the contents of the embodiments. It will be apparent to those skilled in the art that various changes and modifications can be made within the spirit of the invention, and any changes and modifications made are within the scope of the invention.

Sequence listing

<110> Shanghai higher research institute of Chinese academy of sciences

<120> Bacillus subtilis expression system and method for producing alpha-L-AFs by using same

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 6647

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 1

caaatgcgct gaatgcctat gttacaggaa ttggggccaa taaacggatt gtattgtggg 60

atacgacgct gaacaaactt gacgattcag aaattctgtt tattatgggc cacgaaatgg 120

gccattatgt catgaagcac gtttacatcg gtctggctgg ctatttgctc gtgtcgctcg 180

ccggatttta tgtcattgat aagctttaca agcggacggt tcgcctaacc cgcagcatgt 240

ttcatttaga agggcggcat gatcttgcgg cacttccgct gttattgctt ttgttttctg 300

ttttgagctt tgcggttacg cctttttcta atgctgtctc gcgttatcag gagaataagg 360

ctgaccagta tgggatcgag ttgacagaga acagagaagc cgctgttaaa acgtttcagg 420

atttggccgt gacggggctg agccaggttg atcctccggt gcttgtgaag attttcagag 480

gcagccatcc gtcgatcatg gaacggattc aacatgcgga gaaagaagag aatgcgccgg 540

aacatcagga tgctgacaaa taaaaagaag caggtatgga ggaacctgct tctttttact 600

attattgtgc agctgcttgc ctgcactgca gggatccaag cttgcggccg ctaccgttcg 660

tatagcatac attatacgaa gttatttaaa ccgtgtgctc tacgaccaaa actataaaac 720

ctttaagaac tttctttttt tacaagaaaa aagaaattag ataaatctct catatctttt 780

attcaataat cgcatccgat tgcagtataa atttaacgat cactcatcat gttcatattt 840

atcagagctc gtgctataat tatactaatt ttataaggag gaaaaaatat gggcattttt 900

agtatttttg taatcagcac agttcattat caaccaaaca aaaaataagt ggttataatg 960

aatcgttaat aagcaaaatt catataacca aattaaggag ggaaataatg aacgagaaaa 1020

atataaaaca cagtcaaaac tttattactt caaaacataa tatagataaa ataatgacaa 1080

atataagatt aaatgaacat gataatatct ttgaaatcgg ctcaggaaaa ggccatttta 1140

cccttgaatt agtaaagagg tgtaatttcg taactgccat tgaaatagac cataaattat 1200

gcaaaactac agaaaataaa cttgttgatc acgataattt ccaagtttta aacaaggata 1260

tattgcagtt taaatttcct aaaaaccaat cctataaaat atatggtaat ataccttata 1320

acataagtac ggatataata cgcaaaattg tttttgatag tatagctaat gagatttatt 1380

taatcgtgga atacgggttt gctaaaagat tattaaatac aaaacgctca ttggcattac 1440

ttttaatggc agaagttgat atttctatat taagtatggt tccaagagaa tattttcatc 1500

ctaaacctaa agtgaatagc tcacttatca gattaagtag aaaaaaatca agaatatcac 1560

acaaagataa acaaaagtat aattatttcg ttatgaaatg ggttaacaaa gaatacaaga 1620

aaatatttac aaaaaatcaa tttaacaatt ccttaaaaca tgcaggaatt gacgatttaa 1680

acaatattag ctttgaacaa ttcttatctc ttttcaatag ctataaatta tttaataagt 1740

aagttaaggg atgcataaac tgcatccctt aacttgtttt tcgtgtgcct attttttgtg 1800

aattgattat cgatcttttg cgccatggat aacttcgtat agcatacatt atacgaacgg 1860

tacatatgcc cgggctaact tataggggta acacttaaaa aagaatcaat aacgatagaa 1920

accgctccta aagcaggtgc attttttcct aacgaagaag gcaatagttc acatttattg 1980

tctaaatgag aatggactct agaagaaact tcgtttttaa tcgtatttaa aacaatggga 2040

tgagattcaa ttatatgatt tctcaagata acagcttcta tatcaaatgt attaaggata 2100

ttggttaatc caattccgat ataaaagcca aagttttgaa gtgcatttaa catttctaca 2160

tcatttttat ttgcgcgttc cacaatctct tttcgagaaa tattcttttc ttctttagag 2220

agcgaagcca gtaacgcttt ttcagaagca tataattccc aacagcctcg atttccacag 2280

ctgcatttgg gtccattaaa atctatcgtc atatgaccca tttccccaga aaaaccctga 2340

acacctttat acaattcgtt gttaataaca agtccagttc caattccgat attaatactg 2400

atgtaaacga tgttttcata gttttttgtc ataccaaata ctttttcacc gtatgctcct 2460

gcattagctt cattttcaac aaaaaccgga acattaaact cactctcaat taaaaactgc 2520

aaatctttga tattccaatt taagttaggc atgaaaataa tttgctgatg acgatctaca 2580

aggcctggaa cacaaattcc tattccgact agaccataag gggactcagg catatgggtt 2640

acaaaaccat gaataagtgc aaataaaatc tcttttactt cactagcgga agaactagac 2700

aagtcagaag tcttctcgag aataatattt ccttctaagt cggttagaat tccgttaaga 2760

tagtcgactc ctatatcaat accaatcgag tagcctgcat tcttattaaa aacaagcatt 2820

acaggtcttc tgccgcctct agattgccct gccccaattt caaaaataaa atctttttca 2880

agcagtgtat ttacttgaga ggagacagta gacttgttta atcctgtaat ctcagagaga 2940

gttgccctgg agacagggga gttcttcaaa atttcatcta atattaattt ttgattcatt 3000

ttttttacta aagcttgatc tgcaatttga ataataacca ctcctttgtt tatccaccga 3060

actaagttgg tgttttttga agcttgaatt agatatttaa aagtatcata tctaatatta 3120

taactaaatt ttctaaaaaa aacattgaaa taaacattta ttttgtatat gatgagataa 3180

agttagttta ttggataaac aaactaactc aattaagata gttgatggat aaacttgttc 3240

acttaaatca aagggggaaa tgacaaatgg tccaaactag tgatatctaa aaatcaaagg 3300

gggaaatggg atccaaagga ggccataata tgaacacgat taacatcgct aagaacgact 3360

tctctgacat cgaactggct gctatcccgt tcaacactct ggctgaccat tacggtgagc 3420

gtttagctcg cgaacagttg gcccttgagc atgagtctta cgagatgggt gaagcacgct 3480

tccgcaagat gtttgagcgt caacttaaag ctggtgaggt tgcggataac gctgccgcca 3540

agcctctcat cactacccta ctccctaaga tgattgcacg catcaacgac tggtttgagg 3600

aagtgaaagc taagcgcggc aagcgcccga cagccttcca gttcctgcaa gaaatcaagc 3660

cggaagccgt agcgtacatc accattaaga ccactctggc ttgcctaacc agtgctgaca 3720

atacaaccgt tcaggctgta gcaagcgcaa tcggtcgggc cattgaggac gaggctcgct 3780

tcggtcgtat ccgtgacctt gaagctaagc acttcaagaa aaacgttgag gaacaactca 3840

acaagcgcgt agggcacgtc tacaagaaag catttatgca agttgtcgag gctgacatgc 3900

tctctaaggg tctactcggt ggcgaggcgt ggtcttcgtg gcataaggaa gactctattc 3960

atgtaggagt acgctgcatc gagatgctca ttgagtcaac cggaatggtt agcttacacc 4020

gccaaaatgc tggcgtagta ggtcaagact ctgagactat cgaactcgca cctgaatacg 4080

ctgaggctat cgcaacccgt gcaggtgcgc tggctggcat ctctccgatg ttccaacctt 4140

gcgtagttcc tcctaagccg tggactggca ttactggtgg tggctattgg gctaacggtc 4200

gtcgtcctct ggcgctggtg cgtactcaca gtaagaaagc actgatgcgc tacgaagacg 4260

tttacatgcc tgaggtgtac aaagcgatta acattgcgca aaacaccgca tggaaaatca 4320

acaagaaagt cctagcggtc gccaacgtaa tcaccaagtg gaagcattgt ccggtcgagg 4380

acatccctgc gattgagcgt gaagaactcc cgatgaaacc ggaagacatc gacatgaatc 4440

ctgaggctct caccgcgtgg aaacgtgctg ccgctgctgt gtaccgcaag gacaaggctc 4500

gcaagtctcg ccgtatcagc cttgagttca tgcttgagca agccaataag tttgctaacc 4560

ataaggccat ctggttccct tacaacatgg actggcgcgg tcgtgtttac gctgtgtcaa 4620

tgttcaaccc gcaaggtaac gatatgacca aaggactgct tacgctggcg aaaggtaaac 4680

caatcggtaa ggaaggttac tactggctga aaatccacgg tgcaaactgt gcgggtgtcg 4740

ataaggttcc gttccctgag cgcatcaagt tcattgagga aaaccacgag aacatcatgg 4800

cttgcgctaa gtctccactg gagaacactt ggtgggctga gcaagattct ccgttctgct 4860

tccttgcgtt ctgctttgag tacgctgggg tacagcacca cggcctgagc tataactgct 4920

cccttccgct ggcgtttgac gggtcttgct ctggcatcca gcacttctcc gcgatgctcc 4980

gagatgaggt aggtggtcgc gcggttaact tgcttcctag tgaaaccgtt caggacatct 5040

acgggattgt tgctaagaaa gtcaacgaga ttctacaagc agacgcaatc aatgggaccg 5100

ataacgaagt agttaccgtg accgatgaga acactggtga aatctctgag aaagtcaagc 5160

tgggcactaa ggcactggct ggtcaatggc tggcttacgg tgttactcgc agtgtgacta 5220

agcgttcagt catgacgctg gcttacgggt ccaaagagtt cggcttccgt caacaagtgc 5280

tggaagatac cattcagcca gctattgatt ccggcaaggg tctgatgttc actcagccga 5340

atcaggctgc tggatacatg gctaagctga tttgggaatc tgtgagcgtg acggtggtag 5400

ctgcggttga agcaatgaac tggcttaagt ctgctgctaa gctgctggct gctgaggtca 5460

aagataagaa gactggagag attcttcgca agcgttgcgc tgtgcattgg gtaactcctg 5520

atggtttccc tgtgtggcag gaatacaaga agcctattca gacgcgcttg aacctgatgt 5580

tcctcggtca gttccgctta cagcctacca ttaacaccaa caaagatagc gagattgatg 5640

cacacaaaca ggagtctggt atcgctccta actttgtaca cagccaagac ggtagccacc 5700

ttcgtaagac tgtagtgtgg gcacacgaga agtacggaat cgaatctttt gcactgattc 5760

acgactcctt cggtaccatt ccggctgacg ctgcgaacct gttcaaagca gtgcgcgaaa 5820

ctatggttga cacatatgag tcttgtgatg tactggctga tttctacgac cagttcgctg 5880

accagttgca cgagtctcaa ttggacaaaa tgccagcact tccggctaaa ggtaacttga 5940

acctccgtga catcttagag tcggacttcg cgttcgcgta atagtaaaaa gaagcaggtt 6000

cctccatacc tgcttctttt gaattccctg ctggtcgcca ttttggctct ttaccctctc 6060

cttttaaaaa aattcagagt agacttactt aaaagactat tctgtgaatt tattgtaata 6120

gatggaataa tattttagta gacccatttt tttgagatga ttttatctct atttaggtat 6180

atcatctctc gctatttccg tagagactcg aaataactat tttcatacag aaaagaacga 6240

aaatagacat gagtaaatgt tcattatgct gaaatgtcat gcttttttag gttaaatgct 6300

cctgagtccc ggcaaattcc tgtcgaaaaa attcgttcaa atgacctgcg tgtgcttccg 6360

tgagaacaat ggatattatc gtgatatttt ttcaaagcat gatgataaaa gtattctgaa 6420

aaataaactt tacagaaaag ggatagaatg aaaaaattat tgagagggag gaagaaataa 6480

gatgaacatt cgccaagcaa agacatcaga tgcggccgcc attgcgccgc tgtttaacca 6540

atatcgggaa ttttatagac aggcatccga tttgcaaggg gcagaggctt ttttgaaagc 6600

tcgtttggaa aatcacgagt ctgttatttt gatagcagaa gaaaatg 6647

<210> 2

<211> 5729

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 60

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct 120

cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat 180

tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg ccaagcttgg 240

ctgcaggtgg cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac 300

cgcacctgtg gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatcga 360

tctcgatccc gcgaaattaa tacgactcac tataggggaa ttgtgagcgg ataacaattc 420

ccctctagaa ataattttgt ttaactttaa gaaaggagga tataccggat cccccggggg 480

taccgaattc ctgctaacaa agcccgaaag gaagctgagt tggctgctgc caccgctgag 540

caataactag cataacccct tggggcctct aaacgggtct tgaggggttt tttgctgaaa 600

ggaggaacta tatccggatc atatggtgca ctctcagtac aatctgctct gatgccgcat 660

agttaagcca gccccgacac ccgccaacac ccgctgacgc gccctgacgg gcttgtctgc 720

tcccggcatc cgcttacaga caagctgtga ccgtctccgg gagctgcatg tgtcagaggt 780

tttcaccgtc atcaccgaaa cgcgcgagac gaaagggcct cgtgatacgc ctatttttat 840

aggttaatgt catgataata atggtttctt agacgtcagg tggcactttt cggggaaatg 900

tgcgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat ccgctcatga 960

gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac 1020

atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc 1080

cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca 1140

tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc 1200

caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt attgacgccg 1260

ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac 1320

cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca 1380

taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg 1440

agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat cgttgggaac 1500

cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg 1560

caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat 1620

taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg 1680

ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc ggtatcattg 1740

cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg acggggagtc 1800

aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc 1860

attggtaact gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt 1920

tttaatttaa aaggatctag gtgaagatcc atatccttct ttttctgaac cgacttctcc 1980

tttttcgctt ctttattcca attgctttat tgacgttgag cctcggaacc cttaacaatc 2040

ccaaaacttg tcgaatggtc ggcttaatag ctcacgctat gccgacattc gtctgcaagt 2100

ttagttaagg gttcttctca acgcacaata aattttctcg gcataaatgc gtggtctaat 2160

ttttattttt aataaccttg atagcaaaaa atgccattcc aatacaaaac cacataccta 2220

taatcgataa ccacataaca gtcataaaac cactcctttt taacaaactt tatcacaaga 2280

aatatttaaa ttttaaatgc ctttattttg aattttaagg ggcattttaa agatttaggg 2340

gtaaatcata tagttttatg cctaaaaacc tacagaagct tttaaaaagc aaatatgagc 2400

caaataaata tattctaatt ctacaaacaa aaatttgagc aaattcagtg tcgatttttt 2460

aagacactgc ccagttacat gcaaattaaa attttcatga ttttttatag ttcctaacag 2520

ggttaaaatt tgtataacga aagtataatg tttatataac gttagtataa taaagcattt 2580

taacattata cttttgataa tcgtttatcg tcgtcatcac aataactttt aaaatactcg 2640

tgcataattc aacagctgac ctcccaataa ctacatggtg ttatcgggag gtcagctgtt 2700

agcacttata ttttgttatt gttcttcctc gatttcgtct atcattttgt gattaatttc 2760

tcttttttct tgttctgtta agtcataaag ttcactagct aaatactctt tttgtttcca 2820

aatataaaaa atttgataga tatattcggt tggatcaatt tcttttaagt aatctaaatc 2880

cccatttttt aatttctttt tagcctcttt aaataatcct gaataaacta atacctgttt 2940

acctttaagt gatttataaa atgcatcaaa gactttttga tttattaaat aatcactatc 3000

tttaccagaa tacttagcca tttcatataa ttctttatta ttattttgtc ttattttttg 3060

aacttgaact tgtgttattt ctgaaatgcc cgttacatca cgccataaat ctaaccattc 3120

ttgttggcta atataatatc ttttatctgt gaaatacgat ttatttactg caattaacac 3180

atgaaaatga ggattataat catctctttt tttattatat gtaatctcta acttacgaac 3240

atatcccttt ataacactac ctactttttt tctctttata agttttctaa aagaattatt 3300

ataacgtttt atttcatttt ctaattcatc actcattaca ttaggtgtag tcaaagttaa 3360

aaagataaac tcctttttct cttgctgctt aatatattgc atcatcaaag ataaacccaa 3420

tgcatctttt ctagcttttc tccaagcaca gacaggacaa aatcgatttt tacaagaatt 3480

agctttatat aatttctgtt tttctaaagt tttatcagct acaaaagaca gaaatgtatt 3540

gcaatcttca actaaatcca tttgattctc tccaatatga cgtttaataa atttctgaaa 3600

tacttgattt ctttgttttt tctcagtata cttttccatg ttataacaca taaaaacaac 3660

ttagttttca caaactatga caataaaaaa agttgctttt tcccctttct atgtatgttt 3720

tttactagtc atttaaaacg atacattaat aggtacgaaa aagcaacttt ttttgcgctt 3780

aaaaccagtc ataccaataa cttaagggta actagcctcg ccggcaatag ttacccttat 3840

tatcaagata agaaagaaaa ggatttttcg ctacgctcaa atcctttaaa aaaacacaaa 3900

agaccacatt ttttaatgtg gtcttttatt cttcaactaa agcacccatt agttcaacaa 3960

acgaaaattg gataaagtgg gatattttta aaatatatat ttatgttaca gtaatattga 4020

cttttaaaaa aggattgatt ctaatgaaga aagcagacaa gtaagcctcc taaattcact 4080

ttagataaaa atttaggagg catatcaaat gaactttaat aaaattgatt tagacaattg 4140

gaagagaaaa gagatattta atcattattt gaaccaacaa acgactttta gtataaccac 4200

agaaattgat attagtgttt tataccgaaa cataaaacaa gaaggatata aattttaccc 4260

tgcatttatt ttcttagtga caagggtgat aaactcaaat acagctttta gaactggtta 4320

caatagcgac ggagagttag gttattggga taagttagag ccactttata caatttttga 4380

tggtgtatct aaaacattct ctggtatttg gactcctgta aagaatgact tcaaagagtt 4440

ttatgattta tacctttctg atgtagagaa atataatggt tcggggaaat tgtttcccaa 4500

aacacctata cctgaaaatg ctttttctct ttctattatt ccatggactt catttactgg 4560

gtttaactta aatatcaata ataatagtaa ttaccttcta cccattatta cagcaggaaa 4620

attcattaat aaaggtaatt caatatattt accgctatct ttacaggtac atcattctgt 4680

ttgtgatggt tatcatgcag gattgtttat gaactctatt caggaattgt cagataggcc 4740

taatgactgg cttttataat atgagataat gccgactgta ctttttacag tcggttttct 4800

aatgtcacta acctgccccg ttagttgaag aaggttttta tattacagct ccagatctag 4860

gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt ttcgttccac 4920

tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt ttttctgcgc 4980

gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg tttgccggat 5040

caagagctac caactctttt tccgaaggta actggcttca gcagagcgca gataccaaat 5100

actgttcttc tagtgtagcc gtagttaggc caccacttca agaactctgt agcaccgcct 5160

acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga taagtcgtgt 5220

cttaccgggt tggactcaag acgatagtta ccggataagg cgcagcggtc gggctgaacg 5280

gggggttcgt gcacacagcc cagcttggag cgaacgacct acaccgaact gagataccta 5340

cagcgtgagc tatgagaaag cgccacgctt cccgaaggga gaaaggcgga caggtatccg 5400

gtaagcggca gggtcggaac aggagagcgc acgagggagc ttccaggggg aaacgcctgg 5460

tatctttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc 5520

tcgtcagggg ggcggagcct atggaaaaac gccagcaacg cggccttttt acggttcctg 5580

gccttttgct ggccttttgc tcacatgttc tttcctgcgt tatcccctga ttctgtggat 5640

aaccgtatta ccgcctttga gtgagctgat accgctcgcc gcagccgaac gaccgagcgc 5700

agcgagtcag tgagcgagga agcggaaga 5729

<210> 3

<211> 7220

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 60

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaatg tgagttagct 120

cactcattag gcaccccagg ctttacactt tatgcttccg gctcgtatgt tgtgtggaat 180

tgtgagcgga taacaatttc acacaggaaa cagctatgac catgattacg ccaagcttgg 240

ctgcaggtgg cgagcccgat cttccccatc ggtgatgtcg gcgatatagg cgccagcaac 300

cgcacctgtg gcgccggtga tgccggccac gatgcgtccg gcgtagagga tcgagatcga 360

tctcgatccc gcgaaattaa tacgactcac tataggggaa ttgtgagcgg ataacaattc 420

ccctctagaa ataattttgt ttaactttaa gaaaggagga tataccatga ctgtacacaa 480

agcgaagatg acgattgaca aggaatataa ggtggcagag attgataagc gaatttacgg 540

ctcctttatc gagcatctcg gcagagccgt ttatgaaggc atttatgagc ctgatcatcc 600

tgaagctgac gaatcaggct ttcggaaaga tgtcattaaa ctagtcagag aactaaaggt 660

gccgtttatc aggtatcccg gcggaaactt tgtatctgga tataactggg aggatggagt 720

cggacctgtc gaacagcggc cgacaagact tgatttggcg tgggcgacaa ccgagccgaa 780

cttaatcggt acgaacgaat ttatggattg ggcaaagctt gtcggggcag aggtgaatat 840

ggccgtcaac ctcggaacga gaggaattga tgccgcacgc aacctagtag aatattgcaa 900

ccatccgtca ggatcgtact acagcgactt gagaaaatcc cacggatata aggaaccgca 960

taaaattaaa acatggtgcc tcggcaatga aatggacggt ccatggcaaa tcggccataa 1020

aacagcggcc gaatacggaa gacttgctgc tgaagccgcg aaggtgatga aatggacgga 1080

cccgtcgatc gagcttgtcg cctgcggaag ttcgggaagc ggaatgccga cattcatcga 1140

ctgggaaacg accgtgcttg accatacgta cgaacacgtc gagtacatct cgcttcactc 1200

gtattacggc aaccgcgaca atgatcttcc aaactatttg gcgagatcgc tagacatgga 1260

tcactttatc aaaacggtca tctcagtctg cgactatatg aaagcgaaaa agaaaagcaa 1320

gaaaacgatt cacctttcat atgatgagtg gaatgtctgg tatcactcga atgaaaaaga 1380

caaagaagct gaacgctggg cgaaagcgcc gcaccttctt gaagacatct acaactttga 1440

ggatgcgctt ctcgtcggct gtatgctgat tacgatgctc aagcatgccg accgcgtgaa 1500

aatcgcctgt ctggctcagc ttgtcaatgt catcgcgccg attatgacag acaaaggggg 1560

agaagcatgg cgtcagacca ttttctatcc gtttatgcac gcttccgtct acggcagagg 1620

aacggtactg cagacggcgg tatcgtctcc aaagtatgat gcgaaagact ttacggatgt 1680

gccgtacttg gagtccgtgt ctgttttcaa tgaagaagcc gaggaattaa ccgtttttgc 1740

cgtcaaccgc gcaacagacg ccggccttga aatggaagcc gatatgagaa gctttgaagg 1800

gtacagtgtc tctgagcaca tcgttctgga acacgaagat cataaagcga cgaatgaaaa 1860

agaccgcaac aacgtcgttc cgcacagcgg cggagacgcc aaagtatgtg acggcaggct 1920

gacggctcac cttccgaaac tttcctggaa tgtgatcaga atgaagaaac aataagaatt 1980

cctgctaaca aagcccgaaa ggaagctgag ttggctgctg ccaccgctga gcaataacta 2040

gcataacccc ttggggcctc taaacgggtc ttgaggggtt ttttgctgaa aggaggaact 2100

atatccggat catatggtgc actctcagta caatctgctc tgatgccgca tagttaagcc 2160

agccccgaca cccgccaaca cccgctgacg cgccctgacg ggcttgtctg ctcccggcat 2220

ccgcttacag acaagctgtg accgtctccg ggagctgcat gtgtcagagg ttttcaccgt 2280

catcaccgaa acgcgcgaga cgaaagggcc tcgtgatacg cctattttta taggttaatg 2340

tcatgataat aatggtttct tagacgtcag gtggcacttt tcggggaaat gtgcgcggaa 2400

cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac 2460

cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg 2520

tcgcccttat tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc 2580

tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg 2640

atctcaacag cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga 2700

gcacttttaa agttctgcta tgtggcgcgg tattatcccg tattgacgcc gggcaagagc 2760

aactcggtcg ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag 2820

aaaagcatct tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga 2880

gtgataacac tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg 2940

cttttttgca caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga 3000

atgaagccat accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt 3060

tgcgcaaact attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact 3120

ggatggaggc ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt 3180

ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg 3240

ggccagatgg taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta 3300

tggatgaacg aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac 3360

tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat ttttaattta 3420

aaaggatcta ggtgaagatc catatccttc tttttctgaa ccgacttctc ctttttcgct 3480

tctttattcc aattgcttta ttgacgttga gcctcggaac ccttaacaat cccaaaactt 3540

gtcgaatggt cggcttaata gctcacgcta tgccgacatt cgtctgcaag tttagttaag 3600

ggttcttctc aacgcacaat aaattttctc ggcataaatg cgtggtctaa tttttatttt 3660

taataacctt gatagcaaaa aatgccattc caatacaaaa ccacatacct ataatcgata 3720

accacataac agtcataaaa ccactccttt ttaacaaact ttatcacaag aaatatttaa 3780

attttaaatg cctttatttt gaattttaag gggcatttta aagatttagg ggtaaatcat 3840

atagttttat gcctaaaaac ctacagaagc ttttaaaaag caaatatgag ccaaataaat 3900

atattctaat tctacaaaca aaaatttgag caaattcagt gtcgattttt taagacactg 3960

cccagttaca tgcaaattaa aattttcatg attttttata gttcctaaca gggttaaaat 4020

ttgtataacg aaagtataat gtttatataa cgttagtata ataaagcatt ttaacattat 4080

acttttgata atcgtttatc gtcgtcatca caataacttt taaaatactc gtgcataatt 4140

caacagctga cctcccaata actacatggt gttatcggga ggtcagctgt tagcacttat 4200

attttgttat tgttcttcct cgatttcgtc tatcattttg tgattaattt ctcttttttc 4260

ttgttctgtt aagtcataaa gttcactagc taaatactct ttttgtttcc aaatataaaa 4320

aatttgatag atatattcgg ttggatcaat ttcttttaag taatctaaat ccccattttt 4380

taatttcttt ttagcctctt taaataatcc tgaataaact aatacctgtt tacctttaag 4440

tgatttataa aatgcatcaa agactttttg atttattaaa taatcactat ctttaccaga 4500

atacttagcc atttcatata attctttatt attattttgt cttatttttt gaacttgaac 4560

ttgtgttatt tctgaaatgc ccgttacatc acgccataaa tctaaccatt cttgttggct 4620

aatataatat cttttatctg tgaaatacga tttatttact gcaattaaca catgaaaatg 4680

aggattataa tcatctcttt ttttattata tgtaatctct aacttacgaa catatccctt 4740

tataacacta cctacttttt ttctctttat aagttttcta aaagaattat tataacgttt 4800

tatttcattt tctaattcat cactcattac attaggtgta gtcaaagtta aaaagataaa 4860

ctcctttttc tcttgctgct taatatattg catcatcaaa gataaaccca atgcatcttt 4920

tctagctttt ctccaagcac agacaggaca aaatcgattt ttacaagaat tagctttata 4980

taatttctgt ttttctaaag ttttatcagc tacaaaagac agaaatgtat tgcaatcttc 5040

aactaaatcc atttgattct ctccaatatg acgtttaata aatttctgaa atacttgatt 5100

tctttgtttt ttctcagtat acttttccat gttataacac ataaaaacaa cttagttttc 5160

acaaactatg acaataaaaa aagttgcttt ttcccctttc tatgtatgtt ttttactagt 5220

catttaaaac gatacattaa taggtacgaa aaagcaactt tttttgcgct taaaaccagt 5280

cataccaata acttaagggt aactagcctc gccggcaata gttaccctta ttatcaagat 5340

aagaaagaaa aggatttttc gctacgctca aatcctttaa aaaaacacaa aagaccacat 5400

tttttaatgt ggtcttttat tcttcaacta aagcacccat tagttcaaca aacgaaaatt 5460

ggataaagtg ggatattttt aaaatatata tttatgttac agtaatattg acttttaaaa 5520

aaggattgat tctaatgaag aaagcagaca agtaagcctc ctaaattcac tttagataaa 5580

aatttaggag gcatatcaaa tgaactttaa taaaattgat ttagacaatt ggaagagaaa 5640

agagatattt aatcattatt tgaaccaaca aacgactttt agtataacca cagaaattga 5700

tattagtgtt ttataccgaa acataaaaca agaaggatat aaattttacc ctgcatttat 5760

tttcttagtg acaagggtga taaactcaaa tacagctttt agaactggtt acaatagcga 5820

cggagagtta ggttattggg ataagttaga gccactttat acaatttttg atggtgtatc 5880

taaaacattc tctggtattt ggactcctgt aaagaatgac ttcaaagagt tttatgattt 5940

atacctttct gatgtagaga aatataatgg ttcggggaaa ttgtttccca aaacacctat 6000

acctgaaaat gctttttctc tttctattat tccatggact tcatttactg ggtttaactt 6060

aaatatcaat aataatagta attaccttct acccattatt acagcaggaa aattcattaa 6120

taaaggtaat tcaatatatt taccgctatc tttacaggta catcattctg tttgtgatgg 6180

ttatcatgca ggattgttta tgaactctat tcaggaattg tcagataggc ctaatgactg 6240

gcttttataa tatgagataa tgccgactgt actttttaca gtcggttttc taatgtcact 6300

aacctgcccc gttagttgaa gaaggttttt atattacagc tccagatcta ggtgaagatc 6360

ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca 6420

gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc 6480

tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta 6540

ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgttctt 6600

ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc 6660

gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg 6720

ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg 6780

tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag 6840

ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc 6900

agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat 6960

agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg 7020

gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc 7080

tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt 7140

accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca 7200

gtgagcgagg aagcggaaga 7220

<210> 4

<211> 502

<212> PRT

<213> Bacillus licheniformis (Bacillus licheniformis)

<400> 4

Met Thr Val His Lys Ala Lys Met Thr Ile Asp Lys Glu Tyr Lys Val

1 5 10 15

Ala Glu Ile Asp Lys Arg Ile Tyr Gly Ser Phe Ile Glu His Leu Gly

20 25 30

Arg Ala Val Tyr Glu Gly Ile Tyr Glu Pro Asp His Pro Glu Ala Asp

35 40 45

Glu Ser Gly Phe Arg Lys Asp Val Ile Lys Leu Val Arg Glu Leu Lys

50 55 60

Val Pro Phe Ile Arg Tyr Pro Gly Gly Asn Phe Val Ser Gly Tyr Asn

65 70 75 80

Trp Glu Asp Gly Val Gly Pro Val Glu Gln Arg Pro Thr Arg Leu Asp

85 90 95

Leu Ala Trp Ala Thr Thr Glu Pro Asn Leu Ile Gly Thr Asn Glu Phe

100 105 110

Met Asp Trp Ala Lys Leu Val Gly Ala Glu Val Asn Met Ala Val Asn

115 120 125

Leu Gly Thr Arg Gly Ile Asp Ala Ala Arg Asn Leu Val Glu Tyr Cys

130 135 140

Asn His Pro Ser Gly Ser Tyr Tyr Ser Asp Leu Arg Lys Ser His Gly

145 150 155 160

Tyr Lys Glu Pro His Lys Ile Lys Thr Trp Cys Leu Gly Asn Glu Met

165 170 175

Asp Gly Pro Trp Gln Ile Gly His Lys Thr Ala Ala Glu Tyr Gly Arg

180 185 190

Leu Ala Ala Glu Ala Ala Lys Val Met Lys Trp Thr Asp Pro Ser Ile

195 200 205

Glu Leu Val Ala Cys Gly Ser Ser Gly Ser Gly Met Pro Thr Phe Ile

210 215 220

Asp Trp Glu Thr Thr Val Leu Asp His Thr Tyr Glu His Val Glu Tyr

225 230 235 240

Ile Ser Leu His Ser Tyr Tyr Gly Asn Arg Asp Asn Asp Leu Pro Asn

245 250 255

Tyr Leu Ala Arg Ser Leu Asp Met Asp His Phe Ile Lys Thr Val Ile

260 265 270

Ser Val Cys Asp Tyr Met Lys Ala Lys Lys Lys Ser Lys Lys Thr Ile

275 280 285

His Leu Ser Tyr Asp Glu Trp Asn Val Trp Tyr His Ser Asn Glu Lys

290 295 300

Asp Lys Glu Ala Glu Arg Trp Ala Lys Ala Pro His Leu Leu Glu Asp

305 310 315 320

Ile Tyr Asn Phe Glu Asp Ala Leu Leu Val Gly Cys Met Leu Ile Thr

325 330 335

Met Leu Lys His Ala Asp Arg Val Lys Ile Ala Cys Leu Ala Gln Leu

340 345 350

Val Asn Val Ile Ala Pro Ile Met Thr Asp Lys Gly Gly Glu Ala Trp

355 360 365

Arg Gln Thr Ile Phe Tyr Pro Phe Met His Ala Ser Val Tyr Gly Arg

370 375 380

Gly Thr Val Leu Gln Thr Ala Val Ser Ser Pro Lys Tyr Asp Ala Lys

385 390 395 400

Asp Phe Thr Asp Val Pro Tyr Leu Glu Ser Val Ser Val Phe Asn Glu

405 410 415

Glu Ala Glu Glu Leu Thr Val Phe Ala Val Asn Arg Ala Thr Asp Ala

420 425 430

Gly Leu Glu Met Glu Ala Asp Met Arg Ser Phe Glu Gly Tyr Ser Val

435 440 445

Ser Glu His Ile Val Leu Glu His Glu Asp His Lys Ala Thr Asn Glu

450 455 460

Lys Asp Arg Asn Asn Val Val Pro His Ser Gly Gly Asp Ala Lys Val

465 470 475 480

Cys Asp Gly Arg Leu Thr Ala His Leu Pro Lys Leu Ser Trp Asn Val

485 490 495

Ile Arg Met Lys Lys Gln

500

<210> 5

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atgaacacga ttaacatcgc taagaacgac 30

<210> 6

<211> 73

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

catgctgcag aaaagaagca ggtatggagg aacctgcttc tttttactat tacgcgaacg 60

cgaagtccga ctc 73

<210> 7

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atcgctgcag ctaacttata ggggtaacac ttaaaaaaga atc 43

<210> 8

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gtcgttctta gcgatgttaa tcgtgttcat attatggcct cctttggatc ccatttc 57

<210> 9

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gtttaacttt aagaaaggag gatataccat gagtaaaggc gaagaacttt tcac 54

<210> 10

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gcttcctttc gggctttgtt agcaggaatt cttatttgta tagttcatcc atgcc 55

<210> 11

<211> 59

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

taattttgtt taactttaag aaaggaggat ataccatgac tgtacacaaa gcgaagatg 59

<210> 12

<211> 69

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gccaactcag cttcctttcg ggctttgtta gcaggaattc ttattgtttc ttcattctga 60

tcacattcc 69

Claims

1. A bacillus subtilis expression system, comprising: the Bacillus subtilis expression system was established by inserting the xylose-induced T7RNA polymerase expression system at the aprE site of the Bacillus subtilis genome.

2. The Bacillus subtilis expression system of claim 1, wherein: the bacillus subtilis is a mutant strain 164S derived from industrial bacillus subtilis ATCC6051a, obtained by integrating one copy of the comk expression cassette at the nprE site of 6051 a.

3. The expression system of the industrial production strain Bacillus subtilis 164 of claim 1, wherein: the DNA sequence of the T7RNA polymerase expression system is shown as SEQ ID NO. 1.

4. Use of a bacillus subtilis expression system according to any one of claims 1-3 for bioconversion or expression of an enzyme protein.

5. The use of claim 4, wherein: the enzyme protein is alpha-L-arabinofuranosidase.

6. A method for producing alpha-L-arabinofuranosidase by a bacillus subtilis expression system comprises the following steps:

7. The method of producing α -L-arabinofuranosidase using a bacillus subtilis expression system of claim 6, wherein: the DNA sequence of plasmid pMK4-T7-arbf in step 1 is shown in SEQ ID NO 3.

8. The method of producing α -L-arabinofuranosidase using a bacillus subtilis expression system of claim 6, wherein: the amino acid sequence of the alpha-L-arabinofuranosidase in the step 1 is shown as SEQ ID NO. 4.

9. The method of producing α -L-arabinofuranosidase using a bacillus subtilis expression system of claim 6, wherein: and in the step 3, the bacillus subtilis T7-arbf is subjected to fermentation culture in an LB culture medium under the induction of xylose, xylan or bran.

10. The method for producing alpha-L-arabinofuranosidase by using the Bacillus subtilis expression system of claim 6, wherein the Bacillus subtilis T7-arbf fermentation culture medium comprises: LB medium + 3% (m/V) bran.