CN106591344A - Escherichia coli thermally-induced soluble protein expression vector fused with molecular chaperone label and application thereof - Google Patents
Escherichia coli thermally-induced soluble protein expression vector fused with molecular chaperone label and application thereof Download PDFInfo
- Publication number
- CN106591344A CN106591344A CN201611204213.1A CN201611204213A CN106591344A CN 106591344 A CN106591344 A CN 106591344A CN 201611204213 A CN201611204213 A CN 201611204213A CN 106591344 A CN106591344 A CN 106591344A
- Authority
- CN
- China
- Prior art keywords
- protein
- expression vector
- coli
- expression
- label
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/35—Fusion polypeptide containing a fusion for enhanced stability/folding during expression, e.g. fusions with chaperones or thioredoxin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/101—Plasmid DNA for bacteria
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses an escherichia coli thermally-induced soluble protein expression vector pBVTH fused with a molecular chaperone label. The escherichia coli thermally-induced soluble protein expression vector is prepared by cloning a nucleotide sequence with two codes and six histidine, an initiation factor gene derived from escherichia coli and a protein enzyme digestion site of HRV (Human Totavirus) 3C Protease, and one section of a multiple-cloning site segment to an escherichia coli thermally-induced expression vector pBV220; and the nucleotide sequence is shown as SEQ ID No.1. The invention further discloses application of the expression vector to preparation of fusion protein. An experiment proves that target genes are recombined to a multiple-cloning site of the vector through a gene cloning manner; and under an induction condition of 42 DEG C, a target protein and a label protein are fused and expressed, and an initiation factor expresses a molecular chaperone function, so that the solubility of the target protein can be remarkably improved. The carrier disclosed by the invention can be widely applied to expression of the target gene and improvement of the solubility of the target protein, and can be widely applied to protein researches in the fields including molecular biology, biochemistry, medical treatment and the like.
Description
Technical field
The present invention relates to genetic engineering field, is specifically related to a kind of escherichia coli thermal induction of fusion molecule companion label
Soluble protein expression vector and its application.
Background technology
In various expression systems, it is used that studied is escherichia expression system earliest, and grasps at present
Expression system the most ripe, escherichia expression system are relatively simple with the quick yield height of its cell proliferation, IPTG abduction deliverings
Just the advantages of, becomes the most frequently used system of production recombiant protein.
For different albumen are expressed, need using different carriers.The colibacillary expression vector being currently known can
It is divided into two kinds of non-fused type expression vector and Fusion expression carrier.Non-fusion expression is that exogenous gene is inserted into expression vector is strong
Promoter and effective ribosome binding site sequence downstream, as initiation of translation, expression product is in sequence for the AUG with external source gene mRNA
It is consistent with natural destination protein on row.Amalgamation and expression is by destination protein or polypeptide and another protein or polypeptide fragment
DNA sequence is melted and is incorporated in expression in thalline.The carrier of Fusion expression includes secretion expression carrier, the expression of zone purification label is carried
Body, surface are presented expression vector, the expression vector with companion.Genes of interest is expressed using escherichia coli as Host Strains and a large amount of
Obtain the important component part that destination protein is modern biotechnology.Resulting albumen can be used to carry out functional study, make
To catalyze and synthesize the enzyme of the product with important value, it is also possible to the treatment of disease is directly used in as pharmaceutical grade protein.
Whether the correct folding of foundation protein three-dimensional structure, and expressed albumen can be divided into soluble protein and inclusion body
Albumen.Wherein correctly fold and the protein form for being soluble protein, being required for people of holding biologic activity.And mistake
Fold, coagulation in the cell, inactive solid protein granule insolubility albumen are inclusion bodys.Inclusion bodies are made
Albumen is presented water solublity and biologic activity, needs to carry out the process of degeneration and renaturation.The process of this degeneration and renaturation is time-consuming,
It is loaded down with trivial details, and easily cause the loss of protein yield, it is often more important that the activity of albumen can drastically be reduced or even be completely lost.
In view of the importance of albumen solubility property, increase destination protein is expressed as the ratio of soluble protein component to be become
Important process in molecular biology and biochemical research.Research shows that following methods are favorably improved destination protein solubility
Expression：1. the speed of albumen synthesis is reduced.Can be realized by the following method：A. reduce cultivation temperature b. and use weak promoter c.
The concentration of inducer is reduced using the plasmid expression vector d. of low copy number.2. adding in changing culture medium .a. culture medium can be with
Help factor b. of protein folding to add buffer to keep the stable c. of pH to add 1% glucose, suppress lac promoteres d. to add
Sorbitol etc. can be stablized factor e. of albumen natural structure and add ethanol.3. with molecular chaperoneses or folding enzymes amalgamation and expression.
Conventional molecular chaperoneses have：GroES-GroEL DnaK-DnaJ-GrpE ClpB.Conventional folding enzymes have：PPI's、DsbA、
DsbC、PDI.4. secreting, expressing.Destination protein is made to be secreted into periplasmic space, the environmental benefits of the oxidisability of periplasmic space are in two sulfur
The formation of key, and intracellular is then reproducibility.Periplasmic space has the presence of folding enzymes DsbA and DsbC, helps albumen correctly to roll over
It is folded.Periplasmic space will not be hydrolyzed seldom with the presence of protease.Can make to there is the virose albumen of cell in a large number.5. make
Use specific bacterial strain.6. with solubility partner amalgamation and expression.7. a fragment of express express target protein.8. external unfolding,
Again fold.
Albumen of the molecular chaperoneses startup factor of escherichia coli (Escherichia coli) for 48.2KD, research have shown that to open
Reason can be effectively facilitated target protein and correctly fold and increase its solubility, and its mechanism of action is：1. in the conjunction of new polypeptide chain
Into with hydrophobic region protection new polypeptide chain for being grown with which in initial folding process, 2. accelerate peptide cis-trans propyl isomerism.Generally
It is that, by chaperone gene and destination protein gene cloning on different plasmids, two plasmids are coexisted in the cell, and Jing is not
Same derivant induces cloned gene expression.But there is step of converting is loaded down with trivial details, the wayward, protein purification of expression is difficult etc.
Problem.And general general purpose I PTG induction, expression condition also needs to many experiments and gropes, relatively costly.
Jing is retrieved, by by the nucleotide sequence of two codings, six histidine, from colibacillary startup factor
Gene, HRV 3C Protease protease cutting sites and one section are cloned into greatly for cloning the multiple clone site fragment for using
Enterobacteria thermal induction Expression Vectors pBV220 is obtained a kind of coli heat inducing soluble albumen of fusion molecule companion label
Expression vector, and document or patent that the expression vector is used to prepare fusion protein are had not been reported.
The content of the invention
In order to solve the deficiency of prior art presence, the invention provides a kind of escherichia coli of fusion molecule companion label
Thermal induction soluble protein expression vector and its application.
The coli heat inducing soluble protein expression vector of fusion molecule companion label of the present invention, its feature
It is：The soluble protein expression vector is named as pBVTH, and it is the nucleotides sequence by six histidine are encoded two
Arrange, make for cloning from colibacillary startup factor gene, HRV 3C Protease protease cutting sites and one section
Multiple clone site fragment is cloned into coli heat inducible expression carrier pBV220 and is obtained；Its nucleotide sequence such as SEQ ID
Shown in No.1.
The coli heat inducing soluble protein expression vector of above-mentioned fusion molecule companion label builds structure collection of illustrative plates such as
Shown in Fig. 1, wherein comprising following gene, promoter and other element sequences：Ampicillin resistance (Ampr)；Plasmid replication origins
(ori)；Lambda phage expression suppressor genes (cIts857)；From PR the and PL promoteres of the series connection in lambda phagies
(PrPl)；Shine-Dalgarno sequences (SD)；Ribosome rrnB genes (rrnB)；Molecular chaperone (trigger
Factor, tf)；Two hexahistidine tag albumen (His Tag) sequences；Gene multiple clone site (MCS)；Containing HRV 3C
Protease, Thrombin protease cutting site.
In above-mentioned expression vector, the label protein of two codings, six histidine can be used for affinity chromatograph to separate fusion egg
Albumen after white or shearing.
In above-mentioned expression vector, startup factor plays the function of chaperone and destination protein can be promoted correctly to fold and make
Presentation solubility state.
In above-mentioned expression vector, described HRV 3C Protease protease may act on molecular chaperoneses and destination protein
Between specific cleavage site, molecular chaperoneses are separated with destination protein.
The coli heat inducing soluble protein expression vector construction method of above-mentioned fusion molecule companion label, step
It is：
With GenBank accession number as GI:802133627 E.coli K-12 genomic DNA as template, with TP1 and TP2
The molecular chaperone of 1305bp is amplified for primer PCR, is connected in 16 DEG C with pGEM Teasy carriers after recovery, connection product
The competent cell of Transformed E .coli DH5 α, the screening weight on the LB flat boards containing IPTG, X-gal containing 50 μ g/ml ammonia benzyl mycins
Group clone；Plasmid is named as pTT1305 Jing after enzyme action and sequence verification are correct；Wherein：
TP1：5′-CCGGAATTCATGCACCATCATCATCATCAC-3′
TP2：5′-CCGGAATTCCGCCTGCTGGTTCATCAGCTT-3′
By the pTT1305 for extracting with EcoRI enzyme action, recovery product is connected with EcoRI enzyme action pBV220 carrier recovery products
Connect, the competent cell of Transformed E .coli DH5 α, recombinant clone is screened on the LB flat boards containing 50 μ g/ml ammonia benzyl mycins；Survey
Sequence, selects the positive insertion recombinant clones of trigger factor, is named as pBVT；
Synthetic HRV 3C Protease-His Tag-Thrombin- multiple clone site (MCS)-Thrombin-His
Tag nucleotide fragments, the fragment nucleotide sequence is as shown in SEQ ID No.2, wherein 5 ' end introducing EcoRI restriction enzyme sites, 3 '
End introduces PstI restriction enzyme sites；With the carrier of EcoRI, PstI enzyme action fragment, recovery product and EcoRI, PstI enzyme action pBVT
Recovery product is connected, the competent cell of Transformed E .coli DH5 α, screens on the LB flat boards containing 50 μ g/ml ammonia benzyl mycins
Recombinant clone；Enzyme action, sequencing are verified recombinant clone, that is, obtain the coli heat inducing soluble of fusion molecule companion's label
Protein expression vector, is named as pBVTH, and its nucleotide sequence is as shown in SEQ ID No.1.
The coli heat inducing soluble protein expression vector of fusion molecule companion label of the present invention melts in preparation
Application in hop protein.
Wherein：The method of the expression vector expressed fusion protein is, by genes of interest fragment is cloned into pBVTH,
The expressed fusion protein Jing after under the conditions of 42 DEG C；After fusion, the affine nickel column chromatography of albumen nickel is obtained, and further uses HRV 3C
Protease enzymes eliminate the molecular chaperone protein on fusion protein, then with affinity purification, ion-exchange purification or molecular sieve purification
It is consummate that mode carries out destination protein.
To increase the practicality of above-mentioned expression vector, can be by genes of interest orientation restructuring to carrier using double digestion mode
And then express, multiple cloning sites are present invention employs, including：BamHI、KpnI、NdeI、SacI、SalI、SmaI、XbaI、
XhoI.The molecular chaperoneses fusion tag e. coli protein expression vector pBVTH of this patent has good Immune Clone Selection, almost
Any gene can be carried out cloning and express.
Invention provides a kind of utilization thermal induction mode and carries out the carrier of soluble protein expression.Using being derived from
Escherichia coli molecular chaperoneses startup factor (trigger factor) and six histidine (His Tag) are led to as fusion tag
Gene cloning means are crossed, genes of interest is recombinated to the multiple clone site of carrier, under 42 DEG C of inductive conditions, destination protein and label
Protein fusion expression, startup factor play molecular chaperone function, realize the solubility for improving target protein.
The advantage of the molecular chaperoneses pattern of fusion e. coli protein expression vector pBVTH described in this patent is：
1st, clone of the multiple clone site beneficial to genes of interest.
2nd, using thermal induction expression way, 42 DEG C of single temperature, it is not necessary to grope other derivants (such as IPTG) and lure
The expression conditions such as concentration, time are led, it is easier.
3rd, molecular chaperone and genes of interest co expression, it is ensured that dosage effect.
4th, His Tag and Thrombin protease cutting sites are separately added at genes of interest insertion point two ends, after convenience
The removal of continuous destination protein purification work and label protein.
5th, the action site of HRV 3C Protease protease is designed between molecular chaperoneses and genes of interest, so may be used
Destination protein is cut out from fusion protein by HRV 3C Protease protease.Highly active HRV 3C Protease eggs
White enzyme can be made by oneself in laboratory, and this just greatly reduces the cost of Protein expression and purification.
Test confirms：From the preferred embodiment of the Lp-PLA genes of people, expression shows that pBVTH has what is made well
Genes of interest is mainly shown as the ability of soluble protein.Highly soluble is expressed as follow-up Protein Separation, zymologic property and grinds
Study carefully and catalytic applications etc. have established solid foundation.
Description of the drawings
Fig. 1：Coli heat induced protein expression vector of the molecular chaperoneses of 5142 base pairs as fusion tag
The plasmid map of pBVTH.Wherein：
Ampr is ampicillin resistance；
Ori is Plasmid replication origins；
CIts857 is lambda phage expression suppressor genes, but genes of interest can be expressed under the conditions of thermal induction；
PrPl comes from PR the and PL promoteres of the series connection of lambda phagies, it is ensured that the high level expression of gene；
SD is Shine-Dalgarno sequences；
RrnB is ribosome rrnB genes, is genetic transcription termination signal；
Trigger factor are the open reading frame sequences of molecular chaperone (trigger factor, tf)；
His Tag are hexahistidine tag albumen；
MCS is gene multiple clone site, is limited comprising BamHI, KpnI, NdeI, SacI, SalI, SmaI, XbaI, XhoI
Property restriction enzyme site.
Fig. 2：Molecular chaperoneses-Lp-PLA2 fused antigen SDS-PAGE collection of illustrative plates is expressed in pBVTH-PLA2 thermal inductions.Wherein：
1. protein molecular weight standard, size are shown in left side；
2.pBVTH-PLA2 the soluble protein of the non-abduction delivering of expression strain E.coli Rosetta (DE3)；
The soluble protein of 3.pBVTH-PLA2 expression strain E.coli Rosetta (DE3) 42 DEG C of abduction deliverings.
Fig. 3 pET28a-PLA2 difference IPTG concentration abduction delivering Lp-PLA2 antigen SDS-PAGE collection of illustrative plates.Wherein：
M. protein molecular weight standard, size are shown in left side；
The inclusion body protein of the non-abduction deliverings of 1.pET28a-PLA2 expression strains E.coli Rosetta (DE3)；
2.pET28a-PLA2 expression strains E.coli Rosetta (DE3) is with the bag of 0.2mM IPTG concentration abduction deliverings
Contain body protein；
3.pET28a-PLA2 expression strains E.coli Rosetta (DE3) is with the bag of 0.3mM IPTG concentration abduction deliverings
Contain body protein；
4.pET28a-PLA2 expression strains E.coli Rosetta (DE3) is with the bag of 0.5mM IPTG concentration abduction deliverings
Contain body protein；
5.pET28a-PLA2 expression strains E.coli Rosetta (DE3) is with the bag of 1.0mM IPTG concentration abduction deliverings
Contain body protein.
The SDS-PAGE collection of illustrative plates of Fig. 4 Lp-PLA2 genes and molecular chaperone amalgamation and expression purification.Wherein：
M. protein molecular weight standard, size are shown in left side；
1.HRV 3C Protease protease；
The soluble protein nickel of 2.Lp-PLA2 gene expressions bacterial strain E.coli Rosetta (DE3)/pBVTH abduction deliverings
After column purification；
3. molecular chaperoneses and Lp-PLA2 fusion protein are with after HRV 3C Protease protease enzyme action；
After 4.Lp-PLA2 albumen molecular sieve purification.
Specific embodiment
The term for being used in the present invention, unless otherwise specified, typically has those of ordinary skill in the art usual
The implication of understanding.
With reference to specific embodiment, and the present invention is described in further detail with reference to data.It should be understood that these enforcements
Example is of the invention solely for the purpose of illustration, rather than limits the scope of the present invention by any way.Below in an example, not in detail
The various processes and method of thin description are conventional methods as known in the art.The source of agents useful for same, trade name and have must
List its constituent person, indicate when occurring first, identical reagent used thereafter if no special instructions, marking first
Bright content is identical.In embodiment, used bacterial strain and plasmid, are published bacterial strain and plasmid.
1.E.coli K-12.Genome of E.coli is sequenced bacterial strain.
2.E.coli DH5α.Gene cloning Host Strains.Purchased from Sangon Biotech (Shanghai) Co., Ltd..
3.E.coli Rosetta(DE3).Protein expression Host Strains.Purchased from Stratagen companies of the U.S..Protein expression is big
Enterobacteria bacterial strain is not limited to Rosetta, preferred Rosetta in this patent.
4.pGEM T easy vector.T cloning vehicles are purchased from Promega companies.
5.pBV220vector.Coli expression carrier.Purchased from Beijing DingGuo ChangSheng Biology Technology Co., Ltd.
6.pET28a vector.Coli expression carrier.Purchased from Novagen companies.
Structure of 1. molecular chaperoneses of embodiment as the e. coli protein expression vector pBVTH of fusion tag
1.1 molecular chaperones are cloned
With E.coli K-12 genomic DNA as template, with TP1 and TP2 as primer PCR amplify the startup of 1305bp because
Subbase because.The GenBank accession number of genome of E.coli sequence is GI:802133627.Pcr amplification product reclaim after with
PGEM T easy vector connect in 16 DEG C, the competent cell of connection product Transformed E .coli DH5 α, containing 50 μ g/ml
The LB of ammonia benzyl mycin screens recombinant clone on the flat board containing IPTG, X-gal.Plasmid is named Jing after enzyme action and sequence verification are correct
For pTT1305.
(1) primer sequence is as follows：
TP1：5′-CCGGAATTCATGCACCATCATCATCATCAC-3′
TP2：5′-CCGGAATTCCGCCTGCTGGTTCATCAGCTT-3′
(2) recovery of PCR and target DNA
The system of PCR amplifications is carried out according to Takara PrimeSTAR HS DNA Polymerases description
PCR reacts：First in 95 DEG C of degenerative treatments 5min, the condition of circulation is：95 DEG C of 60s, 55 DEG C of 40s, 72 DEG C
1min20s, totally 35 circulations.It is last to extend 5min at 72 DEG C.Using the PCR instrument that instrument is Bio-rad companies.
(3) glue reclaim of PCR primer：The gel reclaims kit of Dalian treasured biotech firm is carried out.
(4) T cloning vehicles connection：Carry out according to Promega pGEM T easy vector description.
(5) convert：In superclean bench, with sterile pipette tip draw 100ul competent cells (competent cell according to
《Molecular cloning》The method of (Science Press, the third edition) is carried out) suspension, in Eppendorf, adds above-mentioned connection product
10ul, is gently vortexed and mixes, ice bath 30 minutes.Place in being immediately transferred to 42 DEG C of water-baths 2 minutes, often pipe addition 0.5ml LB trainings
Foster base, 37 DEG C of incubator shaken cultivation 60 minutes to be drawn and (contain antibiotic) in culture fluid coating and LB culture medium, put 37 DEG C of incubators and fall
Put overnight incubation.
(6) screening of positive recombinant：Monoclonal bacterium colony in the plate of the above-mentioned overnight incubation of each picking, is inoculated in 5ml
In LB fluid mediums (contain antibiotic), 37 DEG C of incubator shaken cultivation 5 hours.Preserve each monoclonal bacterium solution and extract plasmid and (press
According to《Molecular cloning》The method of (Science Press, the third edition) is carried out).Plasmid after extraction EcoRI enzyme action, digestion products are used
Agarose gel electrophoresiies carry out identifying and sequence verification.
The structure of 1.2 coli expression carrier pBVT
By pTT1305 with EcoRI enzyme action after, reclaim containing molecular chaperone DNA fragmentation with EcoRI enzyme action
PBV220 is connected, the competent cell of 5 α of connection product Transformed E .coli, sieves on the LB flat boards containing 50 μ g/ml ammonia benzyl mycins
Select recombinant clone.Plasmid is named as pBVT Jing after enzyme action, sequence verification are correct.The structure of 1.3 coli expression carrier pBVTH
Build
Synthetic HRV 3C Protease-His Tag-Thrombin- multiple clone site (MCS)-Thrombin-His
Tag nucleotide fragments, as shown in SEQ ID No.2, (5 ' ends introduce EcoRI restriction enzyme sites to the fragment nucleotide sequence, and 3 ' ends are drawn
Enter PstI restriction enzyme sites), by Jinan, Bo Shang biotech firms complete.With EcoRI, PstI enzyme action fragment, recovery product with
The carrier recovery product of EcoRI, PstI enzyme action pBVT is connected, the competent cell of Transformed E .coli DH5 α, containing 50 μ g/
Recombinant clone is screened on the LB flat boards of ml ammonia benzyl mycins；Enzyme action, sequencing are verified recombinant clone, are named as pBVTH.
PBVTH is the molecular chaperoneses in this patent and His Tag as the coli heat abduction delivering of fusion tag
Soluble protein carrier, its nucleotide sequence is as shown in SEQ ID No.1.
The amalgamation and expression of embodiment 2.Lp-PLA2 gene and molecular chaperone
2.1 PCR amplifications obtain genes of interest
CDNA library (Shandong Lab Biological Science ＆ Technology Co., Ltd.'s preparation) with people expands the base of Lp-PLA2 mesh as template
Because of fragment, primer sequence sees below, and 50ul reaction systems are as follows, the identification of 1.0% agarose gel electrophoresiies, purifies examination with DNA fragmentation
Agent box carries out purification to PCR primer.
Primer1：GGAATTCCATATTTTGACTGGCAATACATA
Primer2：ACGCGTCGACATTGTATTTCTCTATTCC
The structure of 2.2 people's Lp-PLA2 antigen presentation plasmids
(1) recombined human Lp-PLA2 antigen gene sequences and thermal induction expression vector pBVTH and IPTG inducible expression carrier
The double digestion of pET28a
Take above pcr gene recovery product and pBVTH (invention), pET28a expression vector 30ul are respectively placed in
In 1.5ml Eppendorf centrifuge tubes, 10 × buffer 5ul, NdeI (10U/ul) and each 3ul of SalI (10U/ul) are added, plus
Enter sterile purified water 4ul, put 37 DEG C of water-bath enzyme action 3 hours.The agarose gel electrophoresiies purification of digestion products and recovery：Lp-
After PLA2 genes and pBVTH, pET28a expression vector double digestion, product is said according to TaKaRa DNA gel QIAquick Gel Extraction Kit products
Bright book is carried out.
(2) connect：Add in sterilizing Eppendorf centrifuge tubes the carrier after above-mentioned enzyme action and each 2ul of genes of interest, 10
× T4 DNA Ligase buffer 2ul, T4DNA Ligase (5U/ul) 1ul, add sterile purified water to 20ul, put 16 DEG C
Overnight.
(3) convert：In superclean bench, (competence is thin to draw 100ul Rosetta competent cells with sterile pipette tip
Born of the same parents according to《Molecular cloning》The method of (Science Press, the third edition) is carried out) suspension, in Eppendorf, adds above-mentioned connection
Product 10ul, is gently vortexed and mixes, ice bath 30 minutes.Place in being immediately transferred to 42 DEG C of water-baths 2 minutes, often pipe addition 0.5ml
LB culture medium, 37 DEG C of incubator shaken cultivation 60 minutes to be drawn and (contain antibiotic) in culture fluid coating and LB culture medium, put 37 DEG C it is warm
Carton upside down overnight incubation.
(4) screening of positive recombinant：Monoclonal bacterium colony in the plate of the above-mentioned overnight incubation of each picking, is inoculated in 5ml
In LB fluid mediums (contain antibiotic), 37 DEG C of incubator shaken cultivation 5 hours.Preserve each monoclonal bacterium solution and extract plasmid and (press
According to《Molecular cloning》The method of (Science Press, the third edition) is carried out).Plasmid after extraction NdeI and SalI enzyme action, enzyme action
Product is identified with agarose gel electrophoresiies.
The expression and purification of 2.3 people's Lp-PLA2 antigens
2.3.1 the culture and induction of recombinant molecule companion people Lp-PLA2 fused antigen expression strains：
(1) recovery strain pBVTH-PLA2, take -20 DEG C of refrigerators strain be inoculated in 20ml LB culture medium (ammonia benzyl mycin resist
Property, Amp+) in shaking flask, 30 DEG C of overnight incubations.
(2) it is inoculated in the big shaking flask of LB culture medium (Amp+) according to 0.01% inoculum concentration, 30 DEG C of overnight incubations are secondary
Day, survey bacterium solution OD600When=0.5～0.8,42 DEG C, 200～240rpm, inducing culture 5～8 hours.
(3) thalline and smudge cellses are collected by centrifugation, 12000rpm is centrifuged, be centrifuged 10 minutes, abandon precipitation and take containing solvable point
The supernatant of sub- companion people Lp-PLA2 fusion antigen proteins.Expression of results is shown in Fig. 2.
2.3.2 purification：Above-mentioned solubilization of inclusion bodies liquid is first used the affine nickel column chromatography preliminary purification of nickel.
2.3.3 the culture and induction of people Lp-PLA2 antigen presentations bacterial strain：
(1) recovery strain pET28a-PLA2, the strain for taking -20 DEG C of refrigerators are inoculated in 20ml LB culture medium (kanamycin
Resistance, Kan+) in shaking flask, 37 DEG C of overnight incubations.
(2) it is inoculated in the big shaking flask of LB culture medium (kan+) according to 1% inoculum concentration, 37 DEG C of overnight incubations, next day, surveys
During bacterium solution OD600=0.5～0.8,37 DEG C, addition IPTG to final concentration of 0.2mM, 0.3mM, 0.5mM, 1.0mM, 37 DEG C, 200
～240rpm, inducing culture 5～8 hours.
(3) thalline and smudge cellses are collected by centrifugation, 12000rpm is centrifuged, be centrifuged 10 minutes, collect inclusion body.Expression of results
See Fig. 3
Contrast Fig. 2, Fig. 3 is it is found that molecular chaperoneses-Lp-PLA2 fused antigens insertion pBVTH expression vectors exist
Can be 99kD or so with soluble protein form great expression, molecular weight under the conditions of 42 DEG C of Rosetta bacterial strains, and with independent Lp-
PLA2 inserts pET28a carriers in Rosetta bacterial strains by adjusting IPTG concentration, in the purpose Lp-PLA2 albumen of 45kD or so
Position also only has pole weak expression, and only in inclusion body with the presence of induced protein.
Above description of test, the pBVHT protein expression vectors that this patent builds have general common protein expression vector
Not available advantage of expression, can efficiently be carried out foreign protein and be expressed with soluble form in Bacillus coli cells.
The polishing purification of embodiment 3.Lp-PLA2 recombinant antigen
The recombinant molecule companion people Lp-PLA2 fused antigens that embodiment 2 is obtained and HRV-3C prolease (Shandong Lays
Rich bio tech ltd) according to concentrations by weight, i.e. HRV-3C prolease：Fusion protein=1：10 ratio enzyme action
Overnight, while the pH for adjusting enzyme action buffer is 7.5.The affine nickel column chromatography of protein solution nickel after enzyme action is crossed into post, is received
Collection wash-out protein.Again through molecular sieve (GE companies superdex75) purification, 45kD protein peaks are collected.The albumen for obtaining as may be used
Dissolubility Lp-PLA2 albumen, and identified with SDS-PAGE.As a result see Fig. 4.
By above description of test, by the albumen of pBVTH vector expressions, can be by removing label protein and affine pure
The modes such as change, ion-exchange purification, molecular sieve purification carry out the consummate operation of destination protein such that it is able to be preferably applied to point
The fields such as sub- biology, biochemistry, medical treatment.
Sequence table
<110>Zhu's is bright
<120>A kind of coli heat inducing soluble protein expression vector of fusion molecule companion label and its application
<141> 2016-12-15
<160> 2
<210> 1
<211> 5142
<212> DNA
<213>Artificial sequence
<221>The coli heat inducing soluble protein expression vector pBVTH of fusion molecule companion's label
<222>（1）…（5142）
<400>1
gaattcatgc accatcatca tcatcaccaa ggccttggcc gccgtgtaac gattactatc 60
gctgctgaca gcatcgagac cgctgttaaa agcgagctgg tcaacgttgc gaaaaaagta 120
cgtattgacg gcttccgcaa aggcaaagtg ccaatgaata tcgttgctca gcgttatggc 180
gcgtctgtac gccaggacgt tctgggtgac ctgatgagcc gtaacttcat tgacgccatc 240
attaaagaaa aaatcaatcc ggctggcgca ccgacttatg ttccgggcga atacaagctg 300
ggtgaagact tcacttactc tgtagagttt gaagtttatc cggaagttga actgcagggt 360
ctggaagcga tcgaagttga aaaaccgatc gttgaagtga ccgacgctga cgttgacggc 420
atgctggata ctctgcgtaa acagcaggcg acctggaaag aaaaagacgg cgctgttgaa 480
gcagaagacc gcgtaaccat cgacttcacc ggttctgtag acggcgaaga gttcgaaggc 540
ggtaaagcgt ctgatttcgt actggcgatg ggccagggtc gtatgatccc gggctttgaa 600
gacggtatca aaggccacaa agctggcgaa gagttcacca tcgacgtgac cttcccggaa 660
gaataccacg cagaaaacct gaaaggtaaa gcagcgaaat tcgctatcaa cctgaagaaa 720
gttgaagagc gtgaactgcc ggaactgact gcagaattca tcaaacgttt cggcgttgaa 780
gatggttccg tagaaggtct gcgcgctgaa gtgcgtaaaa acatggagcg cgagctgaag 840
agcgccatcc gtaaccgcgt taagtctcag gcgatcgaag gtctggtaaa agctaacgac 900
atcgacgtac cggctgcgct gatcgacagc gaaatcgacg ttctgcgtcg ccaggctgca 960
cagcgtttcg gtggcaacga aaaacaagct ctggaactgc cgcgcgaact gttcgaagaa 1020
caggctaaac gccgcgtagt tgttggcctg ctgctgggcg aagttatccg caccaacgag 1080
ctgaaagctg acgaagagcg cgtgaaaggc ctgatcgaag agatggcttc tgcgtacgaa 1140
gatccgaaag aagttatcga gttctacagc aaaaacaaag aactgatgga caacatgcgc 1200
aatgttgctc tggaagaaca ggctgttgaa gctgtactgg cgaaagcgaa agtgactgaa 1260
aaagaaacca ctttcaacga gctgatgaac cagcaggcgg gattcctgga agttctgttc 1320
caggggcccc atcatcatca tcatcacatg ggcagcagcc accaccacca ccaccacagc 1380
agcggcctgg tgccgcgcgg cagccatggc ggatccggta cccatatgga gctcgtcgac 1440
cccgggtcta gactcgagct ggtgccgcgc ggcagccacc accaccacca ccactaactg 1500
cagaccaagc ttctgttttg gcttatgaga gaagattttc agcctgatac agattaaatc 1560
agaacgcaga agcggtctga taaaacagaa tttgcctccc ggcagtagcg cggtggtccc 1620
acctgacccc atgccgaact cagaagtgaa acgccgtagc gccgatggta gtgtggggtc 1680
tccccatgcg agagtagcca actgccaggc atcaaataaa acgaaaggct cagtcgaaag 1740
actgggcctt tcgttttatc tgttgtttgt cggtgaacgc tctcctgagt aggacaaatc 1800
cgccgggagc ggatttgaac gttgcgaagc aacggcccgg agggtggcgg gcaggacgcc 1860
cgccataaac tgccaggcat caaaggaatc agaaggccat cctgacggat ggcctttttg 1920
cgtttctaca aactctttgt ttatttttct aaatacattc aaatatgtat ccgctcatga 1980
gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac 2040
atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc 2100
cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca 2160
tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc 2220
caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt gttgacgccg 2280
ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac 2340
cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca 2400
taaccatgag tgataacact gcggccaact tacttctgac aacgatcggg aggaccgaag 2460
gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga tcgttgggaa 2520
ccggatctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg 2580
gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc ccggcaacaa 2640
ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc ggcccttccg 2700
gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt 2760
gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac gacggggagt 2820
caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc actgattaag 2880
cattggtaac tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat 2940
ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct 3000
taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct 3060
tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca 3120
gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc 3180
agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc 3240
aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct 3300
gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag 3360
gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc 3420
tacaccgaac tgagatacct acagcgtgag cattgagaaa gcgccacgct tcccgaaggg 3480
agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg cacgagggag 3540
cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca acctctgact 3600
tgagcgtcga ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac 3660
gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt ctttcctgcg 3720
ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga taccgctcgc 3780
cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga gcgcccttat 3840
ctttcccttt atttttgctg cggtaagtcg cataaaaacc attcttcata attcaatcca 3900
tttactatgt tatgttctga ggggagtgaa aattccccta attcgatgaa gattcttgct 3960
caattgttat cagctatgcg ccgaccagaa caccttgccg atcagccaaa cgtctcttca 4020
ggccactgac tagcgataac tttccccaca acggaacaac tctcattgca tgggatcatt 4080
gggtactgtg ggtttagtgg ttgtaaaaac acctgaccgc tatccctgat cagtttcttg 4140
aaggtaaact catcaccccc aagtctggct atgcagaaat cacctggctc aacagcctgc 4200
tcagggtcaa cgagaattaa cattccgtca ggaaagcttg gcttggagcc tgttggtgcg 4260
gtcatggaat taccttcaac ctcaagccag aatgcagaat cactggcttt tttggttgtg 4320
cttacccatc tctccgcatc acctttggta aaggttctaa gcttaggtga gaacatccct 4380
gcctgaacat gagaaaaaac agggtactca tactcacttc taagtgacgg ctgcatacta 4440
accgcttcat acatctcgta gatttctctg gcgattgaag ggctaaattc ttcaacgcta 4500
actttgagaa tttttgcaag caatgcggcg ttataagcat ttaatgcatt gatgccatta 4560
aataaagcac caacgcctga ctgccccatc cccatcttgt ctgcgacaga ttcctgggat 4620
aagccaagtt catttttctt tttttcataa attgctttaa ggcgacgtgc gtcctcaagc 4680
tgctcttgtg ttaatggttt cttttttgtg ctcatacgtt aaatctatca ccgcaaggga 4740
taaatatcta acaccgtgcg tgttgactat tttacctctg gcggtgataa tggttgcatg 4800
tactaaggag gttgtatgga acaacgcata accctgaaag attatgcaat gcgctttggg 4860
caaaccaaga cagctaaaag atctctcacc taccaaacaa tgcccccctg caaaaaataa 4920
attcatataa aaaacataca gataaccatc tgcggtgata aattatctct ggcggtgttg 4980
acataaatac cactggcggt gatactgagc acatcagcag gacgcactga ccaccatgaa 5040
ggtgacgctc ttaaaaatta agccctgaag aagggcagca ttcaaagcag aaggctttgg 5100
ggtgtgtgat acgaaacgaa gcattggtta aaaattaagg ag 5142
<210> 2
<211> 204
<212> DNA
<213>Artificial sequence
<221>The HRV 3C Protease-His Tag-Thrombin-MCS-Thrombin- of TAA terminators are added at 3 ' ends
His Tag nucleotide fragments
<222>（1）…（204）
<400>2
gaattcctgg aagttctgtt ccaggggccc catcatcatc atcatcacat gggcagcagc 60
caccaccacc accaccacag cagcggcctg gtgccgcgcg gcagccatgg cggatccggt 120
acccatatgg agctcgtcga ccccgggtct agactcgagc tggtgccgcg cggcagccac 180
caccaccacc accactaact gcag 204
Claims (4)
1. a kind of coli heat inducing soluble protein expression vector of fusion molecule companion label, is characterized in that：It is described can
Dissolubility protein expression vector is named as pBVTH, and it is by by the nucleotide sequence of two codings, six histidine, from big
The startup factor gene of enterobacteria, HRV 3C Protease protease cutting sites and one section are used for cloning the polyclone for using
Site fragment is cloned into coli heat inducible expression carrier pBV220 and is obtained；Its nucleotide sequence is as shown in SEQ ID No.1.
2. the coli heat inducing soluble protein expression vector structure side of fusion molecule companion label described in claim 1
Method, step is：
With GenBank accession number as GI:802133627 E.coli K-12 genomic DNA as template, with TP1 and TP2 to draw
Thing PCR amplifies the molecular chaperone of 1305bp, is connected in 16 DEG C with pGEM Teasy carriers after recovery, connection product conversion
The competent cell of E.coli DH5 α, the screening restructuring gram on the LB flat boards containing IPTG, X-gal containing 50 μ g/ml ammonia benzyl mycins
It is grand；Plasmid is named as pTT1305 Jing after enzyme action and sequence verification are correct；Wherein：
TP1：5′-CCGGAATTCATGCACCATCATCATCATCAC-3′
TP2：5′-CCGGAATTCCGCCTGCTGGTTCATCAGCTT-3′
By the pTT1305 for extracting with EcoRI enzyme action, recovery product is connected with EcoRI enzyme action pBV220 carrier recovery products, is turned
Change the competent cell of E.coli DH5 α, recombinant clone is screened on the LB flat boards containing 50 μ g/ml ammonia benzyl mycins；Sequencing, selects
The positive insertion recombinant clones of trigger factor, are named as pBVT；
Synthetic HRV 3C Protease-His Tag-Thrombin- multiple clone site (MCS)-Thrombin-His Tag
Nucleotide fragments, the fragment nucleotide sequence is as shown in SEQ ID No.2, wherein 5 ' ends introduce EcoRI restriction enzyme sites, 3 ' ends are drawn
Enter PstI restriction enzyme sites；With the carrier recovery of EcoRI, PstI enzyme action fragment, recovery product and EcoRI, PstI enzyme action pBVT
Product is connected, the competent cell of Transformed E .coli DH5 α, the screening restructuring on the LB flat boards containing 50 μ g/ml ammonia benzyl mycins
Clone；Enzyme action, sequencing are verified recombinant clone, that is, obtain the coli heat inducing soluble albumen of fusion molecule companion's label
Expression vector, is named as pBVTH, and its nucleotide sequence is as shown in SEQ ID No.1.
3. the coli heat inducing soluble protein expression vector of fusion molecule companion label described in claim 1 melts in preparation
Application in hop protein.
4. application according to claim 3, is characterized in that：The method of the expression vector expressed fusion protein is to pass through
Genes of interest fragment is cloned into into pBVTH, the expressed fusion protein Jing after inducing under the conditions of 42 DEG C；The albumen affine nickel of nickel after fusion
Column chromatography is obtained, the further molecular chaperone protein eliminated with HRV 3C Protease enzymes on fusion protein, then with affine
It is consummate that purification, ion-exchange purification or molecular sieve purification mode carry out destination protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611204213.1A CN106591344A (en) | 2016-12-23 | 2016-12-23 | Escherichia coli thermally-induced soluble protein expression vector fused with molecular chaperone label and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611204213.1A CN106591344A (en) | 2016-12-23 | 2016-12-23 | Escherichia coli thermally-induced soluble protein expression vector fused with molecular chaperone label and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106591344A true CN106591344A (en) | 2017-04-26 |
Family
ID=58601167
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611204213.1A Pending CN106591344A (en) | 2016-12-23 | 2016-12-23 | Escherichia coli thermally-induced soluble protein expression vector fused with molecular chaperone label and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106591344A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110286118A (en) * | 2019-06-18 | 2019-09-27 | 山东大学 | A method of antibiotic mechanism of action is determined using bioluminescence reporting system |
| CN110904138A (en) * | 2018-09-17 | 2020-03-24 | 杭州博茵生物技术有限公司 | Escherichia coli soluble protein expression vector of Msyb fusion tag, construction method and application |
| CN111378047A (en) * | 2018-12-28 | 2020-07-07 | 复旦大学 | Fusion tag protein for improving protein expression and application thereof |
| CN111733178A (en) * | 2020-07-13 | 2020-10-02 | 山西中医药大学 | Recombinant expression vector for improving soluble expression quantity of disease course related protein of astragalus mongholicus |
| CN112063643A (en) * | 2020-09-09 | 2020-12-11 | 华中农业大学 | Expression vector and method for detecting interaction of membrane proteins in bacteria |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102250846A (en) * | 2011-07-19 | 2011-11-23 | 上海近岸科技有限公司 | Method for preparing enzyme through coexpression of recombinant protease and molecular chaperone |
| CN101921800B (en) * | 2010-06-08 | 2012-07-04 | 南京师范大学 | Escherichia coli protein expression vector using trigger factor as fusion tag and construction method and application thereof |
-
2016
- 2016-12-23 CN CN201611204213.1A patent/CN106591344A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101921800B (en) * | 2010-06-08 | 2012-07-04 | 南京师范大学 | Escherichia coli protein expression vector using trigger factor as fusion tag and construction method and application thereof |
| CN102250846A (en) * | 2011-07-19 | 2011-11-23 | 上海近岸科技有限公司 | Method for preparing enzyme through coexpression of recombinant protease and molecular chaperone |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110904138A (en) * | 2018-09-17 | 2020-03-24 | 杭州博茵生物技术有限公司 | Escherichia coli soluble protein expression vector of Msyb fusion tag, construction method and application |
| CN111378047A (en) * | 2018-12-28 | 2020-07-07 | 复旦大学 | Fusion tag protein for improving protein expression and application thereof |
| CN111378047B (en) * | 2018-12-28 | 2022-12-16 | 复旦大学 | Fusion tag protein for improving protein expression and application thereof |
| CN110286118A (en) * | 2019-06-18 | 2019-09-27 | 山东大学 | A method of antibiotic mechanism of action is determined using bioluminescence reporting system |
| CN110286118B (en) * | 2019-06-18 | 2021-06-29 | 山东大学 | Method for judging antibiotic action mechanism by using bioluminescence report system |
| CN111733178A (en) * | 2020-07-13 | 2020-10-02 | 山西中医药大学 | Recombinant expression vector for improving soluble expression quantity of disease course related protein of astragalus mongholicus |
| CN112063643A (en) * | 2020-09-09 | 2020-12-11 | 华中农业大学 | Expression vector and method for detecting interaction of membrane proteins in bacteria |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111705006B (en) | Oral recombinant yeast for expressing novel coronavirus S protein and preparation and application thereof | |
| CN106591344A (en) | Escherichia coli thermally-induced soluble protein expression vector fused with molecular chaperone label and application thereof | |
| AU636537B2 (en) | Improvement of the yield when disulfide-bonded proteins are secreted | |
| CN109486737B (en) | Recombinant escherichia coli with high L-tryptophan yield and construction method thereof | |
| CN111304141B (en) | Recombinant escherichia coli for producing N-acetyl-5-hydroxytryptamine and construction method and application thereof | |
| CN110229838B (en) | Method for obtaining hydroxylated compound by biotransformation of steroid compound | |
| CN102719471B (en) | Integrative plasmid pOPHI and resistance screening marker-free self-luminescent mycobacterium | |
| CN101603023B (en) | Recombinant escherichia coli of temperature-control coexpression exogenous gene and application thereof | |
| US20040028695A1 (en) | Recombinant immunogenic compositions and methods for protecting against lethal infections from Bacillus anthracis | |
| CN112553176B (en) | Glutamine transaminase with improved thermal stability | |
| CN102311954B (en) | Transgenic papaya 55-1 transformation event specific PCR detection method | |
| CN112226451A (en) | Bacillus subtilis expression system and method for producing alpha-L-AFs by using same | |
| CN106011133B (en) | A kind of small DNA molecular amount reference substance, reference substance plasmid and preparation method thereof | |
| CN112011471B (en) | Yeast strain for brewing lemon-flavored beer, preparation method thereof and beer brewing method | |
| CN113980883B (en) | Recombinant escherichia coli for high-yield hydroxylation steroid bulk drug and application thereof | |
| KR101495276B1 (en) | Light Inducible Promoter and Gene Expression System Comprising The Same | |
| CN112176014B (en) | Biological-inorganic assembly system, preparation method thereof and method for degrading organic pollutants | |
| CN108118047A (en) | A kind of preparation method of bifunctional enzyme and its application in trehalose production | |
| CN109554322B (en) | Recombinant Escherichia coli with high L-threonine yield and construction method thereof | |
| CN113736676A (en) | Preparation and application of oral recombinant saccharomyces cerevisiae for expressing porcine epidemic diarrhea virus S protein | |
| CN109957560B (en) | Polypeptide with protease activity and application thereof | |
| CN114539425B (en) | Method for improving biological expression of linear polypeptide | |
| KR100959696B1 (en) | The vector for fusion protein production for analysing the antigenic epitopes of Helicobacter pylori and its method | |
| CN111748034A (en) | Preparation method of mycoplasma synoviae monoclonal antibody | |
| CN114891649B (en) | Complex bacteria and application thereof in degradation of long-chain alkane |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170426 |
|
| RJ01 | Rejection of invention patent application after publication |