CN109486737B - Recombinant escherichia coli with high L-tryptophan yield and construction method thereof - Google Patents

Recombinant escherichia coli with high L-tryptophan yield and construction method thereof Download PDF

Info

Publication number
CN109486737B
CN109486737B CN201811465696.XA CN201811465696A CN109486737B CN 109486737 B CN109486737 B CN 109486737B CN 201811465696 A CN201811465696 A CN 201811465696A CN 109486737 B CN109486737 B CN 109486737B
Authority
CN
China
Prior art keywords
recombinant
escherichia coli
tryptophan
promoter
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201811465696.XA
Other languages
Chinese (zh)
Other versions
CN109486737A (en
Inventor
刘龙
陈泰驰
李江华
堵国成
陈坚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jiangnan University
Original Assignee
Jiangnan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangnan University filed Critical Jiangnan University
Priority to CN201811465696.XA priority Critical patent/CN109486737B/en
Publication of CN109486737A publication Critical patent/CN109486737A/en
Application granted granted Critical
Publication of CN109486737B publication Critical patent/CN109486737B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245—Escherichia (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C12P13/227—Tryptophan
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y103/00—Oxidoreductases acting on the CH-CH group of donors (1.3)
    • C12Y103/01—Oxidoreductases acting on the CH-CH group of donors (1.3) with NAD+ or NADP+ as acceptor (1.3.1)
    • C12Y103/01012—Prephenate dehydrogenase (1.3.1.12)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01071—Shikimate kinase (2.7.1.71)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]

Abstract

The invention discloses a recombinant escherichia coli with high L-tryptophan yield and a construction method thereof, belonging to the technical field of genetic engineering. The invention uses Escherichia coli CICC10303 as an original strain, and adopts CRISPR-Cas9 gene editing technology to replace shikimic acid kinase coding gene aroK promoter as a strong promoter T7; replacing the promoter of the encoding gene pheA of the prephenate dehydrogenase with a weak promoter tac; knocking out the tryptophan transporter coding gene mtr and preventing the tryptophan from being transported back to the cell in the fermentation process. Finally, the Escherichia coli genetic engineering bacteria accumulating the L-tryptophan are obtained, the yield reaches 36g/L, and a foundation is laid for further metabolic engineering transformation of Escherichia coli to produce the L-tryptophan.

Description

Recombinant escherichia coli with high L-tryptophan yield and construction method thereof
Technical Field
The invention relates to recombinant escherichia coli with high L-tryptophan yield and a construction method thereof, belonging to the technical field of genetic engineering.
Background
L-tryptophan is one of eight essential amino acids for human body as a very important aromatic amino acid. In organisms, L-tryptophan can synthesize important bioactive substances such as 5-hydroxytryptamine, nicotinic acid, pigment, alkaloid, coenzyme, indoleacetic acid and the like, plays an important role in the growth and development of human and animals, and is widely applied to the aspects of food, medicine, feed and the like. The production of L-tryptophan was originally mainly based on chemical synthesis and protein hydrolysis, but these methods have the disadvantages of limited material source, long period, complex process, etc., and thus are gradually eliminated. Due to the characteristics of low cost, wide raw material sources, small environmental pollution and the like, the method for producing the L-tryptophan by the microbial method is widely applied.
At present, the microorganism method for producing L-tryptophan has the defects of low yield, complex operation and the like. In 2001, Wangjian and the like use diethyl sulfate (DES) as a mutagen, select a tyrosine and phenylalanine double-auxotroph strain starting strain, breed an L-tryptophan production strain after multiple mutagenesis treatment, and continuously ferment for 64 hours in batches, wherein the accumulation amount of the L-tryptophan can reach 7.28 g/L. In 2007, Chenjunfeng and the like utilize a separation method of multiple mutagenesis, a corynebacterium glutamicum strain is used as an initial strain to obtain a phenylalanine and tyrosine double-auxotroph L-tryptophan structural analogue resistant mutant strain, and after the strain is fermented in a shake flask for 96 hours, the accumulation amount of L-tryptophan reaches 10.82 g/L.
Escherichia coli (Escherichia coli) has been used for the industrial fermentative production of various amino acids. Therefore, the construction of recombinant Escherichia coli by using metabolic engineering means is an effective way for producing L-tryptophan. At present, the overexpression or attenuation of key enzyme genes in an amino acid synthesis path and a competition path mediated by expression plasmids is a main means for carrying out genetic modification on Escherichia coli. However, the use of expression plasmid mediated gene overexpression must introduce antibiotic resistance gene into Escherichia coli cells and add certain antibiotic during growth, which raises the doubt of antibiotic use. Therefore, the method for genetically modifying the escherichia coli is safe and efficient, and has important significance for the field of amino acid production.
Disclosure of Invention
The first purpose of the invention is to provide a recombinant Escherichia coli for producing L-tryptophan, wherein a promoter replacing shikimate kinase gene aroK is a T7 promoter, a tryptophan transporter encoding gene mtr is knocked out, and a promoter replacing a prephenate dehydrogenase encoding gene pheA is a tac promoter.
In one embodiment of the invention, the nucleotide sequence of the tac promoter is shown as SEQ ID NO. 1.
In one embodiment of the invention the nucleotide sequence of the shikimate kinase aroK gene is shown in SEQ ID No. 2.
In one embodiment of the present invention, the nucleotide sequence of the tryptophan transporter encoding gene mtr is shown in SEQ ID NO. 3.
In one embodiment of the invention, the nucleotide sequence of the gene pheA encoding prephenate dehydrogenase is shown as SEQ ID No. 4.
In one embodiment of the invention, the genome of the escherichia coli cic 10303 is edited.
In one embodiment of the invention, the genome editing is performed using CRISPR-Cas9 technology.
The second objective of the present invention is to provide a method for constructing the recombinant Escherichia coli, which comprises the following steps:
1) constructing a T7 promoter replacing recombinant fragment, a tac promoter replacing recombinant fragment and a knockout mtr gene recombinant fragment: after fusing upstream and downstream homologous arm sequences of an initiation codon of an aroK gene cluster of a shikimic acid kinase coding gene of escherichia coli, introducing a T7 promoter to obtain a recombinant fragment T7 AROK; fusing the upstream and downstream homologous arm sequences of the initiation codon of the prephenate dehydrogenase encoding gene pheA, and introducing a promoter tac to obtain a fragment TACPHE; fusing the upstream and downstream homologous arms of the tryptophan transporter coding gene mtr to obtain a fragment MTRD.
2) Constructing a recombinant plasmid: respectively connecting the fragments T7AROK, TACPHE and MTRD with a linearized vector PCR containing sgRNA to respectively obtain a recombinant plasmid containing T7AROK, a recombinant plasmid containing TACPHE and a recombinant plasmid containing MTRD;
3) constructing recombinant escherichia coli: transforming the plasmid containing cas9 protein into Escherichia coli CICC10303 to obtain Escherichia coli CICC10303-cas 9; then transforming the recombinant plasmid containing T7AROK into Escherichia coli CICC10303-cas9 to obtain recombinant Escherichia coli CICC 10303-aroKT; transforming the recombinant plasmid containing TACPHE into Escherichia coli CICC 10303-aroKT to obtain recombinant Escherichia coli CICC 10303-pheAT; transforming the recombinant plasmid containing MTRD into Escherichia coli CICC10303-pheAT to obtain recombinant Escherichia coli CICC 10303-mtrD; after foreign plasmids are removed, the recombinant Escherichia coli CICC10303-TRYP is obtained, wherein the foreign plasmids comprise a recombinant plasmid containing T7AROK, a recombinant plasmid containing TACPHE and a recombinant plasmid containing MTRD.
In one embodiment of the present invention, the plasmid containing cas9 protein comprises pCas 9.
In one embodiment of the invention, the sgRNA-containing linearized vector comprises pTT7A, pTPH, or pTMT.
In one embodiment of the invention, the nucleotide sequence of pTT7A is shown in SEQ ID NO. 5.
In one embodiment of the present invention, the nucleotide sequence of pTPH is shown in SEQ ID NO. 6.
In one embodiment of the present invention, the nucleotide sequence of pTMT is shown in SEQ ID NO. 7.
In one embodiment of the invention, the nucleotide sequence of pCas9 is shown in SEQ ID No. 8.
The third object of the present invention is to provide the use of the above recombinant E.coli for the production of L-tryptophan.
In one embodiment of the invention, the application comprises inoculating a single colony cultured in a plate culture medium at 34-38 ℃ for 22-26h to a seed culture medium, culturing at 34-38 ℃ and 180-220rpm for 5-8h, inoculating a fermentation culture medium with 20% of inoculum size, culturing at 34-38 ℃ and 180-220rpm for 10-14h, and inducing with 0.1mM IPTG for 45-50 h.
The fourth purpose of the invention is to provide the application of the recombinant escherichia coli in feed, pharmacy, health care products or food industry.
The invention uses Escherichia coli CICC10303 as an original strain, and adopts CRISPR-Cas9 gene editing technology to replace shikimic acid kinase coding gene aroK promoter as a strong promoter T7; replacing the promoter of the encoding gene pheA of the prephenate dehydrogenase with a weak promoter tac; knocking out the tryptophan transporter coding gene mtr and preventing the tryptophan from being transported back to the cell in the fermentation process. Finally, the Escherichia coli genetic engineering bacteria accumulating the L-tryptophan are obtained, the yield reaches 36g/L, and a foundation is laid for further metabolic engineering transformation of Escherichia coli to produce the L-tryptophan. The recombinant escherichia coli provided by the invention is simple in construction method, convenient to use and good in application prospect.
Drawings
FIG. 1: plasmid map, a: pTT 7A; b: pTPH; c: pTMT.
FIG. 2: the yield of tryptophan of the recombinant Escherichia coli CICC10303-TRYP under different culture conditions.
FIG. 3: only replacing the promoter of the prephenate dehydrogenase encoding gene pheA as a tac promoter, and fermenting the recombinant bacteria at 35 ℃ to produce L-tryptophan.
FIG. 4: only replacing the promoter of the prephenate dehydrogenase encoding gene pheA as a tac promoter, and fermenting the recombinant bacteria at 35 ℃ to produce L-tryptophan.
FIG. 5: only knocking out the encoding gene mtr of the tryptophan transporter, and fermenting the recombinant bacteria at the temperature of 35 ℃ to produce the L-tryptophan.
Detailed Description
Recombinant escherichia coli seed culture and fermentation medium:
plate medium (g/L): tryptone 10, yeast powder 5, sodium chloride 5 and agar powder 15, and the pH is adjusted to 7.0.
Seed medium (g/L): 30 parts of glucose, 15.2 parts of yeast powder, 24 parts of dipotassium hydrogen phosphate, 5 parts of ammonium sulfate, 9.6 parts of monopotassium phosphate and 1 part of magnesium sulfate heptahydrate.
Fermentation medium (g/L): 60 parts of glucose, 16 parts of magnesium sulfate heptahydrate, 24 parts of ammonium sulfate, 10 parts of yeast extract powder, 16 parts of trisodium citrate dihydrate and 5.6 parts of dipotassium phosphate.
The culture conditions are as follows: picking single colony from the plate cultured at 37 ℃ for 24h to a seed culture medium, culturing at 37 ℃ and 220rpm for 10h, inoculating 10% of inoculum size to a fermentation culture medium, and culturing at 35 ℃ and 220rpm for 42 h.
The method for measuring L-tryptophan comprises the following steps:
1. sample treatment:
1mL of the fermentation broth was taken, centrifuged to remove the cells and the supernatant was taken. The supernatant was diluted appropriately with 5% trichloroacetic acid, centrifuged at 12000rpm/min for 10min, and then filtered through a filter with a pore size of 0.22. mu.m.
2. The analysis method comprises the following steps: OPA boric acid pre-column derivatization, wherein the peak eluted at 13.768min is tryptophan
3. Chromatographic conditions are as follows:
(1) a chromatographic column: column C18 (250X 4.6) mm
(2) Column temperature: 40 deg.C
(3) Mobile phase A: weighing 3.01g of anhydrous sodium acetate in a beaker, adding deionized water to dissolve the anhydrous sodium acetate and fixing the volume to 1L, then adding 200 mu L of triethylamine, and adjusting the pH to 7.20 +/-0.05 by using 5% acetic acid; after suction filtration, 5mL of tetrahydrofuran was added and mixed for further use. Mobile phase B: weighing 3.01g of anhydrous sodium acetate in a beaker; adding deionized water to dissolve and fixing the volume to 200 mL; adjusting pH to 7.20 + -0.05 with 5% acetic acid; after suction filtration, 400mL of acetonitrile and 400mL of methanol were added to the solution, and the mixture was mixed for use.
(4) Flow rate: 1.0 ml/min;
(5) an ultraviolet detector: 338 nm;
(6) column temperature: 40 ℃;
in the following examples, conventional molecular biological experiments are used, not much described.
EXAMPLE 1 construction of recombinant fragments
Designing primers pT-aroK-1R and pT-aroK-2F, pT-aroK-1F, pT-aroK-2R (shown in table 1) according to the genome sequence information of escherichia coli, amplifying aroK gene homologous arm gene sequences with a T7 promoter from an escherichia coli CICC10303 genome by using the four primers respectively for 600bp, and fusing the obtained 2 amplified fragments by a fusion PCR technology to obtain a recombinant fragment T7 AROK;
designing primers pT-pheA-1F, pT-pheA-1R, pT-pheA-2F and pT-pheA-2R according to the sequence information of the escherichia coli genome, amplifying homologous arm gene sequences on both sides of a pheA gene initiation codon from the escherichia coli CICC10303 genome by using the primers, and fusing the obtained 2 amplified fragments by a fusion PCR technology to obtain a recombinant fragment TACPHE.
Primers pT-mtr-1F, pT-mtr-1R, pT-mtr-2F and pT-mtr-2R are designed according to the sequence information of the escherichia coli genome, the homologous arm gene sequences on both sides of the mtr gene are amplified from the escherichia coli CICC10303 genome by using the primers respectively for 600bp, and the obtained 2 amplified fragments are fused by a fusion PCR technology to obtain a recombinant fragment MTRD.
TABLE 1 primer Table
Figure BDA0001889753550000051
EXAMPLE 2 construction of recombinant plasmid
Designing a primer pT-aroK-F, pT-aroK-R according to the sequence information of the vector pTarget, and carrying out PCR to obtain a linearized vector pTT7A (the sequence information is shown as SEQ ID NO. 5) containing sgRNA; designing a primer pT-pheA-F, pT-pheA-R, and carrying out PCR to obtain a linearized vector pTPH (sequence information is shown in SEQ ID NO. 6) containing sgRNA; designing a primer pT-mtr-F, pT-mtr-R, carrying out PCR to obtain a linearized pTMT (the sequence information is shown as SEQ ID NO. 7) containing sgRNA, connecting pTT7A, pTPH and pTMT with recombinant fragments T7AROK, TACPHE and MTRD respectively to construct a recombinant plasmid, carrying out BamHI and BsgI double enzyme digestion verification and sequencing, and confirming that the recombinant plasmid is successfully constructed. The map of pTT7A, pTPH and pTMT plasmids is shown in FIG. 1.
Example 3 construction of recombinant T7AROK fragment E.coli
Coli cic 10303 was transformed with pCas9 plasmid containing cas9 protein. Screening successfully transformed recombinant Escherichia coli CICC10303-cas9 by using a Kana resistance plate, then transforming the recombinant plasmid pTargetT7AROK into Escherichia coli CICC10303-cas9, screening to confirm that the T7 promoter is successfully integrated, adding 0.05mM IPTG to induce for 12 hours at 30 ℃, removing the recombinant plasmid pTargetT7AROK, selecting a primer pT-aroK-2F and pT-aroK-2R to select a transformant to perform colony PCR, generating a band of about 600bp, and obtaining the recombinant Escherichia coli CICC 10303-aroKT of which the aroK gene promoter is T7 after correct sequencing.
Example 4 construction of recombinant TACPHE fragment E.coli
The recombinant plasmid pTargetTACPHE is transformed into Escherichia coli CICC 10303-aroKT, transformants are selected by using primers pT-pheA-2F and pT-pheA-2R for colony PCR, a band of about 600bp appears, and the recombinant Escherichia coli CICC10303-pheAT with an aroK gene promoter T7 and a pheA gene promoter tac is obtained after correct sequencing.
Example 5 construction of recombinant MTRD fragment E.coli
Transforming the recombinant plasmid pTargetMTRD into escherichia coli CICC10303-pheAT, selecting a transformant for colony PCR by selecting primers pT-mtr-1F and pT-mtr-2R, generating a band of about 1200bp, determining that the mtr gene is successfully knocked out by sequencing, adding 0.05mM IPTG to induce for 12h at 30 ℃, and removing the recombinant plasmid pTargetMTRD to obtain recombinant escherichia coli CICC 10303-mtrD with an aroK gene promoter of T7, a pheA gene promoter of tac and mtr gene deletion; culturing at 37 deg.C for 12h, removing plasmid pCas9 to obtain recombinant Escherichia coli CICC10303-TRYP with high yield of L-tryptophan.
EXAMPLE 6 production of L-Tryptophan by fermentation of ammonium sulfate with Soytone as Nitrogen Source
Culturing recombinant Escherichia coli CICC10303-TRYP in a plate culture medium at 37 ℃ for 24h, picking single colony to a seed culture medium, culturing at 37 ℃ and 220rpm for 10h, inoculating a fermentation culture medium with 10% of inoculum size, adding 18g/L ammonium sulfate to the fermentation culture medium, and adding 6g/L soybean peptone. Culturing at 35 deg.C and 220rpm for 12h, and inducing with 0.1mM IPTG for 36h until the bacteria are not sugar-consuming. The content of L-tryptophan in the supernatant of the fermentation liquor is determined to be 22g/L by HPLC.
EXAMPLE 7 fermentative production of L-Tryptophan by addition of citric acid
Culturing recombinant Escherichia coli CICC10303-TRYP in a plate culture medium at 37 deg.C for 24h, picking single colony to seed culture medium, culturing at 37 deg.C and 220rpm for 10h, inoculating to fermentation medium at 10% inoculum size, removing trisodium citrate in the fermentation medium, and adding citric acid 3 g/L. Culturing at 35 deg.C and 220rpm for 12h, and inducing with 0.1mM IPTG for 40h until the thallus does not consume sugar. 26g/L of L-tryptophan in the supernatant of the fermentation liquor is measured by HPLC.
Example 837 ℃ temperature fermentation production of L-Tryptophan
Culturing recombinant Escherichia coli CICC10303-TRYP in a plate culture medium at 37 deg.C for 24h, picking single colony to seed culture medium, culturing at 37 deg.C and 220rpm for 10h, inoculating with 10% inoculum size, culturing at 37 deg.C and 220rpm for 12h, and inducing with 0.1mM IPTG for 48h until sugar is exhausted. The content of L-tryptophan in the supernatant of the fermentation liquor is determined to be 32g/L by HPLC.
Example 935 ℃ temperature fermentation production of L-Tryptophan
Culturing recombinant Escherichia coli CICC10303-TRYP in a plate culture medium at 37 deg.C for 24h, picking single colony to seed culture medium, culturing at 37 deg.C and 220rpm for 10h, inoculating 10% inoculum size to fermentation culture medium, culturing at 35 deg.C and 220rpm for 12h, and inducing with 0.1mM IPTG for 42 h. The supernatant of the fermentation broth was measured to contain 36 g/L-tryptophan by HPLC, as shown in FIG. 2.
Comparative example 1 production of L-Tryptophan by fermenting recombinant bacteria at 35 ℃ with only shikimate kinase aroK promoter replaced with T7 promoter
Designing primers pT-aroK-1R and pT-aroK-2F, pT-aroK-1F, pT-aroK-2R according to the sequence information of the escherichia coli genome, amplifying aroK gene homologous arm gene sequences with a T7 promoter from the escherichia coli CICC10303 genome by using the four primers respectively for 600bp, and fusing the obtained 2 amplified fragments by a fusion PCR technology to obtain a recombinant fragment T7 AROK;
designing a primer pT-aroK-F, pT-aroK-R according to the sequence information of the vector pTarget, and carrying out PCR to obtain a linearized vector pTT7A containing sgRNA; and connecting the recombinant fragment with the T7AROK to construct a recombinant plasmid, carrying out double enzyme digestion verification and sequencing on BamHI and BsgI, and confirming that the recombinant plasmid is successfully constructed.
Coli cic 10303 was transformed with pCas9 plasmid containing cas9 protein. Screening successfully transformed recombinant escherichia coli CICC10303-cas9 by adopting a Kana resistance plate, then transforming the recombinant plasmid pTargetT7AROK into escherichia coli CICC10303-cas9, screening to confirm that the T7 promoter is successfully integrated and removing the recombinant plasmid pTargetT7AROK, selecting a transformant by using primers pT-aroK-2F and pT-aroK-2R to carry out colony PCR, generating a band of about 600bp, and obtaining the recombinant escherichia coli CICC 10303-aroKT with an aroK gene promoter of T7 after the sequencing is correct; after the plasmid pCas9 is removed, the recombinant Escherichia coli CICC10303-TRYP 1 with high L-tryptophan yield is obtained.
Culturing recombinant Escherichia coli CICC10303-TRYP 1 in a plate culture medium at 37 deg.C for 24h, selecting single colony to seed culture medium, culturing at 37 deg.C and 220rpm for 10h, inoculating 10% of inoculum size to fermentation culture medium; culturing at 35 deg.C and 220rpm for 12h, and inducing with 0.1mM IPTG for 42 h. The content of L-tryptophan in the supernatant of the fermentation broth was measured by HPLC (high Performance liquid chromatography) at 12g/L, as shown in FIG. 3.
Comparative example 2 production of L-Tryptophan by fermenting recombinant bacteria at 35 ℃ with a tac promoter instead of the promoter of the Prebenzoate dehydrogenase encoding gene pheA
Designing primers pT-pheA-1F, pT-pheA-1R, pT-pheA-2F and pT-pheA-2R according to the sequence information of the escherichia coli genome, amplifying homologous arm gene sequences on both sides of a pheA gene initiation codon from the escherichia coli CICC10303 genome by using the primers, and fusing the obtained 2 amplified fragments by a fusion PCR technology to obtain a recombinant fragment TACPHE.
Designing primers pT-pheA-F and pT-pheA-R according to the sequence information of the vector pTarget, and carrying out PCR to obtain a linearized vector pTPH containing sgRNA; and connecting the fragment with a recombinant fragment TACPHE to construct a recombinant plasmid, carrying out double enzyme digestion verification and sequencing on BamHI and BsgI, and confirming that the recombinant plasmid is successfully constructed.
Coli cic 10303 was transformed with pCas9 plasmid containing cas9 protein. Screening and transforming successful recombinant escherichia coli CICC10303-cas9 by adopting a Kana resistance plate, then transforming the recombinant plasmid pTargetTACHE into escherichia coli CICC10303-cas9, screening and confirming successful integration of the tac promoter and removing the recombinant plasmid pTargetTACHE, designing a primer for colony PCR verification, and obtaining the recombinant escherichia coli CICC10303-pheAT2 with the pheA gene promoter as tac after a sequencing result is correct; after removal of the plasmid pCas9, recombinant E.coli CICC10303-TRYP 2 was obtained.
Culturing recombinant Escherichia coli CICC10303-TRYP 2 in plate culture medium at 37 deg.C for 24h, picking single colony, culturing at 37 deg.C and 220rpm for 10h, inoculating 10% inoculum size to fermentation culture medium, culturing at 35 deg.C and 220rpm for 12h, and inducing with 0.1mM IPTG for 42 h. The content of L-tryptophan in the supernatant of the fermentation broth was measured by HPLC (high Performance liquid chromatography) at 20g/L, as shown in FIG. 4.
Comparative example 3 production of L-Tryptophan by knocking out only Tryptophan transporter encoding gene mtr and fermenting recombinant bacteria at 35 deg.C
Primers pT-mtr-1F, pT-mtr-1R, pT-mtr-2F and pT-mtr-2R are designed according to the sequence information of the escherichia coli genome, the homologous arm gene sequences on both sides of the mtr gene are amplified from the escherichia coli CICC10303 genome by using the primers respectively for 600bp, and the obtained 2 amplified fragments are fused by a fusion PCR technology to obtain a recombinant fragment MTRD.
Designing primers pT-mtr-F and pT-mtr-R according to the sequence information of the vector pTarget, obtaining a linearized vector pTMT containing sgRNA through PCR, connecting the linearized vector pTMT with a recombinant fragment MTRD to construct a recombinant plasmid, carrying out BamHI and BsgI double enzyme digestion verification and sequencing, and confirming that the recombinant plasmid is successfully constructed.
Coli cic 10303 was transformed with pCas9 plasmid containing cas9 protein. Screening and transforming successfully transformed recombinant escherichia coli CICC10303-cas9 by adopting a Kana resistance plate, then transforming the recombinant plasmid pTargetMTRD into escherichia coli CICC10303-cas9, screening and confirming that mtr genes are successfully knocked out and integrated, removing the recombinant plasmid pTargetMTRD, designing a primer, selecting a transformant for colony PCR verification, obtaining the recombinant escherichia coli CICC 10303-mtrD with the mtr genes successfully knocked out and removing the plasmid pCas9 after a sequencing result is correct, and obtaining the recombinant escherichia coli CICC 10303-YPTR 3 with high L-tryptophan yield.
Culturing recombinant Escherichia coli CICC10303-TRYP 3 in plate culture medium at 37 deg.C for 24h, picking single colony to seed culture medium, culturing at 37 deg.C and 220rpm for 10h, inoculating 10% inoculum size to fermentation culture medium, culturing at 35 deg.C and 220rpm for 12h, and inducing with 0.1mM IPTG for 42 h. The content of L-tryptophan in the supernatant of the fermentation broth was measured by HPLC, as shown in FIG. 5.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of south of the Yangtze river
<120> recombinant escherichia coli for high yield of L-tryptophan and construction method thereof
<160>26
<170>PatentIn version 3.3
<210>1
<211>87
<212>DNA
<213> Artificial Synthesis
<400>1
taatacgact cactataggg gaattgtgag cggataacaa ttcccctcta gaaataattt 60
tgtttaactt taagaaggag atatacc 87
<210>2
<211>978
<212>DNA
<213> Artificial Synthesis
<400>2
acagccgtaa aagcggtaat gtttttacgc tgaacgtgtt tcatctattt gacgcgcgca 60
ggtatttagc atacaaggag taccgatttg agagttggtg ctcttcgctg cctgcgttcc 120
atgatgatga tttatcattc aggcggcatt ttgctgtctt ttttacgcta atcttacccg 180
gtgatttatc gccagagcgg tggtagcaag gcagcgcgct tgcagcgacc agatatgcag 240
agggatgggt gatttattca gttgccaaac ccgctggagt attgagataa ttttcagtct 300
gactctcgca atatcttatg aggtttcagt tcatgtcctg cggcgctctc tgagcgaagc 360
gggtttatca ttaacgaata gtcttagtag taccgaaaaa atggcagaga aacgcaatat 420
ctttctggtt gggcctatgg gtgccggaaa aagcactatt gggcgccagt tagctcaaca 480
actcaatatg gaattttacg attccgatca agagattgag aaacgaaccg gagctgatgt 540
gggctgggtt ttcgatttag aaggcgaaga aggcttccgc gatcgcgaag aaaaggtcat 600
caatgagttg accgagaaac agggtattgt gctggctact ggcggcggct ctgtgaaatc 660
ccgtgaaacg cgtaaccgtc tttccgctcg tggcgttgtc gtttatcttg aaacgaccat 720
cgaaaagcaa cttgcacgca cgcagcgtga taaaaaacgc ccgttgctgc acgttgaaac 780
accgccgcgt gaagttctgg aagcgttggc caatgaacgc aatccgctgt atgaagagat 840
tgccgacgtg accattcgta ctgatgatca aagcgctaaa gtggttgcaa accagattat 900
tcacatgctg gaaagcaact aattctggct ttatatacac tcgtctgcgg gtacagtaat 960
taaggtggat gtcgcgtt 978
<210>3
<211>1515
<212>DNA
<213> Artificial Synthesis
<400>3
tcatcgctga acagcgaaca caatctgtaa aataatatat acagccccga tttttaccat 60
cggggctttt tttctgtctt ttgtactcgt gtactggtac agtgcaatgc ataacaacgc 120
agtcgcacta tttttcactg gagagaagcc ctcatggcaa cactaaccac cacccaaacg 180
tcaccgtcgc tgcttggcgg cgtggtgatt atcggcggca ccattattgg cgcagggatg 240
ttttctctgc cagtggtcat gtccggggcg tggtttttct ggtcaatggc ggcgctgatc 300
tttacctggt tctgtatgct gcattccggc ttgatgattc tggaagctaa cctgaattac 360
agaatcggtt cgagttttga caccatcacc aaagatttgc tgggcaaagg ctggaacgtg 420
gtcaacggca tttccattgc ctttgtgctc tatatcctga cctatgccta tatttctgcc 480
agtggttcga ttctgcatca caccttcgca gagatgtcac taaacgtccc ggcacgggcg 540
gcgggttttg gttttgcatt gctggtagcg tttgtggtgt ggttgagcac taaagccgtc 600
agtcgcatga cagcgattgt gctgggggcg aaagtcatta ccttcttcct cacctttggt 660
agcctgctgg ggcatgtgca gcctgcgaca ttgttcaacg tcgccgaaag caatgcgtct 720
tatgcaccgt atctgttgat gaccctgccg ttctgtctgg catcgtttgg ttatcacggt 780
aacgtgccaa gcctgatgaa gtattacggc aaagatccga aaaccatcgt gaaatgtctg 840
gtgtacggta cgctgatggc gctggcgctg tataccatct ggttgctggc gacgatgggt 900
aacatcccgc gtccggagtt tatcggtatt gcagagaagg gcggtaatat tgatgtgctg 960
gtacaggcgt taagcggcgt actgaacagc cgtagtctgg atctgctgct ggtcgtgttc 1020
tcaaactttg cggtagcgag ttcgttcctc ggcgtaacgc tgggtttgtt tgactatctg 1080
gcagatctgt ttggtttcga cgactcggct gtgggccgct tgaaaacggc attgctgacc 1140
tttgccccgc cagttgtggg ggggctgttg ttcccgaacg gattcctgta cgccattggt 1200
tatgctggtt tagcggctac catctgggcg gcaattgttc cggcgctgtt agcccgtgca 1260
tcgcgtaaac gctttggcag cccgaaattc cgcgtctggg gtggcaagcc gatgattgcg 1320
ctgattctgg tgtttggcgt cggcaacgca ctggtgcata ttttatcgag ctttaattta 1380
ctgccggtgt atcagtaatc agcggtgcct tatccgacat ttctgctgcc tacacaatgc 1440
ctgatgcgct tcgcttatca ggtctatgta ggacagcgtt gccagctcgg ataaggcttc 1500
ccgcgttaag acaca 1515
<210>4
<211>1301
<212>DNA
<213> Artificial Synthesis
<400>4
atgggaggcg tttcgtcgtg tgaaacagaa tgcgaagacg aacaataagg cctcccaaat 60
cggggggcct tttttattga taacaaaaag gcaacactat gacatcggaa aacccgttac 120
tggcgctgcg agagaaaatc agcgcgctgg atgaaaaatt attagcgtta ctggcagaac 180
ggcgcgaact ggccgtcgag gtgggaaaag ccaaactgct ctcgcatcgc ccggtacgtg 240
atattgatcg tgaacgcgat ttgctggaaa gattaattac gctcggtaaa gcgcaccatc 300
tggacgccca ttacattact cgcctgttcc agctcatcat tgaagattcc gtattaactc 360
agcaggcttt gctccaacaa catctcaata aaattaatcc gcactcagca cgcatcgctt 420
ttctcggccc caaaggttct tattcccatc ttgcggcgcg ccagtatgct gcccgtcact 480
ttgagcaatt cattgaaagt ggctgcgcca aatttgccga tatttttaat caggtggaaa 540
ccggccaggc cgactatgcc gtcgtaccga ttgaaaatac cagctccggt gccataaacg 600
acgtttacga tctgctgcaa cataccagct tgtcgattgt tggcgagatg acgttaacta 660
tcgaccattg tttgttggtc tccggcacta ctgatttatc caccatcaat acggtctaca 720
gccatccgca gccattccag caatgcagca aattccttaa tcgttatccg cactggaaga 780
ttgaatatac cgaaagtacg tctgcggcaa tggaaaaggt tgcacaggca aaatcaccgc 840
atgttgctgc gttgggaagc gaagctggcg gcactttgta cggtttgcag gtactggagc 900
gtattgaagc aaatcagcga caaaacttca cccgatttgt ggtgttggcg cgtaaagcca 960
ttaacgtgtc tgatcaggtt ccggcgaaaa ccacgttgtt aatggcgacc gggcaacaag 1020
ccggtgcgct ggttgaagcg ttgctggtac tgcgcaacca caatctgatt atgacccgtc 1080
tggaatcacg cccgattcac ggtaatccat gggaagagat gttctatctg gatattcagg 1140
ccaatcttga atcagcggaa atgcaaaaag cattgaaaga gttaggggaa atcacccgtt 1200
caatgaaggt attgggctgt tacccaagtg agaacgtagt gcctgttgat ccaacctgat 1260
gaaaaggtgc cggatgatgt gaatcatccg gcactggatt a 1301
<210>5
<211>2118
<212>DNA
<213> Artificial Synthesis
<400>5
tcgagttcat gtgcagctcc atcagcaaaa ggggatgata agtttatcac caccgactat 60
ttgcaacagt gccgttgatc gtgctatgat cgactgatgt catcagcggt ggagtgcaat 120
gtcatgaggg aagcggtgat cgccgaagta tcgactcaac tatcagaggt agttggcgtc 180
atcgagcgcc atctcgaacc gacgttgctg gccgtacatt tgtacggctc cgcagtggat 240
ggcggcctga agccacacag tgatattgat ttgctggtta cggtgaccgt aaggcttgat 300
gaaacaacgc ggcgagcttt gatcaacgac cttttggaaa cttcggcttc ccctggagag 360
agcgagattc tccgcgctgt agaagtcacc attgttgtgc acgacgacat cattccgtgg 420
cgttatccag ctaagcgcga actgcaattt ggagaatggc agcgcaatga cattcttgca 480
ggtatcttcg agccagccac gatcgacatt gatctggcta tcttgctgac aaaagcaaga 540
gaacatagcg ttgccttggt aggtccagcg gcggaggaac tctttgatcc ggttcctgaa 600
caggatctat ttgaggcgct aaatgaaacc ttaacgctat ggaactcgcc gcccgactgg 660
gctggcgatg agcgaaatgt agtgcttacg ttgtcccgca tttggtacag cgcagtaacc 720
ggcaaaatcg cgccgaagga tgtcgctgcc gactgggcaa tggagcgcct gccggcccag 780
tatcagcccg tcatacttga agctagacag gcttatcttg gacaagaaga agatcgcttg 840
gcctcgcgcg cagatcagtt ggaagaattt gtccactacg tgaaaggcga gatcaccaag 900
gtagtcggca aataagatgc cgctcgccag tcgattggct gagctcatga agttcctatt 960
ccgaagttcc gcgaacgcgt aaaggatcta ggtgaagatc ctttttgata atctcatgac 1020
caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1080
aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1140
accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1200
aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1260
ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1320
agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1380
accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1440
gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 1500
tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 1560
cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 1620
cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 1680
cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 1740
ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 1800
taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 1860
gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatgctg 1920
gatccttgac agctagctca gtcctaggta taatactagt gcgtttctct gccatttttt 1980
gttttagagc tagaaatagcaagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 2040
ggcaccgagt cggtgctttt tttgaattct ctagagtcga cctgcagaag cttagatcta 2100
ttaccctgtt atccctac 2118
<210>6
<211>2118
<212>DNA
<213> Artificial Synthesis
<400>6
tcgagttcat gtgcagctcc atcagcaaaa ggggatgata agtttatcac caccgactat 60
ttgcaacagt gccgttgatc gtgctatgat cgactgatgt catcagcggt ggagtgcaat 120
gtcatgaggg aagcggtgat cgccgaagta tcgactcaac tatcagaggt agttggcgtc 180
atcgagcgcc atctcgaacc gacgttgctg gccgtacatt tgtacggctc cgcagtggat 240
ggcggcctga agccacacag tgatattgat ttgctggtta cggtgaccgt aaggcttgat 300
gaaacaacgc ggcgagcttt gatcaacgac cttttggaaa cttcggcttc ccctggagag 360
agcgagattc tccgcgctgt agaagtcacc attgttgtgc acgacgacat cattccgtgg 420
cgttatccag ctaagcgcga actgcaattt ggagaatggc agcgcaatga cattcttgca 480
ggtatcttcg agccagccac gatcgacatt gatctggcta tcttgctgac aaaagcaaga 540
gaacatagcg ttgccttggt aggtccagcg gcggaggaac tctttgatcc ggttcctgaa 600
caggatctat ttgaggcgct aaatgaaacc ttaacgctat ggaactcgcc gcccgactgg 660
gctggcgatg agcgaaatgt agtgcttacg ttgtcccgca tttggtacag cgcagtaacc 720
ggcaaaatcg cgccgaagga tgtcgctgcc gactgggcaa tggagcgcct gccggcccag 780
tatcagcccg tcatacttga agctagacag gcttatcttg gacaagaaga agatcgcttg 840
gcctcgcgcg cagatcagtt ggaagaattt gtccactacg tgaaaggcga gatcaccaag 900
gtagtcggca aataagatgc cgctcgccag tcgattggct gagctcatga agttcctatt 960
ccgaagttcc gcgaacgcgt aaaggatcta ggtgaagatc ctttttgata atctcatgac 1020
caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1080
aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1140
accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1200
aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1260
ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1320
agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1380
accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1440
gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 1500
tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 1560
cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 1620
cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 1680
cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 1740
ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 1800
taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 1860
gcgcctgatg cggtattttc tccttacgca tctgtgcggtatttcacacc gcatatgctg 1920
gatccttgac agctagctca gtcctaggta taatactagt aaaaggcaac actatgacat 1980
gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 2040
ggcaccgagt cggtgctttt tttgaattct ctagagtcga cctgcagaag cttagatcta 2100
ttaccctgtt atccctac 2118
<210>7
<211>2118
<212>DNA
<213> Artificial Synthesis
<400>7
tcgagttcat gtgcagctcc atcagcaaaa ggggatgata agtttatcac caccgactat 60
ttgcaacagt gccgttgatc gtgctatgat cgactgatgt catcagcggt ggagtgcaat 120
gtcatgaggg aagcggtgat cgccgaagta tcgactcaac tatcagaggt agttggcgtc 180
atcgagcgcc atctcgaacc gacgttgctg gccgtacatt tgtacggctc cgcagtggat 240
ggcggcctga agccacacag tgatattgat ttgctggtta cggtgaccgt aaggcttgat 300
gaaacaacgc ggcgagcttt gatcaacgac cttttggaaa cttcggcttc ccctggagag 360
agcgagattc tccgcgctgt agaagtcacc attgttgtgc acgacgacat cattccgtgg 420
cgttatccag ctaagcgcga actgcaattt ggagaatggc agcgcaatga cattcttgca 480
ggtatcttcg agccagccac gatcgacatt gatctggcta tcttgctgac aaaagcaaga 540
gaacatagcg ttgccttggt aggtccagcg gcggaggaac tctttgatcc ggttcctgaa 600
caggatctat ttgaggcgct aaatgaaacc ttaacgctat ggaactcgcc gcccgactgg 660
gctggcgatg agcgaaatgt agtgcttacg ttgtcccgca tttggtacag cgcagtaacc 720
ggcaaaatcg cgccgaagga tgtcgctgcc gactgggcaa tggagcgcct gccggcccag 780
tatcagcccg tcatacttga agctagacag gcttatcttg gacaagaaga agatcgcttg 840
gcctcgcgcg cagatcagtt ggaagaattt gtccactacg tgaaaggcga gatcaccaag 900
gtagtcggca aataagatgc cgctcgccag tcgattggct gagctcatga agttcctatt 960
ccgaagttcc gcgaacgcgt aaaggatcta ggtgaagatc ctttttgata atctcatgac 1020
caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1080
aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1140
accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1200
aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1260
ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1320
agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1380
accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1440
gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 1500
tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 1560
cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 1620
cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 1680
cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 1740
ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 1800
taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 1860
gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatgctg 1920
gatccttgac agctagctca gtcctaggta taatactagt ctttgccgta atacttcatc 1980
gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt 2040
ggcaccgagt cggtgctttt tttgaattct ctagagtcga cctgcagaag cttagatcta 2100
ttaccctgtt atccctac 2118
<210>8
<211>12545
<212>DNA
<213> Artificial Synthesis
<400>8
gatctcaaaa aaagcaccga ctcggtgcca ctttttcaag ttgataacgg actagcctta 60
ttttaacttg ctatttctag ctctaaaacc tggtaacagg attagcagat gtgtgaaatt 120
gttatccgct cacaattcca cacattatac gagccggatg attaattgtc aacagctcat 180
ttcagaatat ttgccagaac cgttatgatg tcggcgcaaa aaacattatc cagaacggga 240
gtgcgccttg agcgacacga attatgcagt gatttacgac ctgcacagcc ataccacagc 300
ttccgatggc tgcctgacgc cagaagcatt ggtgcaccgt gcagtcgatg ataagctgtc 360
aaaccagatc aattcgcgct aactcacatt aattgcgttg cgctcactgc ccgctttcca 420
gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg 480
tttgcgtatt gggcgccagg gtggtttttc ttttcaccag tgagacgggc aacagctgat 540
tgcccttcac cgcctggccc tgagagagtt gcagcaagcg gtccacgctg gtttgcccca 600
gcaggcgaaa atcctgtttg atggtggttg acggcgggat ataacatgag ctgtcttcgg 660
tatcgtcgta tcccactacc gagatatccg caccaacgcg cagcccggac tcggtaatgg 720
cgcgcattgc gcccagcgcc atctgatcgt tggcaaccag catcgcagtg ggaacgatgc 780
cctcattcag catttgcatg gtttgttgaa aaccggacat ggcactccag tcgccttccc 840
gttccgctat cggctgaatt tgattgcgag tgagatattt atgccagcca gccagacgca 900
gacgcgccga gacagaactt aatgggcccg ctaacagcgc gatttgctgg tgacccaatg 960
cgaccagatg ctccacgccc agtcgcgtac cgtcttcatg ggagaaaata atactgttga 1020
tgggtgtctg gtcagagaca tcaagaaata acgccggaac attagtgcag gcagcttcca 1080
cagcaatggc atcctggtca tccagcggat agttaatgat cagcccactg acgcgttgcg 1140
cgagaagatt gtgcaccgcc gctttacagg cttcgacgcc gcttcgttct accatcgaca 1200
ccaccacgct ggcacccagt tgatcggcgc gagatttaat cgccgcgaca atttgcgacg 1260
gcgcgtgcag ggccagactg gaggtggcaa cgccaatcag caacgactgt ttgcccgcca 1320
gttgttgtgc cacgcggttg ggaatgtaat tcagctccgc catcgccgct tccacttttt 1380
cccgcgtttt cgcagaaacg tggctggcct ggttcaccac gcgggaaacg gtctgataag 1440
agacaccggc atactctgcg acatcgtata acgttactgg tttcacattc accaccctga 1500
attgactctc ttccgggcgc tatcatgcca taccgcgaaa ggttttgcac cattcgatgg 1560
tgtcaacgta aatgcatgcc gcttcgcctt ccatgggtat ggacagtttt ccctttgata 1620
tgtaacggtg aacagttgtt ctacttttgt ttgttagtct tgatgcttca ctgatagata 1680
caagagccat aagaacctca gatccttccg tatttagcca gtatgttctc tagtgtggtt 1740
cgttgttttt gcgtgagcca tgagaacgaa ccattgagat catacttact ttgcatgtca 1800
ctcaaaaatt ttgcctcaaa actggtgagc tgaatttttg cagttaaagc atcgtgtagt 1860
gtttttctta gtccgttacg taggtaggaa tctgatgtaa tggttgttgg tattttgtca 1920
ccattcattt ttatctggtt gttctcaagt tcggttacga gatccatttg tctatctagt 1980
tcaacttgga aaatcaacgt atcagtcggg cggcctcgct tatcaaccac caatttcata 2040
ttgctgtaag tgtttaaatc tttacttatt ggtttcaaaa cccattggtt aagcctttta 2100
aactcatggt agttattttc aagcattaac atgaacttaa attcatcaag gctaatctct 2160
atatttgcct tgtgagtttt cttttgtgtt agttctttta ataaccactc ataaatcctc 2220
atagagtatt tgttttcaaa agacttaaca tgttccagat tatattttat gaattttttt 2280
aactggaaaa gataaggcaa tatctcttca ctaaaaacta attctaattt ttcgcttgag 2340
aacttggcat agtttgtcca ctggaaaatc tcaaagcctt taaccaaagg attcctgatt 2400
tccacagttc tcgtcatcag ctctctggtt gctttagcta atacaccata agcattttcc 2460
ctactgatgt tcatcatctg agcgtattgg ttataagtga acgataccgt ccgttctttc 2520
cttgtagggt tttcaatcgt ggggttgagt agtgccacac agcataaaat tagcttggtt 2580
tcatgctccg ttaagtcata gcgactaatc gctagttcat ttgctttgaa aacaactaat 2640
tcagacatac atctcaattg gtctaggtga ttttaatcac tataccaatt gagatgggct 2700
agtcaatgat aattactagt ccttttcctt tgagttgtgg gtatctgtaa attctgctag 2760
acctttgctg gaaaacttgt aaattctgct agaccctctg taaattccgc tagacctttg 2820
tgtgtttttt ttgtttatat tcaagtggtt ataatttata gaataaagaa agaataaaaa 2880
aagataaaaa gaatagatcc cagccctgtg tataactcac tactttagtc agttccgcag 2940
tattacaaaa ggatgtcgca aacgctgttt gctcctctac aaaacagacc ttaaaaccct 3000
aaaggcttaa gtagcaccct cgcaagctcg gttgcggccg caatcgggca aatcgctgaa 3060
tattcctttt gtctccgacc atcaggcacc tgagtcgctg tctttttcgt gacattcagt 3120
tcgctgcgct cacggctctg gcagtgaatg ggggtaaatg gcactacagg cgccttttat 3180
ggattcatgc aaggaaacta cccataatac aagaaaagcc cgtcacgggc ttctcagggc 3240
gttttatggc gggtctgcta tgtggtgcta tctgactttt tgctgttcag cagttcctgc 3300
cctctgattt tccagtctga ccacttcgga ttatcccgtg acaggtcatt cagactggct 3360
aatgcaccca gtaaggcagc ggtatcatca acggggtctg acgctcagtg gaacgaaaac 3420
tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta gatcctttta 3480
aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg gtctgacagt 3540
tacgtttcca caaccaatta accaattctg attagaaaaa ctcatcgagc atcaaatgaa 3600
actgcaattt attcatatca ggattatcaa taccatattt ttgaaaaagc cgtttctgta 3660
atgaaggaga aaactcaccg aggcagttcc ataggatggc aagatcctgg tatcggtctg 3720
cgattccgac tcgtccaaca tcaatacaac ctattaattt cccctcgtca aaaataaggt 3780
tatcaagtga gaaatcacca tgagtgacga ctgaatccgg tgagaatggc aaaagcttat 3840
gcatttcttt ccagacttgt tcaacaggcc agccattacg ctcgtcatca aaatcactcg 3900
catcaaccaa accgttattc attcgtgatt gcgcctgagc gagacgaaat acgcgatcgc 3960
tgttaaaagg acaattacaa acaggaatcg aatgcaaccg gcgcaggaac actgccagcg 4020
catcaacaat attttcacct gaatcaggat attcttctaa tacctggaat gctgttttcc 4080
cggggatcgc agtggtgagt aaccatgcat catcaggagt acggataaaa tgcttgatgg 4140
tcggaagagg cataaattcc gtcagccagt ttagtctgac catctcatct gtaacatcat 4200
tggcaacgct acctttgcca tgtttcagaa acaactctgg cgcatcgggc ttcccataca 4260
atcgatagat tgtcgcacct gattgcccga cattatcgcg agcccattta tacccatata 4320
aatcagcatc catgttggaa tttaatcgcg gcctcgagca agacgtttcc cgttgaatat 4380
ggctcataac accccttgta ttactgttta tgtaagcaga cagttttatt gttcatgatg 4440
atatattttt atcttgtgca atgtaacatc agagattttg agacacaacg tggctttccc 4500
tgcagggttt gcagtcagag tagaatagaa gtatcaaaaa aagcaccgac tcggtgccac 4560
tttttcaagt tgataacgga ctagccttat tttaacttgc tatgctgttt tgaatggttc 4620
caacaagatt attttataac ttttataaca aataatcaag gagaaattca aagaaattta 4680
tcagccataa aacaatactt aatactatag aatgataaca aaataaacta ctttttaaaa 4740
gaattttgtg ttataatcta tttattatta agtattgggt aatatttttt gaagagatat 4800
tttgaaaaag aaaaattaaa gcatattaaa ctaatttcgg aggtcattaa aactattatt 4860
gaaatcatca aactcattat ggatttaatt taaacttttt attttaggag gcaaaaatgg 4920
ataagaaata ctcaataggc ttagatatcg gcacaaatag cgtcggatgg gcggtgatca 4980
ctgatgatta taaggttccg tctaaaaagt tcaaggttct gggaaataca gaccgccaca 5040
gtatcaaaaa aaatcttata ggggctcttt tatttgacag tggagagaca gcggaagcga 5100
ctcgtctcaa acggacagct cgtagaaggt atacacgtcg gaagaatcgt atttgttatc 5160
tacaggagat tttttcaaat gagatggcga aagtagatga tagtttcttt catcgacttg 5220
aagagtcttt tttggtggaa gaagacaaga agcatgaacg tcatcctatt tttggaaata 5280
tagtagatga agttgcttat catgagaaat atccaactat ctatcatctg cgaaaaaaat 5340
tggtagattc tactgataaa gcggatttgc gcttaatcta tttggcctta gcgcatatga 5400
ttaagtttcg tggtcatttt ttgattgagg gagatttaaa tcctgataat agtgatgtgg 5460
acaaactatt tatccagttg gtacaaacct acaatcaatt atttgaagaa aaccctatta 5520
acgcaagtgg agtagatgct aaagcgattc tttctgcacg attgagtaaa tcaagacgat 5580
tagaaaatct cattgctcag ctccccggtg agaagaaaaa tggcttattt gggaatctca 5640
ttgctttgtc attgggtttg acccctaatt ttaaatcaaa ttttgatttg gcagaagatg 5700
ctaaattaca gctttcaaaa gatacttacg atgatgattt agataattta ttggcgcaaa 5760
ttggagatca atatgctgat ttgtttttgg cagctaagaa tttatcagat gctattttac 5820
tttcagatat cctaagagta aatactgaaa taactaaggc tcccctatca gcttcaatga 5880
ttaaacgcta cgatgaacat catcaagact tgactctttt aaaagcttta gttcgacaac 5940
aacttccaga aaagtataaa gaaatctttt ttgatcaatc aaaaaacgga tatgcaggtt 6000
atattgatgg gggagctagc caagaagaat tttataaatt tatcaaacca attttagaaa 6060
aaatggatgg tactgaggaa ttattggtga aactaaatcg tgaagatttg ctgcgcaagc 6120
aacggacctt tgacaacggc tctattcccc atcaaattca cttgggtgag ctgcatgcta 6180
ttttgagaag acaagaagac ttttatccat ttttaaaaga caatcgtgag aagattgaaa 6240
aaatcttgac ttttcgaatt ccttattatg ttggtccatt ggcgcgtggc aatagtcgtt 6300
ttgcatggat gactcggaag tctgaagaaa caattacccc atggaatttt gaagaagttg 6360
tcgataaagg tgcttcagct caatcattta ttgaacgcat gacaaacttt gataaaaatc 6420
ttccaaatga aaaagtacta ccaaaacata gtttgcttta tgagtatttt acggtttata 6480
acgaattgac aaaggtcaaa tatgttactg aaggaatgcg aaaaccagca tttctttcag 6540
gtgaacagaa gaaagccatt gttgatttac tcttcaaaac aaatcgaaaa gtaaccgtta 6600
agcaattaaa agaagattat ttcaaaaaaa tagaatgttt tgatagtgtt gaaatttcag 6660
gagttgaaga tagatttaat gcttcattag gtacctacca tgatttgcta aaaattatta 6720
aagataaaga ttttttggat aatgaagaaa atgaagatat cttagaggat attgttttaa 6780
cattgacctt atttgaagat agggagatga ttgaggaaag acttaaaaca tatgctcacc 6840
tctttgatga taaggtgatg aaacagctta aacgtcgccg ttatactggt tggggacgtt 6900
tgtctcgaaa attgattaat ggtattaggg ataagcaatc tggcaaaaca atattagatt 6960
ttttgaaatc agatggtttt gccaatcgca attttatgca gctgatccat gatgatagtt 7020
tgacatttaa agaagacatt caaaaagcac aagtgtctgg acaaggcgat agtttacatg 7080
aacatattgc aaatttagct ggtagccctg ctattaaaaa aggtatttta cagactgtaa 7140
aagttgttga tgaattggtc aaagtaatgg ggcggcataa gccagaaaat atcgttattg 7200
aaatggcacg tgaaaatcag acaactcaaa agggccagaa aaattcgcga gagcgtatga 7260
aacgaatcga agaaggtatc aaagaattag gaagtcagat tcttaaagag catcctgttg 7320
aaaatactca attgcaaaat gaaaagctct atctctatta tctccaaaat ggaagagaca 7380
tgtatgtgga ccaagaatta gatattaatc gtttaagtga ttatgatgtc gatcacattg 7440
ttccacaaag tttccttaaa gacgattcaa tagacaataa ggtcttaacg cgttctgata 7500
aaaatcgtgg taaatcggat aacgttccaa gtgaagaagt agtcaaaaag atgaaaaact 7560
attggagaca acttctaaac gccaagttaa tcactcaacg taagtttgat aatttaacga 7620
aagctgaacg tggaggtttg agtgaacttg ataaagctgg ttttatcaaa cgccaattgg 7680
ttgaaactcg ccaaatcact aagcatgtgg cacaaatttt ggatagtcgc atgaatacta 7740
aatacgatga aaatgataaa cttattcgag aggttaaagt gattacctta aaatctaaat 7800
tagtttctga cttccgaaaa gatttccaat tctataaagt acgtgagatt aacaattacc 7860
atcatgccca tgatgcgtat ctaaatgccg tcgttggaac tgctttgatt aagaaatatc 7920
caaaacttga atcggagttt gtctatggtg attataaagt ttatgatgtt cgtaaaatga 7980
ttgctaagtc tgagcaagaa ataggcaaag caaccgcaaa atatttcttt tactctaata 8040
tcatgaactt cttcaaaaca gaaattacac ttgcaaatgg agagattcgc aaacgccctc 8100
taatcgaaac taatggggaa actggagaaa ttgtctggga taaagggcga gattttgcca 8160
cagtgcgcaa agtattgtcc atgccccaag tcaatattgt caagaaaacagaagtacaga 8220
caggcggatt ctccaaggag tcaattttac caaaaagaaa ttcggacaag cttattgctc 8280
gtaaaaaaga ctgggatcca aaaaaatatg gtggttttga tagtccaacg gtagcttatt 8340
cagtcctagt ggttgctaag gtggaaaaag ggaaatcgaa gaagttaaaa tccgttaaag 8400
agttactagg gatcacaatt atggaaagaa gttcctttga aaaaaatccg attgactttt 8460
tagaagctaa aggatataag gaagttaaaa aagacttaat cattaaacta cctaaatata 8520
gtctttttga gttagaaaac ggtcgtaaac ggatgctggc tagtgccgga gaattacaaa 8580
aaggaaatga gctggctctg ccaagcaaat atgtgaattt tttatattta gctagtcatt 8640
atgaaaagtt gaagggtagt ccagaagata acgaacaaaa acaattgttt gtggagcagc 8700
ataagcatta tttagatgag attattgagc aaatcagtga attttctaag cgtgttattt 8760
tagcagatgc caatttagat aaagttctta gtgcatataa caaacataga gacaaaccaa 8820
tacgtgaaca agcagaaaat attattcatt tatttacgtt gacgaatctt ggagctcccg 8880
ctgcttttaa atattttgat acaacaattg atcgtaaacg atatacgtct acaaaagaag 8940
ttttagatgc cactcttatc catcaatcca tcactggtct ttatgaaaca cgcattgatt 9000
tgagtcagct aggaggtgac tgaagtatat tttagatgaa gattatttct taatctagac 9060
atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca 9120
tttccccgaa aagtgccacc tgcatcgatt tattatgaca acttgacggc tacatcattc 9180
actttttctt cacaaccggc acggaactcg ctcgggctgg ccccggtgca ttttttaaat 9240
acccgcgaga aatagagttg atcgtcaaaa ccaacattgc gaccgacggt ggcgataggc 9300
atccgggtgg tgctcaaaag cagcttcgcc tggctgatac gttggtcctc gcgccagctt 9360
aagacgctaa tccctaactg ctggcggaaa agatgtgaca gacgcgacgg cgacaagcaa 9420
acatgctgtg cgacgctggc gatatcaaaa ttgctgtctg ccaggtgatc gctgatgtac 9480
tgacaagcct cgcgtacccg attatccatc ggtggatgga gcgactcgtt aatcgcttcc 9540
atgcgccgca gtaacaattg ctcaagcaga tttatcgcca gcagctccga atagcgccct 9600
tccccttgcc cggcgttaat gatttgccca aacaggtcgc tgaaatgcgg ctggtgcgct 9660
tcatccgggc gaaagaaccc cgtattggca aatattgacg gccagttaag ccattcatgc 9720
cagtaggcgc gcggacgaaa gtaaacccac tggtgatacc attcgcgagc ctccggatga 9780
cgaccgtagt gatgaatctc tcctggcggg aacagcaaaa tatcacccgg tcggcaaaca 9840
aattctcgtc cctgattttt caccaccccc tgaccgcgaa tggtgagatt gagaatataa 9900
cctttcattc ccagcggtcg gtcgataaaa aaatcgagat aaccgttggc ctcaatcggc 9960
gttaaacccg ccaccagatg ggcattaaac gagtatcccg gcagcagggg atcattttgc 10020
gcttcagcca tacttttcat actcccgcca ttcagagaag aaaccaattg tccatattgc 10080
atcagacatt gccgtcactg cgtcttttac tggctcttct cgctaaccaa accggtaacc 10140
ccgcttatta aaagcattct gtaacaaagc gggaccaaag ccatgacaaa aacgcgtaac 10200
aaaagtgtct ataatcacgg cagaaaagtc cacattgatt atttgcacgg cgtcacactt 10260
tgctatgcca tagcattttt atccataaga ttagcggatc ctacctgacg ctttttatcg 10320
caactctcta ctgtttctcc atacccgttt ttttgggaat tcgagctcta aggaggttat 10380
aaaaaatgga tattaatact gaaactgaga tcaagcaaaa gcattcacta accccctttc 10440
ctgttttcct aatcagcccg gcatttcgcg ggcgatattt tcacagctat ttcaggagtt 10500
cagccatgaa cgcttattac attcaggatc gtcttgaggc tcagagctgg gcgcgtcact 10560
accagcagct cgcccgtgaa gagaaagagg cagaactggc agacgacatg gaaaaaggcc 10620
tgccccagca cctgtttgaa tcgctatgca tcgatcattt gcaacgccac ggggccagca 10680
aaaaatccat tacccgtgcg tttgatgacg atgttgagtt tcaggagcgc atggcagaac 10740
acatccggta catggttgaa accattgctc accaccaggt tgatattgat tcagaggtat 10800
aaaacgaatg agtactgcac tcgcaacgct ggctgggaag ctggctgaac gtgtcggcat 10860
ggattctgtc gacccacagg aactgatcac cactcttcgc cagacggcat ttaaaggtga 10920
tgccagcgat gcgcagttca tcgcattact gatcgttgcc aaccagtacg gccttaatcc 10980
gtggacgaaa gaaatttacg cctttcctga taagcagaat ggcatcgttc cggtggtggg 11040
cgttgatggc tggtcccgca tcatcaatga aaaccagcag tttgatggca tggactttga 11100
gcaggacaat gaatcctgta catgccggat ttaccgcaag gaccgtaatc atccgatctg 11160
cgttaccgaa tggatggatg aatgccgccg cgaaccattc aaaactcgcg aaggcagaga 11220
aatcacgggg ccgtggcagt cgcatcccaa acggatgtta cgtcataaag ccatgattca 11280
gtgtgcccgt ctggccttcg gatttgctgg tatctatgac aaggatgaag ccgagcgcat 11340
tgtcgaaaat actgcataca ctgcagaacg tcagccggaa cgcgacatca ctccggttaa 11400
cgatgaaacc atgcaggaga ttaacactct gctgatcgcc ctggataaaa catgggatga 11460
cgacttattg ccgctctgtt cccagatatt tcgccgcgac attcgtgcat cgtcagaact 11520
gacacaggcc gaagcagtaa aagctcttgg attcctgaaa cagaaagccg cagagcagaa 11580
ggtggcagca tgacaccgga cattatcctg cagcgtaccg ggatcgatgt gagagctgtc 11640
gaacaggggg atgatgcgtg gcacaaatta cggctcggcg tcatcaccgc ttcagaagtt 11700
cacaacgtga tagcaaaacc ccgctccgga aagaagtggc ctgacatgaa aatgtcctac 11760
ttccacaccc tgcttgctga ggtttgcacc ggtgtggctc cggaagttaa cgctaaagca 11820
ctggcctggg gaaaacagta cgagaacgac gccagaaccc tgtttgaatt cacttccggc 11880
gtgaatgtta ctgaatcccc gatcatctat cgcgacgaaa gtatgcgtac cgcctgctct 11940
cccgatggtt tatgcagtga cggcaacggc cttgaactga aatgcccgtt tacctcccgg 12000
gatttcatga agttccggct cggtggtttc gaggccataa agtcagctta catggcccag 12060
gtgcagtaca gcatgtgggt gacgcgaaaa aatgcctggt actttgccaa ctatgacccg 12120
cgtatgaagc gtgaaggcct gcattatgtc gtgattgagc gggatgaaaa gtacatggcg 12180
agttttgacg agatcgtgcc ggagttcatc gaaaaaatgg acgaggcact ggctgaaatt 12240
ggttttgtat ttggggagca atggcgatga cgcatcctca cgataatatc cgggtaggcg 12300
caatcacttt cgtctactcc gttacaaagc gaggctgggt atttcccggc ctttctgtta 12360
tccgaaatcc actgaaagca cagcggctgg ctgaggagat aaataataaa cgaggggctg 12420
tatgcacaaa gcatcttctg ttgagttaag aacgagtatc gagatggcac atagccttgc 12480
tcaaattgga atcaggtttg tgccaatacc agtagaaaca gacgaagaat ccatgggtat 12540
ggaca 12545
<210>9
<211>60
<212>DNA
<213> Artificial Synthesis
<400>9
tcggtgcttt ttttgaattc tttttcggta ctactaagac tattcgttaa tgataaaccc 60
<210>10
<211>32
<212>DNA
<213> Artificial Synthesis
<400>10
gtcgttactc aaacgcaggt cgaggtcaaa ag 32
<210>11
<211>37
<212>DNA
<213> Artificial Synthesis
<400>11
acctgcgttt gagtaacgac aatcctctcc ataacgc 37
<210>12
<211>74
<212>DNA
<213> Artificial Synthesis
<400>12
taacaattcc cctctagaaa taattttgtt taactttaag aaggagatat accatggcag 60
agaaacgcaa tatc 74
<210>13
<211>90
<212>DNA
<213> Artificial Synthesis
<400>13
attatttcta gaggggaatt gttatccgct cacaattccc ctatagtgag tcgtattaaa 60
gcttagatct attaccctgt tatccctact 90
<210>14
<211>25
<212>DNA
<213> Artificial Synthesis
<400>14
gaattcaaaa aaagcaccga ctcgg 25
<210>15
<211>56
<212>DNA
<213> Artificial Synthesis
<400>15
tcggtgcttt ttttgaattc gtaaaattta tgacaatgaa cattaccagc aaacaa 56
<210>16
<211>67
<212>DNA
<213> Artificial Synthesis
<400>16
gttttccgat gtcatgcggc cgcacctcct ttgtgaaaac acattatacg agccgatgat 60
taattgt 67
<210>17
<211>42
<212>DNA
<213> Artificial Synthesis
<400>17
aggcaacact ttgacaatta atcatcggct cgtataatgt gt 42
<210>18
<211>45
<212>DNA
<213> Artificial Synthesis
<400>18
agggtaatag atctaagctt taaatcagta gtgccggaga ccaac 45
<210>19
<211>32
<212>DNA
<213> Artificial Synthesis
<400>19
aagcttagat ctattaccct gttatcccta ct 32
<210>20
<211>25
<212>DNA
<213> Artificial Synthesis
<400>20
gaattcaaaa aaagcaccga ctcgg 25
<210>21
<211>41
<212>DNA
<213> Artificial Synthesis
<400>21
tcggtgcttt ttttgaattc gttgaccacg ttccagcctt t 41
<210>22
<211>25
<212>DNA
<213> Artificial Synthesis
<400>22
ctgatgcgct ggcggtggtc gtggt 25
<210>23
<211>29
<212>DNA
<213> Artificial Synthesis
<400>23
gaccaccgcc agcgcatcag gcattgtgt 29
<210>24
<211>35
<212>DNA
<213> Artificial Synthesis
<400>24
agggtaatag atctaagctt cgctgatggc gctgg 35
<210>25
<211>32
<212>DNA
<213> Artificial Synthesis
<400>25
aagcttagat ctattaccct gttatcccta ct 32
<210>26
<211>25
<212>DNA
<213> Artificial Synthesis
<400>26
gaattcaaaa aaagcaccga ctcgg 25

Claims (9)

1. A recombinant Escherichia coli for producing L-tryptophan is characterized in that a promoter replacing shikimate kinase gene aroK is a T7 promoter, a promoter knocking out tryptophan transporter encoding gene mtr and replacing prephenate dehydrogenase encoding gene pheA is a tac promoter; the nucleotide sequence of the tac promoter is shown as SEQ ID NO. 1.
2. The recombinant Escherichia coli of claim 1, wherein the recombinant Escherichia coli is obtained by genome editing of Escherichia coli CICC 10303.
3. The recombinant escherichia coli of claim 2, wherein said genome editing is performed using CRISPR-Cas9 technology.
4. The method for constructing recombinant E.coli of any one of claims 1 to 3, wherein said method comprises the steps of:
1) constructing a T7 promoter replacing recombinant fragment, a tac promoter replacing recombinant fragment and a knockout mtr gene recombinant fragment: after fusing upstream and downstream homologous arm sequences of an initiation codon of an aroK gene cluster of a shikimic acid kinase coding gene of escherichia coli, introducing a T7 promoter to obtain a recombinant fragment T7 AROK; fusing the upstream and downstream homologous arm sequences of the initiation codon of the prephenate dehydrogenase encoding gene pheA, and introducing a promoter tac to obtain a fragment TACPHE; fusing the upstream and downstream homologous arms of the tryptophan transporter coding gene mtr to obtain a fragment MTRD.
2) Constructing a recombinant plasmid: connecting the fragments T7AROK, TACPHE and MTRD with a linearized vector containing sgRNA respectively to obtain a recombinant plasmid containing T7AROK, a recombinant plasmid containing TACPHE and a recombinant plasmid containing MTRD of the recombinant plasmid;
3) constructing recombinant escherichia coli: transforming the plasmid containing cas9 protein into Escherichia coli CICC10303 to obtain Escherichia coli CICC10303-cas 9; then transforming the recombinant plasmid containing T7AROK into Escherichia coli CICC10303-cas9 to obtain recombinant Escherichia coli CICC 10303-aroKT; transforming the recombinant plasmid containing TACPHE into Escherichia coli CICC 10303-aroKT to obtain recombinant Escherichia coli CICC 10303-pheAT; transforming the recombinant plasmid containing MTRD into Escherichia coli CICC10303-pheAT to obtain recombinant Escherichia coli CICC 10303-mtrD; after the exogenous plasmid is removed, the recombinant Escherichia coli CICC10303-TRYP is obtained.
5. The method of construction according to claim 4, wherein the plasmid containing cas9 protein is pCas 9.
6. The construction method according to claim 4 or 5, wherein the T7 AROK-containing recombinant plasmid sequence is shown as SEQ ID No.5, the TACPHE-containing recombinant plasmid sequence is shown as SEQ ID No.6, and the MTRD-containing recombinant plasmid sequence is shown as SEQ ID No. 7.
7. Use of the recombinant E.coli strain of any one of claims 1 to 3 for the production of L-tryptophan.
8. The use of claim 7, wherein the use comprises inoculating a single colony cultured in a plate medium at 34-38 ℃ for 22-26h to a seed medium, culturing at 34-38 ℃ and 180-.
9. Use of the recombinant E.coli of any one of claims 1 to 3 for the industrial production of L-tryptophan in feed, pharmaceuticals, nutraceuticals or foods.
CN201811465696.XA 2018-12-03 2018-12-03 Recombinant escherichia coli with high L-tryptophan yield and construction method thereof Active CN109486737B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201811465696.XA CN109486737B (en) 2018-12-03 2018-12-03 Recombinant escherichia coli with high L-tryptophan yield and construction method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201811465696.XA CN109486737B (en) 2018-12-03 2018-12-03 Recombinant escherichia coli with high L-tryptophan yield and construction method thereof

Publications (2)

Publication Number Publication Date
CN109486737A CN109486737A (en) 2019-03-19
CN109486737B true CN109486737B (en) 2020-09-04

Family

ID=65699086

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201811465696.XA Active CN109486737B (en) 2018-12-03 2018-12-03 Recombinant escherichia coli with high L-tryptophan yield and construction method thereof

Country Status (1)

Country Link
CN (1) CN109486737B (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110343653B (en) * 2019-07-30 2021-06-25 江南大学 Method for improving yield of 1,2,4-butanetriol by knocking out aldehyde dehydrogenase gene of escherichia coli
CN111235079A (en) * 2019-08-09 2020-06-05 山东汇冠康博生物科技有限公司 Method for screening escherichia coli with high tryptophan yield
WO2021042460A1 (en) * 2019-09-03 2021-03-11 宁夏伊品生物科技股份有限公司 Application of transport carrier gene which improves l-tryptophan production efficiency in escherichia coli
CN112980891B (en) * 2019-12-16 2023-12-12 中国科学院分子植物科学卓越创新中心 Coli genome editing tool based on CRISPR-Cas
CN111154706B (en) * 2020-01-13 2021-05-11 江南大学 Recombinant escherichia coli with improved L-tryptophan yield as well as construction method and application thereof
CN113388631B (en) * 2020-03-12 2022-08-09 天津大学 Recombinant bacterium for high-yield IgG1 and construction method
CN115975894A (en) * 2022-09-20 2023-04-18 上海市农业科学院 Recombinant escherichia coli capable of fermenting and synthesizing Terequinone A as well as preparation method and application thereof

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102140431B (en) * 2010-12-21 2014-08-27 大成生化科技(松原)有限公司 L-tryptophan gene engineering bacterium, method for constructing same and method for fermenting and producing L-tryptophan by using same
CN102168118B (en) * 2011-01-31 2013-01-30 安徽丰原发酵技术工程研究有限公司 Method for increasing fermentation output of tryptophan
US9540652B2 (en) * 2011-09-02 2017-01-10 The Regents Of The University Of California Metabolic engineering of the shikimate pathway
CN102994439A (en) * 2012-12-12 2013-03-27 江南大学 Escherichia coli recombinant strain producing shikimic acid, and construction method and application thereof
US9663768B2 (en) * 2014-09-02 2017-05-30 University Of Georgia Research Foundation, Inc. Precursor-directed biosynthesis of 5-hydroxytryptophan
CN104388330B (en) * 2014-09-26 2017-09-22 廊坊梅花生物技术开发有限公司 A kind of method of L tryptophans fermentation strain and its fermenting and producing L tryptophans
CN105087703A (en) * 2015-08-06 2015-11-25 安徽丰原发酵技术工程研究有限公司 Fermentation production method of L-tryptophan

Also Published As

Publication number Publication date
CN109486737A (en) 2019-03-19

Similar Documents

Publication Publication Date Title
CN109486737B (en) Recombinant escherichia coli with high L-tryptophan yield and construction method thereof
DK2640740T3 (en) MUTEINS OF HUMAN LIPOCALIN 2 WITH AFFINITY FOR GLYPICAN-3 (GPC3)
CN107641631A (en) A kind of method that bacillus coli gene is knocked out based on CRISPR/Cas9 systems by chemical conversion mediation
KR101974044B1 (en) Muteins of human lipocalin 2(Lcn2, hNGAL) with affinity for a given target
CN108350412B (en) Method for producing aldehyde
CN109952380B (en) Method for producing target substance
CN109890970B (en) Method for producing target substance
CN108148797B (en) Method for producing N-acetylglucosamine by co-utilizing glucose and xylose based on CRISPR
CN106591344A (en) Escherichia coli thermally-induced soluble protein expression vector fused with molecular chaperone label and application thereof
CN108026548A (en) The method that biology prepares methacrylic acid and its derivative
CN110964678B (en) Genetically engineered bacterium for synthesizing farnesene and construction method and application thereof
CN101603023B (en) Recombinant escherichia coli of temperature-control coexpression exogenous gene and application thereof
CN114457100B (en) Escherichia coli gene editing system based on CRISPR/Cpf1 and application thereof
CN109554322B (en) Recombinant Escherichia coli with high L-threonine yield and construction method thereof
CN112430617A (en) Plasmid with negative selection marker for gene modification of corynebacterium glutamicum
CN109963947B (en) Method for producing L-methionine or a metabolite requiring S-adenosylmethionine for synthesis
CN112226451A (en) Bacillus subtilis expression system and method for producing alpha-L-AFs by using same
US8357521B2 (en) Method for producing a biobutanol using a thiolase with improved activity
CN106755031B (en) Rhamnolipid production plasmid, construction method thereof, escherichia coli engineering bacteria and application
CN101993885A (en) Novel high-efficiency recombinant plasmid vector and application thereof
CN114672508B (en) Construction method of natamycin high-yield strain, strain and application
CN112080493B (en) Method for preparing tandem repeat DNA, related biological material and application
CN107502619B (en) Lactobacillus casei gene knockout vector and application thereof
CN115505595B (en) Metabolizing engineering modified clostridium soloneicum and application thereof
CN110964680B (en) Engineering strain and method for preparing farnesene by using cellulose

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant