CN107502619B - Lactobacillus casei gene knockout vector and application thereof - Google Patents
Lactobacillus casei gene knockout vector and application thereof Download PDFInfo
- Publication number
- CN107502619B CN107502619B CN201710696363.7A CN201710696363A CN107502619B CN 107502619 B CN107502619 B CN 107502619B CN 201710696363 A CN201710696363 A CN 201710696363A CN 107502619 B CN107502619 B CN 107502619B
- Authority
- CN
- China
- Prior art keywords
- vector
- lactobacillus casei
- lox66
- gene
- lox71
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/335—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Lactobacillus (G)
Abstract
The invention discloses a group of lactobacillus casei gene knockout vectors, which comprise a special vector pMSP456 mediating homologous recombination between an exogenous double-stranded DNA knockout box up-lox66-cat-lox71-down and homologous sequences on a chromosome and a special vector pMSPcre mediating recombination reaction between lox66 and lox71 sites so as to excise a resistance gene; wherein the nucleotide sequence of the vector pMSP456 is shown as SEQ ID No.1, and the nucleotide sequence of the vector pMSPcre is shown as SEQ ID No. 2. The invention also discloses application of the vector in constructing a lactobacillus casei gene knockout mutant strain. Experiments prove that the carrier pMSP456 and pMSPcre of the invention are used for knocking out the lactobacillus casei gene, the knocking-out efficiency reaches 100 percent, the operation is simple, the time consumption is short, and the invention has wide application prospect in the lactobacillus casei metabolic engineering.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and relates to a group of special gene knockout vectors, in particular to a special vector for mediating homologous recombination between an exogenous double-stranded DNA knockout box (up-lox66-cat-lox71-down) and homologous sequences on a chromosome, a special vector for mediating recombination reaction between lox66 and lox71 sites so as to excise a resistance gene, and application thereof in efficiently and quickly constructing a lactobacillus casei gene knockout mutant strain.
Background
Lactobacillus casei is a gram-positive bacterium and is widely used in dairy processing. At present, lactobacillus casei has obvious probiotic effects on hosts, such as regulating inflammation, promoting immunity, improving gastrointestinal dysfunction, preventing allergy and the like, so that lactobacillus casei is often used as probiotic bacteria to be applied to the development and production of health care products and health drinks. However, when the physiological function and action mechanism of the strain are further researched and lactobacillus casei is genetically modified, a high-efficiency genetic operation tool is lacked.
Currently, lactobacillus casei gene knockout and site-specific insertion vectors mainly comprise two types: the principle of the conditional integration vector and the integration vector with a reverse screening marker is to utilize host self recombinase RecA mediated homologous double exchange. Due to the fact that activity of recombinase RecA expressed at a background level is low, homologous recombination efficiency is low, operation steps are complex, and the RecA expressed at a background level becomes a limiting factor for limiting genetic modification of lactobacillus casei. With the rapid development of genome sequencing technology, new recombinase functional genomes are discovered and applied, and the possibility of constructing novel vectors of lactobacillus casei is provided. However, no patent is reported about a special vector pMSP456 for mediating homologous recombination between an exogenous double-stranded DNA knockout box (up-lox66-cat-lox71-down) and homologous sequences on a chromosome and a special vector pMSPcre for mediating recombination reaction between lox66 and lox71 sites so as to excise a resistance gene and application thereof.
Disclosure of Invention
Aiming at the defects of the existing gene knockout vectors, the invention provides a group of lactobacillus casei gene knockout vectors and application thereof.
The group of lactobacillus casei gene knockout vectors comprise a special vector for mediating homologous recombination between an exogenous double-stranded DNA knockout box up-lox66-cat-lox71-down and homologous sequences on a chromosome, which is named as pMSP456 and a special vector for mediating recombination reaction between lox66 and lox71 sites so as to excise a resistance gene, and which is named as pMSPcre;
wherein:
the vector pMSP456 consists of recombinase L CAB L _13040, L CAB L _13050 and L CAB L _13060, namely L CAB L _13040-50-60, replication initiation proteins RepD, RepE, RepG, an erythromycin resistance screening marker and elements NisR, NisK and nisA promoters PnisA of a NICE induced expression system, wherein the nucleotide sequence of the vector pMSP456 is shown as SEQ ID No. 1;
the vector pMSPcre consists of Cre recombinase, replication initiation proteins RepD, RepE, RepG, an erythromycin resistance screening marker and NICE inducible expression system elements NisR, NisK and nisA promoter PnisA; the nucleotide sequence is shown as SEQID No. 2.
The two lactobacillus casei gene knockout special-purpose vector construction methods and the steps are as follows:
(1) design of amplification primers (PAGE purification, Beijing ancient China Changsheng Biotechnology Limited liability Co.).
Primers used for amplifying L CAB L _ 13040-50-60:
456F：5’-AACTGCAGATGACCATGCTTGATTACAACACAG-3’
456R：5’-AATCTAGACTACTCGACTAGCTCATCCATGCT-3’
primers used for amplification of cre:
creF：5’-AACTGCAGACATGTCCAATTTACTGACCGTAC-3’
creR：5’-ACGCGTCGACTTAATCGCCATCTTCCAGCA-3’
underlined sequences represent added cleavage sites:
PstI：CTGCAG；
XbaI:TCTAGA；
SalI:GTCGAC。
after synthesis, the mixture is prepared by ultrapure water according to the concentration of 10 MuM and the temperature is 20 ℃ below zero for standby.
(2) L CAB L _13040-50-60 and cre fragment.
Amplification was performed using 2 × Primestar Max (TaKaRa) in sterile 0.2m L PCR reaction tubes, respectively, as follows:
after mixing, the PCR reaction program is that the temperature is 98 ℃ for 10s, the temperature is 55 ℃ for 10s, the temperature is 72 ℃ for Xs (X is 10 when amplifying L CAB L _13040-50-60, X is 5 when amplifying cre), 30 cycles, the temperature is 72 ℃ for 10min, and the temperature is 16 ℃.
A template used for amplifying L CAB L _13040-50-60 is lactobacillus casei B L23 chromosomal DNA;
the template used for amplifying cre is plasmid 706-cre.
(3) Vector and fragment cleavage
In a 0.5m L enzyme cutting tube, taking 40 mu L vector pMSP3535 or the fragment in (2) for enzyme cutting, wherein the enzyme cutting system is as follows:
after mixing, the mixture was reacted at 37 ℃ for 1 hour. (restriction enzymes used were purchased from TaKaRa Co.)
The used vector is pMSP3535, and the linearized vector is obtained by double enzyme digestion with PstI/XbaI and PstI/XhoI respectively.
The fragments L CAB L _13040-50-60 and cre were digested simultaneously with PstI/XbaI and PstI/SalI, respectively, to obtain digested fragments.
(4) The enzyme digestion fragment is connected with the carrier
To a 0.5m L reaction tube were added the following reagents (T4 DNA ligase from TaKaRa Co.):
after mixing, the mixture was connected at 16 ℃ for 12 hours.
(5) Preparation of E.coli DH5 α competent cells and transformation of ligation products
Selecting newly activated Escherichia coli DH5 α single colony from L B plate, inoculating in 5m L L B liquid culture medium (10.0g peptone, 5.0g yeast powder, 5.0g NaCl dissolved in 1L distilled water), shake culturing at 37 deg.C for about 12 hr until late logarithmic growth phase, inoculating the bacterial suspension in 2% ratio in 100m L L B liquid culture medium, shake culturing at 37 deg.C for 1.5-2 hr to OD600About 0.4.
The culture solution was transferred to a centrifuge tube, and after ice-bath for 10min, 6,000g × 5min at 4 ℃.
The supernatant was discarded and the residue was washed with pre-cooled 10M L0.1.1M CaCl2The solution gently suspended cells, ice bath for 15min, 4 ℃ 6,000g × 5 min.
The supernatant was discarded and 4M L was added to pre-cool 0.1M CaCl containing 10% glycerol2Solution, gently suspend cells.
Competent cells were divided into 100. mu. L aliquots and stored at-80 ℃ for storage.
A100. mu. L competent cell suspension was taken from a-80 ℃ freezer and immediately thawed on ice.
Add 10. mu. L (4) of the ligation mixture to the flask, shake gently, ice-wash for 30 min.
The mixture was heated in a 42 ℃ water bath for 90s and quickly placed on ice for 3 min.
500 μ L L B liquid medium was added to the tube and resuscitated at 37 ℃ for 2 h.
100 μ L were plated on a screening plate containing L erythromycin L B at a final concentration of 250 μ g/m and incubated at 37 ℃.
(6) Verification of pMSP456 and pMSPcre vectors
Several monoclonals are randomly picked from a plate and cultured in 5m L L B liquid culture medium containing erythromycin with the final concentration of 250 mu g/m L at 37 ℃ overnight, pMSP456 and pMSPcre are extracted and are respectively cut and verified by PstI/XbaI and PstI, the result is in accordance with the expectation, and then sequencing is sent (Botany Biotechnology (Shanghai) Limited company), the nucleotide sequence of the vector pMSP456 is shown in SEQ ID No.1, and the nucleotide sequence of the vector pMSPcre is shown in SEQ ID No. 2.
(7) Plasmid extraction, DNA fragment gel recovery and purification
(3) In the step (6), Plasmid Extraction adopts a kit Plasmid Mini kit (Omega), and recovery and purification of DNA fragment Gel adopt Gel Extraction kit (Omega) and Cycle-Pure kit (Omega). Strictly following the instructions provided in the kit, ddH was finally used2And (4) eluting with O.
The invention discloses application of a lactobacillus casei gene knockout vector in constructing a lactobacillus casei gene knockout mutant strain.
When the vector is used for knocking out the genes of the lactobacillus casei, firstly, three recombinase L CAB L _13040, L CAB L _13050 and L CAB L _13060 expressed by the vector pMSP456 are subjected to recombination reaction between an up-lox66-cat-lox71-down exogenous double-stranded DNA knockout box and homologous sequences on a chromosome, the target gene is replaced by lox66-cat-lox71, then, recombinase Cre mediated lox66 and lox71 sites expressed by the vector pMSPcre are subjected to recombination reaction to remove the chloramphenicol resistance gene cat, the target gene is replaced by a lox72 site, knocking out the target gene is realized, and the lactobacillus casei knockout mutant strain can be obtained.
The invention has the outstanding effects that:
1. the invention discloses a special vector for knocking out a lactobacillus casei gene, overcomes the defects of a conditional replication vector and a conditional replication vector method with a reverse screening marker, improves the efficiency of knocking out the lactobacillus casei gene and shortens the period of knocking out the gene.
2. The results obtained using the vector pMSP456 according to the invention confirm that: the efficiency of homologous recombination between a mediated exogenous double-stranded DNA knockout box (up-lox66-cat-lox71-down) and a chromosome is 100 percent after screening by chloramphenicol.
3. The results obtained using the vector pMSPcre according to the invention confirm that: the efficiency of pMSPcre in mediating the recombination reaction between lox66 and lox71 sites was 100%.
Drawings
FIG. 1 PCR assay of primers specific for transformed Lactobacillus casei B L23 with pMSP 456.
Wherein, lane 1: marker, GeneRuler 1 kb; lane 2: and (3) PCR fragments.
FIG. 2pMSP456 mediated replacement PCR results for the gene of interest.
Wherein, the lanes 1 and 25 are DNA Marker; lanes 2 and 24 are controls; lanes 3-23 are picked chloramphenicol resistant transformants.
FIG. 3 PCR detection of primers specific for pMSPcre transformation replacement.
Wherein, lane 1: marker, GeneRuler 1 kb; lane 2: and (3) PCR fragments.
FIG. 4 pMSPcre-mediated chloramphenicol resistance gene deletion PCR assay.
Wherein, the lanes 1 and 25 are DNA Marker; lanes 2 and 24 are controls; lanes 3-23 are 106bp galK gene fragment knock-outs.
Detailed Description
Example 1: construction of two novel special vectors for gene knockout of lactobacillus casei
(1) Design of amplification primers (PAGE purification, Beijing ancient China Changsheng Biotechnology Limited liability Co.).
Primers used for amplifying L CAB L _ 13040-50-60:
456F：5’-AACTGCAGATGACCATGCTTGATTACAACACAG-3’
456R：5’-AATCTAGACTACTCGACTAGCTCATCCATGCT-3’
primers used for amplification of cre:
creF：5’-AACTGCAGACATGTCCAATTTACTGACCGTAC-3’
creR：5’-ACGCGTCGACTTAATCGCCATCTTCCAGCA-3’
underlined sequences represent added cleavage sites:
PstI：CTGCAG；
XbaI:TCTAGA；
SalI:GTCGAC。
after synthesis, the mixture is prepared by ultrapure water according to the concentration of 10 MuM and the temperature is 20 ℃ below zero for standby.
(2) L CAB L _13040-50-60 and cre fragment.
Amplification was performed using 2 × Primestar Max (TaKaRa) in sterile 0.2m L PCR reaction tubes, respectively, as follows:
after mixing, the PCR reaction program is that the temperature is 98 ℃ for 10s, the temperature is 55 ℃ for 10s, the temperature is 72 ℃ for Xs (X is 10 when amplifying L CAB L _13040-50-60, X is 5 when amplifying cre), 30 cycles, the temperature is 72 ℃ for 10min, and the temperature is 16 ℃.
A template used for amplifying L CAB L _13040-50-60 is lactobacillus casei B L23 chromosomal DNA;
the template used for amplifying cre is plasmid 706-cre.
(3) Vector and fragment cleavage
In a 0.5m L enzyme cutting tube, taking 40 mu L vector pMSP3535 or the fragment in (2) for enzyme cutting, wherein the enzyme cutting system is as follows:
after mixing, the mixture was reacted at 37 ℃ for 1 hour. (restriction enzymes used were purchased from TaKaRa Co.)
The used vector is pMSP3535, and the linearized vector is obtained by double enzyme digestion with PstI/XbaI and PstI/XhoI respectively.
The fragments L CAB L _13040-50-60 and cre were digested simultaneously with PstI/XbaI and PstI/SalI, respectively, to obtain digested fragments.
(4) The enzyme digestion fragment is connected with the carrier
To a 0.5m L reaction tube were added the following reagents (T4 DNA ligase from TaKaRa Co.):
after mixing, the mixture was connected at 16 ℃ for 12 hours.
(5) Preparation of E.coli DH5 α competent cells and transformation of ligation products
Selecting newly activated Escherichia coli DH5 α single colony from L B plate, inoculating in 5m L L B liquid culture medium (10.0g peptone, 5.0g yeast powder, 5.0g NaCl dissolved in 1L distilled water), shake culturing at 37 deg.C for about 12 hr until late logarithmic growth phase, inoculating the bacterial suspension in 2% ratio in 100m L L B liquid culture medium, shake culturing at 37 deg.C for 1.5-2 hr to OD600About 0.4.
The culture solution was transferred to a centrifuge tube, and after ice-bath for 10min, 6,000g × 5min at 4 ℃.
The supernatant was discarded and the residue was washed with pre-cooled 10M L0.1.1M CaCl2The solution gently suspended cells, ice bath for 15min, 4 ℃ 6,000g × 5 min.
The supernatant was discarded and 4M L was added to pre-cool 0.1M CaCl containing 10% glycerol2Solution, gently suspend cells.
Competent cells were divided into 100. mu. L aliquots and stored at-80 ℃ for storage.
A100. mu. L competent cell suspension was taken from a-80 ℃ freezer and immediately thawed on ice.
Add 10. mu. L (4) of the ligation mixture to the flask, shake gently, ice-wash for 30 min.
The mixture was heated in a 42 ℃ water bath for 90s and quickly placed on ice for 3 min.
500 μ L L B liquid medium was added to the tube and resuscitated at 37 ℃ for 2 h.
100 μ L were plated on a screening plate containing L erythromycin L B at a final concentration of 250 μ g/m and incubated at 37 ℃.
(6) Verification of pMSP456 and pMSPcre vectors
Several monoclonals are randomly picked from a plate and cultured in 5m L L B liquid culture medium containing erythromycin with the final concentration of 250 mu g/m L at 37 ℃ overnight, pMSP456 and pMSPcre are extracted and are respectively cut and verified by PstI/XbaI and PstI, and after the result meets the expected result, the sequence is sent to the sequencing (Botanshang Biotechnology (Shanghai) Co., Ltd.), the nucleotide sequence of the vector pMSP456 is shown as SEQ ID No.1, and the nucleotide sequence of the vector pMSPcre is shown as SEQ ID No. 2.
(7) Plasmid extraction, DNA fragment gel recovery and purification
(3) (6) extraction of plasmidThe Plasmid Mini kit (Omega) was used, and Gel Extraction Kits (Omega) and Cycle-Pure kit (Omega) were used for DNA fragment Gel recovery and purification. Strictly following the instructions provided in the kit, ddH was finally used2And (4) eluting with O.
Example 2: application of lactobacillus casei gene knockout vector in construction of lactobacillus casei gene knockout mutant strain and knockout efficiency identification
(1) Transferring lactobacillus casei B L23 with MRS activated overnight into 5m L SMRS according to the inoculation amount of 2%, statically culturing at 37 ℃ until OD600 is 0.30-0.60, preparing competent cells and electrically shocking a transformation vector pMSP456, after recovering for 2h, coating an MRS plate added with erythromycin with the final concentration of 5 mug/m L, picking up erythromycin resistant transformants, extracting plasmids, and detecting whether the vector is transferred or not by PCR (polymerase chain reaction) by using pMSP456 specific primers (pMSPF and pMSPR), wherein the results are shown in figure 1.
(2) After the transformants verified to be correct in step (1) were activated overnight, they were transferred to SMRS (supplemented with erythromycin at a final concentration of 5. mu.g/m L) in accordance with the inoculum size of 4%, and cultured at 37 ℃ until OD6000.20-0.25, induction to OD by adding 5ng/m L nisin600Competent cells were prepared and transformed with electric shock to a substrate double-stranded DNA galK knockout cassette (up-lox66-cat-lox71-down), recovered for 2h, spread on a chloramphenicol MRS plate added to a final concentration of 5. mu.g/m L, chloramphenicol resistant transformants were picked, chromosomal DNA was extracted, and primers galK-uF and galK-dR were PCR-detected, the results of which are shown in FIG. 2.
(3) Streaking transformants verified to be correct in the step (2) on an MRS plate added with 5 mu g/m L chloramphenicol to a final concentration, picking single colonies, transferring the single colonies into SMRS after 24 hours according to an inoculation amount of 2%, and performing static culture at 37 ℃ until OD is reached600Preparing competent cells and electrically shocking the transformation vector pMSPcre, coating on an MRS plate with a final concentration of 5 mug/m L erythromycin after 2h recovery, picking up transformants, extracting plasmids, detecting whether the vector is transformed by PCR (polymerase chain reaction) with pMSPcre specific primers (SPF and pMSPR), and obtaining the result shown in figure 3. transferring the correct transformant to 5m L with a final concentration of 5 mug/m L erythromycin MRS according to the inoculation amount of 2%, and statically culturing at 37 ℃ until OD is achieved6000.30-0.80, induced at 37 ℃ for 24h by adding 5ng/m L nisin, and streaking on MRS platesSingle colonies were picked, chromosomal DNA was extracted, and primers galK-uF and galK-dR were PCR detected, the results are shown in FIG. 4.
(4) The method for preparing competent cells and performing electrotransformation in the steps (1), (2) and (3) comprises the steps of carrying out ice bath on cells for 5min, carrying out 6000 to × 5min at 4 ℃, collecting somatic cells, washing twice by using SM buffer at 4 ℃ and carrying out 6000 to × 7min, then adding 80 microliter SMbuffer for heavy suspension to prepare the competent cells, adding a carrier with the total amount of 1 mu g in the steps (1) and (3), adding a substrate double-chain DNA galK knockout box with the total amount of 4 mu g in the step (2), uniformly mixing, transferring to an electric rotating cup, carrying out ice bath for 10min, 2000v, 400 omega, carrying out 25 mu F electric shock, carrying out 3min ice bath, adding 1m L SGS for 1h, coating a solid MRS plate added with erythromycin with the final concentration of 5 mu g/m L in the steps (1) (3), and coating a solid MRS plate added with chloramphenicol with the final concentration of 5 mu g/m L in the step (.
(5) The sequences of the specific primers (pMSPF and pMSPR) in the steps (1) and (3) are as follows:
pMSPF：5’-GTCGATAACGCGAGCATAATAAAC-3’
pMSPR：5’-AACCGTATTACCGCCTTTG-3’
(6) the culture medium and solution formulas required by the steps (1), (2), (3) and (4) are as follows:
MRS culture medium formula: 1 liter of distilled water contains: 5g of glucose, 10g of tryptone, 5g of yeast powder, 10g of beef extract, (NH)4)2C6H5O72g，C2H3O2Na·3H2O 5g，K2HPO42g，MgSO4·7H2O 0.58g，MnSO4·H2O0.25 g, Tween-801 m L, and sterilization for 30 minutes at 115 ℃.
The formula of SMRS is as follows: 10g of glycine and 136.64g of sorbitol were added to 1 liter of MRS medium. Sterilizing at 115 deg.C for 30 min.
The formula of SGMRS is as follows: 1 liter of MRS culture medium is added with 1.11g of CaCl2136.64g of sorbitol. Sterilizing at 115 deg.C for 30 min.
Formulation of SM buffer: 1 liter of distilled water contains: 326g of sucrose, 0.71g of MgCl2·H2And O. Sterilizing at 115 deg.C for 30 min.
The concentration of the mother liquor of the chloramphenicol and the erythromycin is 10mg/m L, and the mother liquor is prepared by absolute ethyl alcohol.
Nisin mother liquor is 10 μ g/m L, and is prepared by using HCl solution with pH 2.5.
(7) The substrate double-stranded DNA galK knockout box (up-lox66-cat-lox71-down) in the step (2) and (4) means that homologous arms of upstream 975bp and downstream 1,028bp of a 167bp fragment in the galactose operon are respectively positioned at two ends of a cat chloramphenicol resistance gene with lox66 and lox 71. The specific obtaining method comprises the following steps:
1) amplification primer design (Beijing Ding Guoshang biotechnology Limited liability company, PAGE purification)
The primers for amplifying the upstream homology arms are as follows:
galK-uF：TGAATAGTACAGATGTCACGAAA
galK-uR：CATACATTATACGAACGGTAAGGCATTGGTCACAAGGGTAT
the primers for amplifying the downstream homology arms are as follows:
galK-dF：TGTATGCTATACGAACGGTAATGGTGCTAAGCAACTGAACT
galK-dR：CTTCCAGCCTAAAATGTCACGA
amplification lox66-cat-lox71 primers were as follows:
catF：TACCGTTCGTATAATGTATGCTATACGAAGTTATACGAAAGTCGACGGCAATAG
catR：TACCGTTCGTATAGCATACATTATACGAAGTTATCTGTAATATAAAAACCTTCT
after the synthesis, the resulting mixture was prepared with ultrapure water at a concentration of 10. mu.M for use.
2) PCR amplification of upstream and downstream homology arms and lox66-cat-lox71
Amplification was performed using 2 × Primestar Max (TaKaRa) in sterile 0.2m L PCR reaction tubes, respectively, as follows:
the PCR reaction program after mixing is that the temperature is 98 ℃ for 10s, the temperature is 55 ℃ for 10s, the temperature is 72 ℃ for 5s, 30 cycles are carried out, the temperature is 72 ℃ for 10min, after the PCR reaction is finished, Gel Extraction Kits (Omega) are used for glue recovery, the concrete steps are strictly carried out according to the instruction, and finally 30 mu L ddH is added2And (4) eluting with O.
The template used for amplifying the upstream and downstream homologous arms is lactobacillus casei B L23 chromosome DNA;
the template used for amplifying lox66-cat-lox71 is plasmid pNZ 8148.
3) Obtaining substrate double-stranded DNA galK knockout box (up-lox66-cat-lox71-down) by fusion PCR
Amplification was performed in a sterile 0.2m L PCR reaction tube using 2 × Primestar Max (TaKaRa) as follows:
the system does not add primers in the first round of PCR reaction, the reaction program comprises that the temperature is 98 ℃ for 10s, the temperature is 55 ℃ for 10s, the temperature is 72 ℃ for 5s, 5 cycles and the temperature is 72 ℃ for 10min, after the first round of PCR reaction is finished, the primers galK-uF and galK-dR are added, the second round of PCR is continued, the reaction program comprises that the temperature is 98 ℃ for 10s, the temperature is 55 ℃ for 10s, the temperature is 72 ℃ for 5s, 25 cycles and the temperature is 72 ℃ for 10min, after the second round of PCR reaction is finished, the gel recovery is carried out by utilizing a GelExtraction Kits (Omega), the specific steps are strictly carried out according to the instruction, and finally 30 mu L ddH is added2And (4) eluting with O.
(8) The extraction method of the lactobacillus casei plasmid in the steps (1) and (3) is as follows:
collecting thallus cells 6,000g × 5min after overnight culture, discarding supernatant, adding 400 μ L acetone, vortexing, discarding supernatant after 4,000g × 2min, standing at 42 deg.C to remove residual acetone, treating with lysozyme of 200 μ L final concentration 20mg/m L at 37 deg.C for 1h, 4,000g × 2min, discarding supernatant, extracting Plasmid with Plasmid Mini kit (Omega), and adding 50 μ L ddH2And (4) eluting with O.
(9) The method for extracting the chromosome of the lactobacillus casei in the steps (2) and (3) comprises the following steps:
1) 1ml of overnight-cultured bacterial suspension was collected for 6,000g of × 5 min.
2) Resuspended in 120. mu.l SolI (80. mu. L50 mg/ml lysozyme was added), mixed well and treated in a 37 ℃ water bath for 1 h.
3)4,000g × 2min, discard the supernatant.
4) Adding 200 μ L SolI, vortex and mix, adding 100 μ L phenol, vortex for 2min, adding 100 μ L chloroform to isoamyl alcohol 23:1, mix, 13,000g × 10 min.
5) The supernatant was aspirated at 180. mu. L, and an equal volume of phenol, chloroform, isoamyl alcohol 24:23:1 was added and mixed well for 13,000g × 5 min.
6) The supernatant was aspirated at 80. mu. L, and an equal volume of chloroform isoamyl alcohol 23:1 was added thereto, followed by mixing and 13,000g × 5 min.
7) Sucking 50 mu L supernatant to obtain chromosome extract.
The SolI formula used is as follows: 50mM glucose, 25mM Tris-HCl, 10mM EDTA (pH 8.0).
(10) The lysozyme stock used in steps (8) and (9) was dissolved in TE buffer (10mM Tris-HCl (pH 7.6), 1mM EDTA (pH 8.0) at a concentration of 50mg/m L.
Sequence listing
<110> Shandong university
<120> a group of lactobacillus casei gene knockout vectors and application thereof
<141>2017-08-12
<160>2
<210>1
<211>10394
<212>DNA
<213> Artificial sequence
<221> vector pMSP456
<222>（1）…（10394）
<400>1
agatctgatc cgtagcggtt ttcaaaattt gcaaccagga atgaattact atccctttta 60
tcaagaagcg caaaagaaaa acgaaatgat acaccaatca gtgcaaaaaa agatataatg 120
ggagataaga cggttcgtgt tcgtgctgacttgcaccata tcataaaaat cgaaacagca 180
aagaatggcg gaaacgtaaa agaagttatg gaaataagac ttagaagcaa acttaagagt 240
gtgttgatag tgcagtatct taaaattttg tataatagga attgaagtta aattagatgc 300
taaaaatttg taattaagaa ggagtgatta catgaacaaa aatataaaat attctcaaaa 360
ctttttaacg agtgaaaaag tactcaacca aataataaaa caattgaatt taaaagaaac 420
cgataccgtt tacgaaattg gaacaggtaa agggcattta acgacgaaac tggctaaaat 480
aagtaaacag gtaacgtcta ttgaattaga cagtcatcta ttcaacttat cgtcagaaaa 540
attaaaactg aatactcgtg tcactttaat tcaccaagat attctacagt ttcaattccc 600
taacaaacag aggtataaaa ttgttgggag tattccttac catttaagca cacaaattat 660
taaaaaagtg gtttttgaaa gccatgcgtc tgacatctat ctgattgttg aagaaggatt 720
ctacaagcgt accttggata ttcaccgaac actagggttg ctcttgcaca ctcaagtctc 780
gattcagcaa ttgcttaagc tgccagcgga atgctttcat cctaaaccaa aagtaaacag 840
tgtcttaata aaacttaccc gccataccac agatgttcca gataaatatt ggaagctata 900
tacgtacttt gtttcaaaat gggtcaatcg agaatatcgt caactgttta ctaaaaatca 960
gtttcatcaa gcaatgaaac acgccaaagt aaacaattta agtaccgtta cttatgagca 1020
agtattgtct atttttaata gttatctatt atttaacggg aggaaataat tctatgagtc 1080
gcttttgtaa atttggaaag ttacacgtta ctaaagggaa tgtagataaa ttattaggta 1140
tactactgac agcttccaag gagctaaaga ggtccctagc gcttagaatc gctttaggaa 1200
acacgatcca gtccaataat cgtcgataaa aacttttgaa aaaggttggt gaaattacct 1260
acttttggaa taatcacaaa tcacaagtga ttaatcacaa atcacaagtg attaatcact 1320
tgtttattaa gatattaaaa gctataattt aaataaagcg tgaattttat tacacaaaaa 1380
gaggggggag aaacttggaa ctagcattta gagaaagctt aaaaaagatg agaggtacca 1440
aatcaaaaga aaaattctcc caagaattag aaatgagtag atcaaattat tcacgaatag 1500
aatcaggaaa atcagatcca accataaaaa cactagaaca aattgcaaag ttaactaact 1560
caacgctagt agtggattta atcccaaatg agccaacaga accagaacca gaaacagaat 1620
cagaacaagt aacattggat ttagaaatgg aagaagaaaa aagcaatgac ttcgtgtgaa 1680
taatgcacga aatcgttgct tatttttttt taaaagcggt atactagata taacgaaaca 1740
acgaactgaa tagaaacgaa aaaagagcca tgacacattt ataaaatgtt tgacgacatt 1800
ttataaatgc atagcccgat aagattgcca aaccaacgct tatcagttag tcagatgaac 1860
tcttccctcg taagaagtta tttaattaac tttgtttgaa gacggtatat aaccgtacta 1920
tcattatata gggaaatcag agagttttca agtatctaag ctactgaatt taagaattgt 1980
taagcaatca atcggaaatc gtttgattgc tttttttgta ttcatttata gaaggtggag 2040
tttgtatgaa tcatgatgaa tgtaaaactt atataaaaaa tagtttattg gagataagaa 2100
aattagcaaa tatctataca ctagaaacgt ttaagaaaga gttagaaaag agaaatatct 2160
acttagaaac aaaatcagat aagtattttt cttcggaggg ggaagattat atatataagt 2220
taatagaaaa taacaaaata atttattcga ttagtggaaa aaaattgact tataaaggaa 2280
aaaaatcttt ttcaaaacat gcaatattga aacagttgaa tgaaaaagca aaccaagtta 2340
attaaacaac ctattttata ggatttatag gaaaggagaa cagctgaatg aatatccctt 2400
ttgttgtaga aactgtgctt catgacggct tgttaaagta caaatttaaa aatagtaaaa 2460
ttcgctcaat cactaccaag ccaggtaaaa gcaaaggggc tatttttgcg tatcgctcaa 2520
aatcaagcat gattggcggt cgtggtgttg ttctgacttc cgaggaagcg attcaagaaa 2580
atcaagatac atttacacat tggacaccca acgtttatcg ttatggaacg tatgcagacg 2640
aaaaccgttc atacacgaaa ggacattctg aaaacaattt aagacaaatc aataccttct 2700
ttattgattt tgatattcac acggcaaaag aaactatttc agcaagcgat attttaacaa 2760
ccgctattga tttaggtttt atgcctacta tgattatcaa atctgataaa ggttatcaag 2820
catattttgt tttagaaacg ccagtctatg tgacttcaaa atcagaattt aaatctgtca 2880
aagcagccaa aataatttcg caaaatatcc gagaatattt tggaaagtct ttgccagttg 2940
atctaacgtg taatcatttt ggtattgctc gcataccaag aacggacaat gtagaatttt 3000
ttgatcctaa ttaccgttat tctttcaaag aatggcaaga ttggtctttc aaacaaacag 3060
ataataaggg ctttactcgt tcaagtctaa cggttttaag cggtacagaa ggcaaaaaac 3120
aagtagatga accctggttt aatctcttat tgcacgaaac gaaattttca ggagaaaagg 3180
gtttaatagg gcgtaataac gtcatgttta ccctctcttt agcctacttt agttcaggct 3240
attcaatcga aacgtgcgaa tataatatgt ttgagtttaa taatcgatta gatcaaccct 3300
tagaagaaaa agaagtaatc aaaattgtta gaagtgccta ttcagaaaac tatcaagggg 3360
ctaataggga atacattacc attctttgca aagcttgggt atcaagtgat ttaaccagta 3420
aagatttatt tgtccgtcaa gggtggttta aattcaagaa aaaaagaagc gaacgtcaac 3480
gtgttcattt gtcagaatgg aaagaagatt taatggctta tattagcgaa aaaagcgatg 3540
tatacaagcc ttatttagtg acgaccaaaa aagagattag agaagtgcta ggcattcctg 3600
aacggacatt agataaattg ctgaaggtac tgaaggcgaa tcaggaaatt ttctttaaga 3660
ttaaaccagg aagaaatggt ggcattcaac ttgctagtgt taaatcattg ttgctatcga 3720
tcattaaagt aaaaaaagaa gaaaaagaaa gctatataaa ggcgctgaca aattcttttg 3780
acttagagca tacattcatt caagagactt taaacaagct agcagaacgc cctaaaacgg 3840
acacacaact cgatttgttt agctatgata caggctgaaa ataaaacccg cactatgcca 3900
ttacatttat atctatgata cgtgtttgtt ttttctttgc tgtttagcga atgattagca 3960
gaaatataca gagtaagatt ttaattaatt attaggggga gaaggagaga gtagcccgaa 4020
aacttttagt tggcttggac tgaacgaagt gagggaaagg ctactaaaac gtcgaggggc 4080
agtgagagcg aagcgaacac ttgatttttt aattttctat cttttatagg tcattagagt 4140
atacttattt gtcctataaa ctatttagca gcataataga tttattgaat aggtcattta 4200
agttgagcat attagaggag gaaaatcttg gagaaatatt tgaagaaccc gattacatgg 4260
attggattag ttcttgtggt tacgtggttt ttaactaaaa gtagtgaatt tttgattttt 4320
ggtgtgtgtg tcttgttgtt agtatttgct agtcaaagtg attaaataga attctcatgt 4380
ttgacagctt atcatcggag ctccgatgat aagctgtcca aacatgagaa ttccccggct 4440
ttaggtatag tgtgtatctc aatccttggt atattgaaaa gaaagactaa aaattgatag 4500
attatatttc ttcagaatga atggtataat gaagtaatga gtactaaaca atcggaggta 4560
aagtggtgta taaaatttta atagttgatg atgatcagga aattttaaaa ttaatgaaga 4620
cagcattaga aatgagaaac tatgaagttg cgacgcatca aaacatttca cttcccttgg 4680
atattactga ttttcaggga tttgatttga ttttgttaga tatcatgatg tcaaatattg 4740
aagggacaga aatttgtaaa aggattcgca gagaaatatc aactccaatt atctttgtta 4800
gtgcgaaaga tacagaagag gatattataa acggcttagg tattggtggg gatgactata 4860
ttactaagcc ttttagcctt aaacagttgg ttgcaaaagt ggaagcaaat ataaagcgag 4920
aggaacgcaa taaacatgca gttcatgttt tttcagagat tcgtagagat ttaggaccaa 4980
ttacatttta tttagaagaa aggcgagtct gtgtcaatgg tcaaacaatt ccactgactt 5040
gtcgtgaata cgatattctt gaattactat cacaacgaac ttctaaagtt tatacgagag 5100
aggatattta tgatgacgta tatgatgaat attctaatgc actttttcgg tcaatctcgg 5160
agtatattta tcagattagg agtaagtttg caccatacga tattaatccg ataaaaacgg 5220
ttcggggact tgggtatcag tggcatgggt aaaaaatatt caatgcgtcg acggatatgg 5280
caagctgtca ttgaaattat cataggtact tgtctactta tcctgttgtt actgggcttg 5340
actttctttc tacgacaaat tggacaaatc agtggttcag aaactattcg tttatcttta 5400
gattcagata atttaactat ttctgatatc gaacgtgata tgaaacacta cccatatgat 5460
tatattattt ttgacaatga tacaagtaaa attttgggag gacattatgt caagtcggat 5520
gtacctagtt ttgtagcttc aaaacagtct tcacataata ttacagaagg agaaattact 5580
tatacttatt caagcaataa gcatttttca gttgttttaa gacaaaacag tatgcctgaa 5640
tttacaaatc atacgcttcg ttcaatttct tataatcaat ttacttacct tttctttttt 5700
cttggtgaaa taatactcat tattttttct gtctatcatc tcattagaga attttctaag 5760
aattttcaag ccgttcaaaa gattgcattg aagatggggg aaataactac ttttcctgaa 5820
caagaggaat caaaaattat tgaatttgat caggttctga ataacttata ttcgaaaagt 5880
aaggagttag ctttccttat tgaagcggag cgtcatgaaa aacatgattt atccttccag 5940
gttgctgcac tttcacatga tgttaagaca cctttaacag tattaaaagg aaatattgaa 6000
ctgctagaga tgactgaagt aaatgaacaa caagctgatt ttattgagtc aatgaaaaat 6060
agtttgactg tttttgacaa gtattttaac acaatgatta gttatacaaa acttttgaat 6120
gatgaaaatg attacaaagc gacaatctcc ctggaggatt ttttgataga tttatcagtt 6180
gagttggaag agttgtcaac aacttatcaa gtggattatc agctagttaa aaaaacagat 6240
ttaaccactt tttacggaaa tacattagct ttaagtcgag cacttatcaa tatctttgtt 6300
aatgcctgtc agtatgctaa agagggtgaa aaaatagtca gtttgagtat ttatgatgat 6360
gaaaaatatc tctattttga aatctggaat aatggtcatc ctttttctga acaagcaaaa 6420
aaaaatgctg gaaaactatt tttcacagaa gatactggac gtagtgggaa acactatggg 6480
attggactat cttttgctca aggtgtagct ttaaaacatc aaggaaactt aattctcagt 6540
aatcctcaaa aaggtggggc agaagttatc ctaaaaataa aaaagtaatt tagtaatctc 6600
taaggattac tttttttgtt tcggcaaact attaactggc gaactactta ctctagcttc 6660
ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 6720
ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 6780
cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 6840
gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 6900
actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 6960
aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 7020
caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 7080
aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 7140
accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 7200
aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 7260
ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 7320
agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 7380
accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 7440
gcgaacgacc tacaccgaac tgagatacct acagcgtgag cattgagaaa gcgccacgct 7500
tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 7560
cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 7620
cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 7680
cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 7740
ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 7800
taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 7860
gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcaggttaac 7920
ctggcttatc gaaattaata cgactcacta tagggagacc ggcctcgagt ctagactact 7980
cgactagctc atccatgctg ataattgtgg cgactcgttt agttgccttg cagtaatcac 8040
aggcctcaca gcgatgagga cgcacctgac cggatttaac cgcctcaacg tgttcggtgc 8100
tgtcatggat ctcttccagt gcctcgtcca tacggtactg tggtacttcg atgacggcat 8160
ggtcgggcac gtcttcctta gtcacggcaa tgatgaaggc tcgtggtcgc gttccgtaat 8220
tttggtaaac cagctcctga taaaccgcca tctgaagctg atagttatag gcatcaacga 8280
aactggttgg ttgacgttct cctggtttcc aatacttctt gtgaagcgac tgtgtggtct 8340
ttagatccaa aaagaatgac tttgtggagt cgaagcagtc cagcttgccc atccactcga 8400
ccccaaacag atcaccggtc aggatctctt ctttttcgcc ctgataaagt cgttgaacat 8460
tctcatcagc ttcaagcgtg gcaatcatcg catcagcttg tttatacgtg gctttcagtt 8520
gtccttttga tgatccacga gttgagaaca tctctgggtg tcctttgata aaagactcat 8580
gagcttgctt ggattcaaaa tagctgtgta gatagtttcc aaccagcaag gcagtcggat 8640
cacctcttgg tatccattta ccttgcaact cggccatcgc ttccgcttcg catgtcagaa 8700
acttcttaaa ccaggtagca gactgatatt tgaaactggt atccagcgag taataattat 8760
ccttgttgac cgtcaaagat ttctggttgt tttcctgcat ttgggtcgtg ggtaatgtct 8820
ggcttaagag catctggctt cacctccgat tttgtgacgg gttcagcggg agcgttaagt 8880
gcatcctcga tcgagttagg atcttcgggg gtaacatcct tcagttctgg atcagcttcg 8940
actggttttt catcggcact gaccgcactt tgcatgtcgg ttgtcattgg accccactta 9000
gtcagcagcg atttgattac cgtcttcagg gccatagcct cgtagttgtc tttccaaacg 9060
cccttgggct ccgcgctacc accagatttg ctgaaacgct tgcgatgatc atcgacttgc 9120
tgataagtcc aatagaccat cttttcaaaa ccgttagtca gtttgaacga tgcggcatag 9180
ccaaccggtt tttcgcttgc tttgcgatcg tggaagttcg gcgtgtactc aagttcctcc 9240
gttagtgggt tccagctctt gaactcatct tcataaattg gtaaagcagt caggcgctga 9300
taccgtcctg atcgttgagc taattggata tagcctttat aaccaatctg tggctgcgcc 9360
tggttcttgt atggaacgat gtagacaaaa cccaagctcg ggttaaccgg aagatcgagc 9420
gttgctgcta ccagggccga gttgataaca cttaactgat caactctggc taagcttgga 9480
ttaaggctta ccgcgctggc aattgatgaa agaaactgtg gtgcccgttt gtccagaagc 9540
gctgcaaact tattcttaat cgtctgcgtc tcaatcagtt tcttaactgg catttttttt 9600
aggtcatatt gtgtcgtcat atgctactcc tcctatttcc attcctgaaa tccttgattc 9660
ttcatgaaat caataacgtc taagctgtca ccgccgaaga aaatctcaac cagttctgtt 9720
ttcggatacg tagaactagc agcgtctttt aagaatcgct cagggccgtg aatgttgatc 9780
caatctttca agtattcctt cgctttgtct ttgttaaagg cgccctcata acgcgatgca 9840
gcacagcttt gatagagcca aggtttcttt gtatcaactt catattcatc ggcggtggcc 9900
aagaactcct ccgcttgttc gatatccata tctttgggca agacggtacc gtgataggac 9960
tcccaatcgg caatggcttt atcttcaagt cgttctcgcc gttgatattc attcagaacc 10020
gctgtgttgt aatcaagcat ggtcatctgc agcccgggac tagtggtacc ggatccatgc 10080
agagtctcct gttttacaac cgggtgtaca tagcgaaata cttgtaatgc gtggtgatgc 10140
acctgaatct ttcttcgaaa cagataccaa atccaagcta aaatcttttg tactcatttt 10200
gagtgcctcc ttataattta ttttgtagtt ccttcgaacg aaatcattgt atctaacaaa 10260
cttcagaatt taatcagagc cgtttattat gctcgcgtta tcgacaataa tattattacc 10320
aatactttct caagatagaa ttaagactgt tttagatttg ttaatgtttc tattgtcagt 10380
atagttataa gact 10394
<210>2
<211>9349
<212>DNA
<213> Artificial sequence
<221> vector pMSPcre
<222>（1）…（9349）
<400>2
agatctgatc cgtagcggtt ttcaaaattt gcaaccagga atgaattact atccctttta 60
tcaagaagcg caaaagaaaa acgaaatgat acaccaatca gtgcaaaaaa agatataatg 120
ggagataaga cggttcgtgt tcgtgctgac ttgcaccata tcataaaaat cgaaacagca 180
aagaatggcg gaaacgtaaa agaagttatg gaaataagac ttagaagcaa acttaagagt 240
gtgttgatag tgcagtatct taaaattttg tataatagga attgaagtta aattagatgc 300
taaaaatttg taattaagaa ggagtgatta catgaacaaa aatataaaat attctcaaaa 360
ctttttaacg agtgaaaaag tactcaacca aataataaaa caattgaatt taaaagaaac 420
cgataccgtt tacgaaattg gaacaggtaa agggcattta acgacgaaac tggctaaaat 480
aagtaaacag gtaacgtcta ttgaattaga cagtcatcta ttcaacttat cgtcagaaaa 540
attaaaactg aatactcgtg tcactttaat tcaccaagat attctacagt ttcaattccc 600
taacaaacag aggtataaaa ttgttgggag tattccttac catttaagca cacaaattat 660
taaaaaagtg gtttttgaaa gccatgcgtc tgacatctat ctgattgttg aagaaggatt 720
ctacaagcgt accttggata ttcaccgaac actagggttg ctcttgcaca ctcaagtctc 780
gattcagcaa ttgcttaagc tgccagcgga atgctttcat cctaaaccaa aagtaaacag 840
tgtcttaata aaacttaccc gccataccac agatgttcca gataaatatt ggaagctata 900
tacgtacttt gtttcaaaat gggtcaatcg agaatatcgt caactgttta ctaaaaatca 960
gtttcatcaa gcaatgaaac acgccaaagt aaacaattta agtaccgtta cttatgagca 1020
agtattgtct atttttaata gttatctatt atttaacggg aggaaataat tctatgagtc 1080
gcttttgtaa atttggaaag ttacacgtta ctaaagggaa tgtagataaa ttattaggta 1140
tactactgac agcttccaag gagctaaaga ggtccctagc gcttagaatc gctttaggaa 1200
acacgatcca gtccaataat cgtcgataaa aacttttgaa aaaggttggt gaaattacct 1260
acttttggaa taatcacaaa tcacaagtga ttaatcacaa atcacaagtg attaatcact 1320
tgtttattaa gatattaaaa gctataattt aaataaagcg tgaattttat tacacaaaaa 1380
gaggggggag aaacttggaa ctagcattta gagaaagctt aaaaaagatg agaggtacca 1440
aatcaaaaga aaaattctcc caagaattag aaatgagtag atcaaattat tcacgaatag 1500
aatcaggaaa atcagatcca accataaaaa cactagaaca aattgcaaag ttaactaact 1560
caacgctagt agtggattta atcccaaatg agccaacaga accagaacca gaaacagaat 1620
cagaacaagt aacattggat ttagaaatgg aagaagaaaa aagcaatgac ttcgtgtgaa 1680
taatgcacga aatcgttgct tatttttttt taaaagcggt atactagata taacgaaaca 1740
acgaactgaa tagaaacgaa aaaagagcca tgacacattt ataaaatgtt tgacgacatt 1800
ttataaatgc atagcccgat aagattgcca aaccaacgct tatcagttag tcagatgaac 1860
tcttccctcg taagaagtta tttaattaac tttgtttgaa gacggtatat aaccgtacta 1920
tcattatata gggaaatcag agagttttca agtatctaag ctactgaatt taagaattgt 1980
taagcaatca atcggaaatc gtttgattgc tttttttgta ttcatttata gaaggtggag 2040
tttgtatgaa tcatgatgaa tgtaaaactt atataaaaaa tagtttattg gagataagaa 2100
aattagcaaa tatctataca ctagaaacgt ttaagaaaga gttagaaaag agaaatatct 2160
acttagaaac aaaatcagat aagtattttt cttcggaggg ggaagattat atatataagt 2220
taatagaaaa taacaaaata atttattcga ttagtggaaa aaaattgact tataaaggaa 2280
aaaaatcttt ttcaaaacat gcaatattga aacagttgaa tgaaaaagca aaccaagtta 2340
attaaacaac ctattttata ggatttatag gaaaggagaa cagctgaatg aatatccctt 2400
ttgttgtaga aactgtgctt catgacggct tgttaaagta caaatttaaa aatagtaaaa 2460
ttcgctcaat cactaccaag ccaggtaaaa gcaaaggggc tatttttgcg tatcgctcaa 2520
aatcaagcat gattggcggt cgtggtgttg ttctgacttc cgaggaagcg attcaagaaa 2580
atcaagatac atttacacat tggacaccca acgtttatcg ttatggaacg tatgcagacg 2640
aaaaccgttc atacacgaaa ggacattctg aaaacaattt aagacaaatc aataccttct 2700
ttattgattt tgatattcac acggcaaaag aaactatttc agcaagcgat attttaacaa 2760
ccgctattga tttaggtttt atgcctacta tgattatcaa atctgataaa ggttatcaag 2820
catattttgt tttagaaacg ccagtctatg tgacttcaaa atcagaattt aaatctgtca 2880
aagcagccaa aataatttcg caaaatatcc gagaatattt tggaaagtct ttgccagttg 2940
atctaacgtg taatcatttt ggtattgctc gcataccaag aacggacaat gtagaatttt 3000
ttgatcctaa ttaccgttat tctttcaaag aatggcaaga ttggtctttc aaacaaacag 3060
ataataaggg ctttactcgt tcaagtctaa cggttttaag cggtacagaa ggcaaaaaac 3120
aagtagatga accctggttt aatctcttat tgcacgaaac gaaattttca ggagaaaagg 3180
gtttaatagg gcgtaataac gtcatgttta ccctctcttt agcctacttt agttcaggct 3240
attcaatcga aacgtgcgaa tataatatgt ttgagtttaa taatcgatta gatcaaccct 3300
tagaagaaaa agaagtaatc aaaattgtta gaagtgccta ttcagaaaac tatcaagggg 3360
ctaataggga atacattacc attctttgca aagcttgggt atcaagtgat ttaaccagta 3420
aagatttatt tgtccgtcaa gggtggttta aattcaagaa aaaaagaagc gaacgtcaac 3480
gtgttcattt gtcagaatgg aaagaagatt taatggctta tattagcgaa aaaagcgatg 3540
tatacaagcc ttatttagtg acgaccaaaa aagagattag agaagtgcta ggcattcctg 3600
aacggacatt agataaattg ctgaaggtac tgaaggcgaa tcaggaaatt ttctttaaga 3660
ttaaaccagg aagaaatggt ggcattcaac ttgctagtgt taaatcattg ttgctatcga 3720
tcattaaagt aaaaaaagaa gaaaaagaaa gctatataaa ggcgctgaca aattcttttg 3780
acttagagca tacattcatt caagagactt taaacaagct agcagaacgc cctaaaacgg 3840
acacacaact cgatttgttt agctatgata caggctgaaa ataaaacccg cactatgcca 3900
ttacatttat atctatgata cgtgtttgtt ttttctttgc tgtttagcga atgattagca 3960
gaaatataca gagtaagatt ttaattaatt attaggggga gaaggagaga gtagcccgaa 4020
aacttttagt tggcttggac tgaacgaagt gagggaaagg ctactaaaac gtcgaggggc 4080
agtgagagcg aagcgaacac ttgatttttt aattttctat cttttatagg tcattagagt 4140
atacttattt gtcctataaa ctatttagca gcataataga tttattgaat aggtcattta 4200
agttgagcat attagaggag gaaaatcttg gagaaatatt tgaagaaccc gattacatgg 4260
attggattag ttcttgtggt tacgtggttt ttaactaaaa gtagtgaatt tttgattttt 4320
ggtgtgtgtg tcttgttgtt agtatttgct agtcaaagtg attaaataga attctcatgt 4380
ttgacagctt atcatcggag ctccgatgat aagctgtcca aacatgagaa ttccccggct 4440
ttaggtatag tgtgtatctc aatccttggt atattgaaaa gaaagactaa aaattgatag 4500
attatatttc ttcagaatga atggtataat gaagtaatga gtactaaaca atcggaggta 4560
aagtggtgta taaaatttta atagttgatg atgatcagga aattttaaaa ttaatgaaga 4620
cagcattaga aatgagaaac tatgaagttg cgacgcatca aaacatttca cttcccttgg 4680
atattactga ttttcaggga tttgatttga ttttgttaga tatcatgatg tcaaatattg 4740
aagggacaga aatttgtaaa aggattcgca gagaaatatc aactccaatt atctttgtta 4800
gtgcgaaaga tacagaagag gatattataa acggcttagg tattggtggg gatgactata 4860
ttactaagcc ttttagcctt aaacagttgg ttgcaaaagt ggaagcaaat ataaagcgag 4920
aggaacgcaa taaacatgca gttcatgttt tttcagagat tcgtagagat ttaggaccaa 4980
ttacatttta tttagaagaa aggcgagtct gtgtcaatgg tcaaacaatt ccactgactt 5040
gtcgtgaata cgatattctt gaattactat cacaacgaac ttctaaagtt tatacgagag 5100
aggatattta tgatgacgta tatgatgaat attctaatgc actttttcgg tcaatctcgg 5160
agtatattta tcagattagg agtaagtttg caccatacga tattaatccg ataaaaacgg 5220
ttcggggact tgggtatcag tggcatgggt aaaaaatatt caatgcgtcg acggatatgg 5280
caagctgtca ttgaaattat cataggtact tgtctactta tcctgttgtt actgggcttg 5340
actttctttc tacgacaaat tggacaaatc agtggttcag aaactattcg tttatcttta 5400
gattcagata atttaactat ttctgatatc gaacgtgata tgaaacacta cccatatgat 5460
tatattattt ttgacaatga tacaagtaaa attttgggag gacattatgt caagtcggat 5520
gtacctagtt ttgtagcttc aaaacagtct tcacataata ttacagaagg agaaattact 5580
tatacttatt caagcaataa gcatttttca gttgttttaa gacaaaacag tatgcctgaa 5640
tttacaaatc atacgcttcg ttcaatttct tataatcaat ttacttacct tttctttttt 5700
cttggtgaaa taatactcat tattttttct gtctatcatc tcattagaga attttctaag 5760
aattttcaag ccgttcaaaa gattgcattg aagatggggg aaataactac ttttcctgaa 5820
caagaggaat caaaaattat tgaatttgat caggttctga ataacttata ttcgaaaagt 5880
aaggagttag ctttccttat tgaagcggag cgtcatgaaa aacatgattt atccttccag 5940
gttgctgcac tttcacatga tgttaagaca cctttaacag tattaaaagg aaatattgaa 6000
ctgctagaga tgactgaagt aaatgaacaa caagctgatt ttattgagtc aatgaaaaat 6060
agtttgactg tttttgacaa gtattttaac acaatgatta gttatacaaa acttttgaat 6120
gatgaaaatg attacaaagc gacaatctcc ctggaggatt ttttgataga tttatcagtt 6180
gagttggaag agttgtcaac aacttatcaa gtggattatc agctagttaa aaaaacagat 6240
ttaaccactt tttacggaaa tacattagct ttaagtcgag cacttatcaa tatctttgtt 6300
aatgcctgtc agtatgctaa agagggtgaa aaaatagtca gtttgagtat ttatgatgat 6360
gaaaaatatc tctattttga aatctggaat aatggtcatc ctttttctga acaagcaaaa 6420
aaaaatgctg gaaaactatt tttcacagaa gatactggac gtagtgggaa acactatggg 6480
attggactat cttttgctca aggtgtagct ttaaaacatc aaggaaactt aattctcagt 6540
aatcctcaaa aaggtggggc agaagttatc ctaaaaataa aaaagtaatt tagtaatctc 6600
taaggattac tttttttgtt tcggcaaact attaactggc gaactactta ctctagcttc 6660
ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 6720
ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 6780
cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 6840
gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 6900
actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 6960
aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 7020
caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 7080
aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 7140
accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 7200
aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 7260
ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 7320
agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 7380
accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 7440
gcgaacgacc tacaccgaac tgagatacct acagcgtgag cattgagaaa gcgccacgct 7500
tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 7560
cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 7620
cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 7680
cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 7740
ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 7800
taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 7860
gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcaggttaac 7920
ctggcttatc gaaattaata cgactcacta tagggagacc ggcctcgacc taatcgccat 7980
cttccagcag gcgcaccatt gcccctgttt cactatccag gttacggata tagttcatga 8040
caatatttac attggtccag ccaccagctt gcatgatctc cggtattgaa actccagcgc 8100
gggccatatc tcgcgcggct ccgacacggg cactgtgtcc agaccaggcc aggtatctct 8160
gaccagagtc atccttagcg ccgtaaatca atcgatgagt tgcttcaaaa atcccttcca 8220
gggcgcgagt tgatagctgg ctggtggcag atggcgcggc aacaccattt tttctgaccc 8280
ggcaaaacag gtagttattc ggatcatcag ctacaccaga gacggaaatc catcgctcga 8340
ccagtttagt tacccccagg ctaagtgcct tctctacacc tgcggtgcta accagcgttt 8400
tcgttctgcc aatatggatt aacattctcc caccgtcagt acgtgagata tctttaaccc 8460
tgatcctggc aatttcggct atacgtaaca gggtgttata agcaatcccc agaaatgcca 8520
gattacgtat atcctggcag cgatcgctat tttccatgag tgaacgaacc tggtcgaaat 8580
cagtgcgttc gaacgctaga gcctgttttg cacgttcacc ggcatcaacg ttttcttttc 8640
ggatccgccg cataaccagt gaaacagcat tgctgtcact tggtcgtggc agcccggacc 8700
gacgatgaag catgtttagc tggcccaaat gttgctggat agtttttact gccagaccgc 8760
gcgcctgaag atatagaaga taatcgcgaa catcttcagg ttctgcggga aaccatttcc 8820
ggttattcaa cttgcaccat gccgcccacg accggcaaac ggacagaagc attttccagg 8880
tatgctcaga aaacgcctgg cgatccctga acatgtccat caggttcttg cgaacctcat 8940
cactcgttgc atcgaccggt aatgcaggca aattttggtg tacggtcagt aaattggaca 9000
tctgcagccc gggactagtg gtaccggatc catgcagagt ctcctgtttt acaaccgggt 9060
gtacatagcg aaatacttgt aatgcgtggt gatgcacctg aatctttctt cgaaacagat 9120
accaaatcca agctaaaatc ttttgtactc attttgagtg cctccttata atttattttg 9180
tagttccttc gaacgaaatc attgtatcta acaaacttca gaatttaatc agagccgttt 9240
attatgctcg cgttatcgac aataatatta ttaccaatac tttctcaaga tagaattaag 9300
actgttttag atttgttaat gtttctattg tcagtatagt tataagact 9349
Claims (3)
1. A kit for constructing a knockout mutant of a lactobacillus casei gene, comprising:
1) a special vector for mediating homologous recombination between an exogenous double-stranded DNA knockout box up-lox66-cat-lox71-down and homologous sequences on a chromosome, which is named as pMSP456, and the nucleotide sequence of the vector is shown as SEQ ID No. 1; and
2) a special vector for mediating the recombination reaction between lox66 and lox71 sites to excise the resistance gene is named pMSPcre, and the nucleotide sequence is shown in SEQ ID No. 2.
2. Use of the kit of claim 1 for constructing a knockout mutant of a lactobacillus casei gene.
3. The use according to claim 2, characterized in that the recombination reaction between the exogenous double-stranded DNA knock-out cassette up-lox66-cat-lox71-down on the vector pMSP456 and the homologous sequence on the chromosome is first carried out, replacing the gene of interest with lox66-cat-lox 71; then, a recombinase Cre mediated lox66 and lox71 site expressed by the vector pMSPcre is utilized to carry out recombination reaction to cut off a chloramphenicol resistance gene cat, a target gene is replaced by a lox72 site, the knockout of the target gene is realized, and the lactobacillus casei knockout mutant strain can be obtained.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710696363.7A CN107502619B (en) | 2017-08-15 | 2017-08-15 | Lactobacillus casei gene knockout vector and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710696363.7A CN107502619B (en) | 2017-08-15 | 2017-08-15 | Lactobacillus casei gene knockout vector and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107502619A CN107502619A (en) | 2017-12-22 |
| CN107502619B true CN107502619B (en) | 2020-07-31 |
Family
ID=60690796
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710696363.7A Active CN107502619B (en) | 2017-08-15 | 2017-08-15 | Lactobacillus casei gene knockout vector and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107502619B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113652384A (en) * | 2021-07-06 | 2021-11-16 | 南京农业大学 | Lactobacillus paracasei S-NB gene deletion mutant strain and construction method and application thereof |
-
2017
- 2017-08-15 CN CN201710696363.7A patent/CN107502619B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN107502619A (en) | 2017-12-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111705006B (en) | Oral recombinant yeast for expressing novel coronavirus S protein and preparation and application thereof | |
| CN107641631A (en) | A kind of method that bacillus coli gene is knocked out based on CRISPR/Cas9 systems by chemical conversion mediation | |
| CN109136251B (en) | pCaspA/pACRISPR double-plasmid system and application thereof | |
| CN110923183A (en) | Construction method of lanosterol-producing escherichia coli strain | |
| CN106591344A (en) | Escherichia coli thermally-induced soluble protein expression vector fused with molecular chaperone label and application thereof | |
| CN102719471B (en) | Integrative plasmid pOPHI and resistance screening marker-free self-luminescent mycobacterium | |
| CN107502619B (en) | Lactobacillus casei gene knockout vector and application thereof | |
| CN101603023B (en) | Recombinant escherichia coli of temperature-control coexpression exogenous gene and application thereof | |
| CN111041038B (en) | Synechocystis 6803 genetic engineering bacterium for efficiently biologically synthesizing astaxanthin and construction method and application thereof | |
| CN106011133B (en) | A kind of small DNA molecular amount reference substance, reference substance plasmid and preparation method thereof | |
| CN102311954B (en) | Transgenic papaya 55-1 transformation event specific PCR detection method | |
| CN108714210B (en) | Application of recombinant attenuated listeria in preparation of mesothelin high-expression cancer therapeutic vaccine | |
| CN112011471A (en) | Yeast strain for brewing lemon-flavored beer, preparation method thereof and beer brewing method | |
| CN113736676A (en) | Preparation and application of oral recombinant saccharomyces cerevisiae for expressing porcine epidemic diarrhea virus S protein | |
| KR101495276B1 (en) | Light Inducible Promoter and Gene Expression System Comprising The Same | |
| CN111088201B (en) | Recombinant clostridium acetobutylicum and construction method and application thereof | |
| CN113073102B (en) | Application of autophagy gene ATG9 in rice breeding and/or rice grain type mechanism research | |
| CN110241099B (en) | Truncated variant of CRISPR nuclease SpCas9 of streptococcus pyogenes and application thereof | |
| KR20140094757A (en) | A cassette comprising promoter sequences of a target gene and a method for gene manipulation using the same | |
| CN113817621B (en) | Recombinant saccharomyces cerevisiae strain capable of simultaneously expressing IFNa14 protein and human hepatitis B virus S protein as well as preparation method and application thereof | |
| CN111748034A (en) | Preparation method of mycoplasma synoviae monoclonal antibody | |
| CN113862207B (en) | Modified strain, application thereof in preparation of intestinal motility promoting preparation and product | |
| CN114539425B (en) | Method for improving biological expression of linear polypeptide | |
| CN109321601B (en) | AQP5 recombinant overexpression vector and construction method and application thereof | |
| CN113755512B (en) | Method for preparing tandem repeat protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |