CN112063643A - Expression vector and method for detecting interaction of membrane proteins in bacteria - Google Patents

Abstract

The invention discloses an expression vector and a method for detecting interaction of membrane proteins in bacteria. Firstly, constructing a double-tag protein expression vector with a maltose binding protein tag (MBP) and a histidine tag (8 × His), and using the vector to express and purify insoluble membrane protein to increase the solubility of the membrane protein; and then, the interaction between the membrane protein and other proteins is detected by using a pull down technology, and meanwhile, the method can also be used for screening the protein which interacts with the membrane protein in the bacterial whole-cell protein. The method for detecting the interaction of the membrane proteins in the bacteria breaks through the technical difficulty that the membrane proteins in prokaryotes are insoluble, provides an experimental means for researching the functions of the membrane proteins of the bacteria, and has important application value.

Description

Expression vector and method for detecting interaction of membrane proteins in bacteria

Technical Field

The invention relates to the technical field of genetic engineering, in particular to an expression vector and a method for detecting interaction of membrane proteins in bacteria.

Background

The interaction between proteins refers to the process of forming a protein complex from two or more protein molecules through non-covalent bonds, and is the basis of all known cell life activities. The research on the interaction between proteins is of great significance for the deep exploration of protein functions and the disclosure of life activity mechanisms. The current methods for studying protein interaction mainly comprise yeast/bacteria double hybridization, phage display technology, surface plasma resonance technology, fluorescence energy transfer technology, co-immunoprecipitation technology, pull down experiment and the like. Among them, pull down experiments have become an in vitro experimental technique for effectively verifying protein interaction due to advantages such as simple operation, low cost, and low requirements for instruments and equipment, and have been favored by researchers in recent years. The most widely used in the present research is GST (Glutathione-S-transferase Glutathione mercaptotransferase) pull down, which has the basic principle that a target protein and a GST tag are fused and then affinity-immobilized on Glutathione-labeled magnetic beads, a protein solution to be detected is incubated with the target protein, namely, a protein which has interaction with the target protein can be captured from the magnetic beads, and the interaction between the two proteins is confirmed by SDS-PAGE electrophoretic analysis after a conjugate is eluted. However, due to the large molecular weight of the GST tag, about 26kDa, it may affect the activity of the target protein fused thereto, thereby affecting the subsequent pull down result. In addition, like other technologies for detecting protein interaction in vitro, the GST pull down experiment is premised on that the target protein-GST fusion protein can be normally folded in host bacteria to form active fusion protein and can be purified and obtained with high efficiency, and for the interaction research of some insoluble proteins, the low solubility is a difficult problem in the front of researchers. GST is a protein derived from the eukaryotic organism Schistosoma japonicum, and the expression and folding effects in eukaryotic cells are better than those in prokaryotic cells, so that GST is widely applied to eukaryotic protein expression and pull down experiments, and GST tags are not the best choice in prokaryotic protein expression and pull down experiments.

Membrane proteins are proteins contained in biological membranes and are the main contributors to the function of biological membranes. The membrane protein has a single or multiple transmembrane structure and is easy to aggregate, so that the membrane protein is difficult to dissolve in a host bacterium and is generally difficult to obtain the protein with an active function, thereby influencing the subsequent research on the interaction of the membrane protein. The method for purifying membrane protein is to dissolve membrane protein by detergent, but the types of detergent suitable for dissolving membrane protein are different due to different kinds of membrane protein, and it takes a lot of time to search conditions; secondly, detergents have an impact on subsequent experiments and the process of removing detergents can take a lot of time. Therefore, the pull down method suitable for detecting the interaction of the membrane proteins in the bacteria is developed, and has important significance for researching the functions of the membrane proteins of the bacteria.

Disclosure of Invention

In view of the above, the invention provides an expression vector and a method for detecting interaction of membrane proteins in bacteria, which are convenient for expressing and purifying insoluble membrane proteins in bacteria and detecting interaction proteins of the membrane proteins of the bacteria, and the detection method is simple, convenient and efficient.

The technical scheme of the invention is realized as follows:

in a first aspect, the invention provides an expression vector for detecting membrane protein interaction in bacteria, which comprises a dual-tag fragment, wherein the dual-tag fragment is sequentially connected with an MBP coding gene, a thrombin recognition site coding sequence, a multiple cloning site, a His tag coding sequence and a translation termination code.

On the basis of the technical scheme, preferably, the nucleotide sequence of the double-label fragment is shown as SEQ ID NO.1 in a sequence table.

In a second aspect, the present invention provides the use of an expression vector according to the first aspect for detecting membrane protein interactions in bacteria.

In a third aspect, the present invention provides a method for constructing the expression vector of the first aspect, comprising the following steps:

s1, mixing a forward primer with a nucleotide sequence shown as SEQ ID NO.2 in the sequence table and a reverse primer with a nucleotide sequence shown as SEQ ID NO.3 in the sequence table with the high-fidelity DNA polymerase premix for PCR reaction to obtain a PCR product of a Th-MCS-8 × His fragment;

s2, carrying out enzyme digestion on the plasmid pMAL-c2X, and recovering to obtain a linearized pMAL-c2X vector fragment;

s3, carrying out enzyme digestion on the Th-MCS-8 × His fragment and the linearized pMAL-c2X vector fragment by using T5 exonuclease;

s4, transforming the enzyme digestion product obtained in the step S3 into escherichia coli DH5 alpha, extracting a plasmid, and performing sequencing verification to obtain an expression vector pMAL-Th 8H.

Based on the above technical solution, preferably, in step S1, the PCR reaction procedure is: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 15s, annealing at 60 ℃ for 60s, extension at 72 ℃ for 30s, repeating for 10 cycles; extension at 72 ℃ for 60 s; 20 ℃ for 10 s.

On the basis of the above technical solution, preferably, in step S2, the restriction enzyme is double-digested with restriction enzymes EcoRI and HindIII.

In a fourth aspect, the present invention also provides a method for detecting membrane protein interactions in bacteria, comprising the steps of:

sa, constructing an expression vector pMAL-Th8H-X containing the target protein X coding gene X;

sb, transforming an expression vector pMAL-Th8H-X into escherichia coli BL21, and inducing and expressing fusion protein MBP-X-8 xHis;

sc, purifying the fusion protein MBP-X-8 XHis by using an affinity chromatography column;

sd, capturing the protein interacting with the target protein X through an MBP pull down experiment, or capturing the protein interacting with the target protein X through an His pull down experiment after cutting off an MBP label by thrombin;

and Se, verifying whether the protein to be detected interacts with the target protein through SDS-PAGE, and screening the interacting protein of the target protein through mass spectrometry sequencing.

On the basis of the above technical scheme, preferably, in step Sa, the process for constructing the expression vector pMAL-Th8H-x comprises the following steps: PCR amplifying a target gene x, and introducing double enzyme cutting sites at two ends of the target gene x; and carrying out enzyme digestion and ligation on the amplification product and the vector pMAL-Th8H by using the same restriction enzyme, transforming the amplification product and the vector pMAL-Th8H into escherichia coli DH5 alpha, extracting a plasmid, and carrying out sequencing verification to obtain an expression vector pMAL-Th 8H-x.

On the basis of the above technical scheme, preferably, in step Sa, the process for constructing the expression vector pMAL-Th8H-x comprises the following steps: PCR amplifying a target gene x, and introducing vector pMAL-Th8H homologous sequences at two ends of the target gene x; carrying out enzyme digestion on the amplification product and a vector pMAL-Th8H by using T5 exonuclease; and transforming the obtained enzyme digestion product into escherichia coli DH5 alpha, extracting a plasmid, and performing sequencing verification to obtain an expression vector pMAL-Th 8H-x.

On the basis of the above technical scheme, preferably, in step Sc, the affinity chromatography column is a Ni ion affinity chromatography column or an agarose gel column with dextrin-specific ligands.

Compared with the prior art, the expression vector and the method for detecting the interaction of the membrane proteins in the bacteria have the following beneficial effects:

(1) the Maltose Binding Protein (MBP) label used by the invention is coded by MBP gene of Escherichia coli K12 strain, and is expressed in Escherichia coli host bacteria in origin, so when being synthesized on ribosome, MBP can be quickly and effectively folded into a natural structure, and target protein which is folded downstream can be promoted to obtain a correct structure through isomerization reaction, besides, molecular chaperones can be collected when the MBP is folded, and the molecular chaperones are gathered near the fusion protein to help the correct folding, therefore, the MBP is used as a dissolution promoting label, the water solubility of the target protein is greatly improved, and the MBP label can reduce the degradation of the target protein, thereby being beneficial to the efficient purification of subsequent protein;

(2) the expression vector of the invention is provided with the MBP and His double tags, and either MBP or His can be selected as a proper purification tag according to the affinity of the target protein and the chromatographic column, so that the purification efficiency is improved, and the successful capture of the interaction protein through pull down experiments is facilitated;

(3) the method for detecting the interaction of the indissolvable membrane proteins in the bacteria by using the pull down technology has the advantages of simple operation, high efficiency, real and credible detection result and good repeatability.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 is a plasmid map of the expression vector pMAL-Th8H constructed in the present invention.

FIG. 2 is a schematic diagram showing the base arrangement, annealing, extension and alignment of the primers Th8HisS and Th8HisA in example 1 of the present invention.

FIG. 3 is a schematic diagram showing the procedure for constructing the vector pMAL-Th8H using T5 exonuclease in example 1 of the present invention.

FIG. 4 shows the sequencing of the transformants of example 1 of the present invention aligned with a pre-designed sequence of pMAL-Th 8H.

FIG. 5 is an SDS-PAGE of purified PP _0337 expressed from pMAL-Th8H-PP _0337 and pET-28a-PP _0337 in example 2 of the invention. Wherein, Lane No.1 and Lane No.2 are respectively the supernatant and the precipitate of BL21 whole cell lysate carrying pMAL-Th8H-PP _0337, Lane No.3 and Lane No.4 are the eluents obtained by purifying PP _0337 protein by using pMAL-Th8H-PP _0337 expression vector, Lane No. 5 and Lane No. 6 are respectively the supernatant and the precipitate of BL21 whole cell lysate carrying pET-28a-PP _0337, Lane No. 7 and Lane No. 8 are the eluents obtained by purifying PP _0337 protein by using pET-28a-PP _0337 expression vector, and M represents protein Marker.

FIG. 6 shows the result of detecting the phosphodiester activity of PP _0337 protein purified in example 2. Wherein lane 1 is a blank control without added protein; lane 2 with 2. mu.L PP _ 0337; lane 3 with 4. mu.L PP _ 0337; lane 4 is filled with 8. mu.L of PP _ 0337.

FIG. 7 is a flowchart of the operation of the method for detecting the interaction of the insoluble membrane protein PP _ 0337.

FIG. 8 is an SDS-PAGE photograph of interaction between PP _0337 and the CheA protein detected by His pull down in example 3 of the present invention. Wherein, Lane 1 is independent PP _0337 protein, Lane 2 is independent CheA protein, Lanes 3 and 4 are proteins eluted from pull down after incubation of PP _0337 and CheA, Lanes 5 and 6 are proteins eluted after incubation of blank Ni ion affinity column and CheA, and M represents protein Marker.

FIG. 9 is an SDS-PAGE electrophoresis chart of the interaction between PP _0337 and the CheA protein detected by MBP pull down in example 5 of the present invention. Wherein, Lane 1 is MBP-PP _0337 protein alone, Lane 2 is CheA protein alone, Lanes 3 and 4 are MBP-PP _0337 and CheA protein eluted from pull down after incubation, Lanes 5 and 6 are MBP protein in a control affinity column and protein eluted after CheA incubation, and M represents protein Marker.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without any inventive step based on the embodiments of the present invention, are within the scope of the present invention.

The experimental procedures in the following examples were carried out by conventional methods unless otherwise specified, and the experimental materials used in the following examples were purchased from conventional biochemical reagents companies unless otherwise specified.

The experimental escherichia coli DH5 alpha, BL21 and pseudomonas putida KT2440 were purchased from Beijing Quanjin Biotechnology Co., Ltd, and were all grown in a conventional LB medium, and selected antibiotics and concentrations thereof used for growth were: 100. mu.g/mL ampicillin Amp, 50. mu.g/mL kanamycin Kan. The original plasmids pMAL-c2X, pET-28a and pET-52b used in the experiment were all universal vectors purchased from Biotech, Inc., of the Beijing Huayue. Conventional reagents or consumables such as antibiotics, culture media, protein expression inducers IPTG, protein purification columns and the like are purchased from reagent companies and are commonly sold in the market.

Example 1 construction of expression vector pMAL-Th8H

The implementation is to construct a protein expression vector pMAL-Th8H, and use a commercial expression vector pMAL-c2X as a framework, as shown in FIG. 1, a sequence which is added with a Thrombin (Thrombin) recognition site and 8 XHis tags (the number of His can be 6-10, and 8His are preferred in the embodiment) at the downstream of an MBP coding gene is designed, 8 common restriction enzyme sites are inserted between the Thrombin site and 8 XHis, a translation termination code is inserted at the downstream of the 8 XHis tags, the total length of the sequence is 1275bp (containing the MBP coding gene), and a specific nucleotide sequence is shown as SEQ ID NO.1 in a sequence table.

S1, synthesizing Th-MCS-8 × His segment. Forward and reverse primers are respectively designed aiming at two end sequences of the Th-MCS-8 XHis fragment and then sent to a third-party biological engineering (Shanghai) corporation for synthesis, and the primer sequences are as follows:

Th8HisS5'-CCTCGGGATCGAGGGAAGGATTTCACTGGTGCCGCGCGGCAGCGAATTCGGATCCTCTAGAGTCGACCTGCAG-3'(SEQ ID NO.2)

Th8HisA5'-GACGTTGTAAAACGACGGCCAGTGCTTAGCTGCTGCCGTGATGGTGATGATGATGATGATGAAGCTTCTCGAGGGTACCCCCGGGCTGCAGGTCGACTCTAGAGGATCCGAATTC-3'(SEQ ID NO.3)

as shown in the combined figure 2, 25 bases at the 5' ends of the two primers are homologous sequences on a pMAL-c2X expression vector, so that the primers can be conveniently connected with the vector by utilizing homologous recombination subsequently; the 25 bases at the 3' ends of the two primers are reverse complementary sequences and can be paired with each other to form a double strand. After the synthesized primer dry powder was centrifuged at 12000rpm for 5min, the primer was dissolved in TE buffer (10mmol/L Tris-HCl, 1mmol/L EDTA) having a pH of 8.0 to a final concentration of 10. mu. mol/L.

Primers and high fidelity DNA polymerase premix (available from Biotech, Inc., of Okins, Beijing) were added in a total volume of 55 μ L: 2.5. mu.L each of Th8HisS and Th8HisA, 50. mu.L of high fidelity DNA polymerase premix. After uniformly mixing, carrying out amplification reaction on a PCR instrument, wherein the PCR amplification procedure is as follows: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 15s, annealing at 60 ℃ for 60s, extension at 72 ℃ for 30s, repeating for 10 cycles; extension at 72 ℃ for 60 s; 20 ℃ for 10 s.

As shown in FIG. 2, in the PCR process, after annealing reaction, Th8HisS and Th8HisA are paired by virtue of their complementary sequences at the 3' ends to form a partial double strand, and in the subsequent extension process, high fidelity polymerase will amplify from both sides of the complementary sequences to complete the two strands and obtain two DNA strands that are completely complementary. After completion of the extension reaction, the synthesized fragment was recovered using a PCR product recovery kit (purchased from a living organism) and named Th-MCS-8 XHis.

S2, carrying out double digestion on the vector plasmid pMAL-c2X by EcoRI and HindIII, recovering a vector fragment, removing the original multiple cloning sites on the vector by the digestion process, and enabling the terminal sequence of the formed linear vector to correspond to the homologous sequence site sequence added in the step S1. The linear vector fragment was cleaved with EcoRI and HindIII restriction enzymes as follows: mu.L of pMAL-c2X (50 ng/. mu.L), 2. mu.L of Q.cut EcoRI (Takara), 2. mu.L of Q.cut HindIII (Takara), 5. mu.L of 10 XQ.cut buffer, 26. mu.L of deionized water, in a total volume of 50. mu.L. Mixing, standing at 37 deg.C, and reacting for 1 h.

And (3) carrying out 1% agarose gel electrophoresis on the enzyme digestion product, carrying out constant-pressure 140V electrophoresis for 25min, then cutting a carrier strip of a mesh under an ultraviolet gel cutting instrument, and recovering the carrier after enzyme digestion by using a gel recovery kit (Takara), thereby obtaining a linearized pMAL-c2X carrier fragment.

S3, treating the Th-MCS-8 XHis fragment and the linearized pMAL-c2X vector fragment with T5 exonuclease to obtain a sticky end. The T5 exonuclease degrades DNA in the 5'→ 3' direction, which degrades double-stranded DNA, single-stranded DNA, and linear plasmid DNA. As shown in FIG. 3, the ends of the Th-MCS-8 XHis fragment and the pMAL-c2X vector fragment were partially cleaved with an enzyme to form a sticky end. The enzyme digestion system is as follows: mu.L of linearized pMAL-c2X vector (10 ng/. mu.L), 6.5. mu.L of the fragment of interest (50 ng/. mu.L), 1. mu. L T5 exonuclease, 2. mu.L of 10 XT 5 Exo Buffer, total volume 20. mu.L. And (3) putting the enzyme digestion system in water bath at 30 ℃ for 40min, then putting the enzyme digestion system on ice to terminate the enzyme digestion reaction, and directly using the cooled reaction product for a subsequent transformation experiment.

S4, transforming the reaction product into Escherichia coli DH5 alpha competent cells and sequencing to determine the sequence of the constructed vector. The transformation method comprises the following steps: adding the reaction product in the step S3 into 100 mu L of Escherichia coli DH5 alpha competent cell suspension, and standing for 20min on ice; heat shock is carried out in 42 ℃ water bath for 90s, 700 mu L of LB liquid culture medium without antibiotics is added, and shaking culture is carried out at 37 ℃ for 60 min; centrifuging at 5000rpm for 3min, removing supernatant, collecting about 100 μ L of bacterial liquid, and uniformly coating on LB solid culture medium containing antibiotic Amp, wherein the final concentration of Amp in the culture dish is 100 μ g/mL; inversely culturing the culture dish at 37 ℃ for 12-16 h, and taking out when bacterial colonies grow well and are not overlapped with each other; selecting colonies, and sequencing by Biotechnology engineering (Shanghai) Co., Ltd; the sequencing results were compared with the designed vector sequences on-line using NCBI BLAST. The sequencing primer sequences used were: 5'-TCCCGCAGATGTCCGCTTTC-3', as shown in SEQ ID NO.4 of the sequence list.

As shown in FIG. 4, the sequencing results confirmed by alignment that the target region of the constructed plasmid was identical to the pre-designed sequence, and the constructed expression vector was named pMAL-Th 8H.

Example 2 expression and purification of the Membrane protein PP _0337 with pMAL-Th8H

PP _0337 is a phosphodiesterase in the model strain Pseudomonas putida KT2440, localized in the cell membrane and responsible for the degradation of the second messenger c-di-GMP. It is difficult to obtain soluble PP _0337 protein by conventional expression methods. In this example, the vector pMAL-Th8H constructed in example 1 was used to express and purify PP _0337 protein by the following specific steps:

s1, PCR amplification of PP _0337 encoding gene. Performing PCR amplification on a PP _0337 encoding gene by using a pseudomonas putida KT2440 genome as a template, wherein the used primer sequences are as follows:

PP_0337S：5'-CGGGATCCATGAAAAGCCAACCCGATG-3'(SEQ ID NO.5)

PP_0337A：5'-CCCTCGAGACGCGGATAGCGCTTCAG-3'(SEQ ID NO.6)

the product was recovered using a PCR recovery kit and the amplified product was 2676bp in length and contained the entire PP _0337 coding region, except for the translation termination code.

S2, constructing recombinant plasmids pMAL-Th8H-PP _0337 and pET-28a-PP _ 0337. The amplified PP _0337 encoding gene and the vector pMAL-Th8H are subjected to double enzyme digestion by BamHI and XhoI respectively, the enzyme digestion product is recovered by a DNA purification kit, the two fragments are subjected to enzyme ligation after recovery, escherichia coli DH5 alpha competent cells are transformed, sequencing verification is carried out, and the correct plasmid is named as pMAL-Th8H-PP _ 0337. PP _0337 was ligated to the protein expression vector pET-28a in the same manner as above to obtain a recombinant plasmid pET-28a-PP _ 0337. In this example, restriction enzyme method was used to link PP _0337 encoding gene in order to verify whether the restriction enzyme site in the pMAL-Th8H vector could be used normally; if the target gene fragment contains various enzyme cutting sites and cannot use restriction enzymes, the T5 exonuclease method can be used for constructing pMAL-Th8H-PP _0337, and only the homologous sequence of the pMAL-Th8H vector is added at the 5' end when designing the target gene amplification primer, and then the construction is carried out according to the operation method in the example 1.

S3, and the fusion protein MBP-PP _0337-8 XHis induction expression. Respectively introducing recombinant plasmids pMAL-Th8H-PP _0337 and pET-28a-PP _0337 into escherichia coli BL21 competent cells, picking single colonies, shaking at 37 ℃, culturing overnight, then inoculating into 200mL of fresh LB liquid culture medium, shaking at 37 ℃, culturing for about 4h, then adding IPTG with the final concentration of 0.4mM to induce protein expression, inducing for 10h at 16 ℃, and then centrifuging to collect thalli.

And (4) purifying the S4 and PP _0337 protein. Adding lysis buffer (20mM Tris-HCl, pH 7.8, 300mM KCl, 10% glycerol) to the collected cells in step S3, disrupting the cells with a pressure disrupter, and filtering with a 0.22 μm filter to remove the precipitate; adding Thrombin (Thrombin), and incubating at room temperature for 20min to excise the MBP tag; and (2) purifying the PP _0337-8 XHis fusion protein by using a Ni ion affinity chromatography column, washing the hybrid protein by using imidazole with the concentration of 20mM, washing the hybrid protein by using a lysis buffer containing imidazole with the concentration of 50mM after the hybrid protein is completely washed, until the protein can not be detected in an effluent, and eluting the PP _0337 protein by using the lysis buffer containing imidazole with the concentration of 250mM so as to obtain soluble PP _0337 protein. In this embodiment, the Ni ion affinity column (His as purification tag) is used to obtain PP _0337 protein with high efficiency, and if the Ni ion affinity column is used to purify other insoluble proteins with low efficiency, the agarose gel column with dextrin-specific ligand (MBP as purification tag) can be used to purify the target protein, but it should be noted that Thrombin (Thrombin) should be added after the impurity protein is washed clean; adding Thrombin for enzyme digestion, and continuously eluting to obtain the soluble target protein.

Verification of S5, purified PP _0337 protein and its activity. The purified PP _0337 protein was first verified by SDS-PAGE and, as shown in FIG. 5, soluble PP _0337 protein was obtained using the pMAL-Th8H-PP _0337 expression vector, whereas PP _0337 was only present in the pellet when induced using the pET-28a-PP _0337 expression vector and soluble PP _0337 protein could not be obtained after purification. Then, the presence or absence of phosphodiesterase activity in PP _0337 was examined by using c-di-GMP labeled with isotope P32, and as a result, as shown in FIG. 6, only c-di-GMP was found in the lane without protein, pGpGpGpGpGpGpG (product of c-di-GMP degradation) appeared after PP _0337 protein was added, and the amount of pGpG gradually increased with the increase in the amount of PP _0337 protein added, indicating that the purified PP _0337 protein had phosphodiesterase activity.

In conclusion, the pMAL-Th8H expression vector constructed by the invention can express the insoluble membrane protein PP _0337, and the purified PP _0337 protein has normal phosphodiesterase activity.

Example 3 detection of the interaction of Membrane protein PP _0337 with CheA protein Using His pull down assay

The CheA protein is a chemotactic kinase widely present in various gram-negative bacteria and plays a key regulatory role in bacterial chemotactic activity. Previous studies demonstrated the interaction between the CheA and PP 0337 proteins in pseudomonas using a bacterial two-hybrid approach, but this result was observed in the host bacterium, escherichia coli, and was not a more direct visual in vitro result. In this example, the PP _0337 protein obtained in example 2 was used, and a pull down technique was used to visually detect whether there is an interaction between PP _0337 and the CheA protein, and the operation flow is shown in fig. 7. The specific operation steps are as follows:

s1, expressing and purifying the CheA protein. Firstly, taking a pseudomonas putida KT2440 genome as a template, and carrying out PCR amplification on a CheA coding gene, wherein the used primer sequences are as follows:

CheAsense：5'-CGGGATCCTATGAGCTTCGGCGCCGAT-3'(SEQ ID NO.7)

CheAanti：5'-CGAGCTCCGGCGGAAGAAACCAGAA-3'(SEQ ID NO.8)

CheA does not belong to insoluble protein, a pET-52b vector with Strep-tag II labels is used for constructing a fusion protein expression vector, the expressed fusion protein is purified by a Strep-Tactin resin chromatographic column, and an expression vector construction method and a CheA protein purification method are commonly found in various molecular cloning experimental guidelines and reagent specifications. The purified CheA protein was placed on ice for future use.

S2, PP _0337 protein was purified according to the method of example 2, and the procedure was carried out until the MBP tag was cut off by adding Thrombin and the column was washed with lysis buffer containing imidazole at a concentration of 50mM until no protein was detected in the effluent, i.e., PP _0337 protein bound to the column. Meanwhile, a blank Ni ion affinity chromatographic column is arranged for a control experiment.

S3, adding the purified CheA protein in the step S1 into the Ni ion affinity chromatographic column in the step S2, sealing the column by a cover, slightly reversing and uniformly mixing the mixture to ensure that the resin matrix in the Ni column is uniformly distributed in the whole column; the column is horizontally placed in an ice box, the ice box is placed on a shaking table to be slowly shaken for 4 hours at a speed of 20r/min and then taken out; vertically placing a Ni ion affinity column, standing for 10min, and allowing a resin matrix in the Ni column to precipitate to the bottom of the column; the lid was opened to allow the protein solution to flow out, and lysis buffer containing 20mM imidazole was added to rinse the column until no protein was detected in the effluent; PP _0337 and possibly bound CheA protein were eluted with lysis buffer containing imidazole at a concentration of 250mM and the eluted protein was collected. The blank Ni column of the control group was similarly loaded with CheA protein and eluted, and the eluted protein was collected.

S4, preparing SDS-PAGE gel, running the protein collected in the step S3, staining with Coomassie brilliant blue and observing the result. SDS-PAGE gel preparation, protein sample processing, and gel running methods are commonly found in various molecular cloning protocols. As a result, as shown in fig. 8, PP 0337 protein and CheA protein were simultaneously detected in the final Ni column effluent of the experimental group, while CheA protein was not detected in the Ni column effluent of the control group, indicating that Ni column could not bind CheA protein, and CheA protein could be retained on the column only when PP 0337 protein and CheA protein were bound, thus allowing detection in the final effluent, thus confirming that there was a direct interaction between PP 0337 protein and CheA protein.

Example 4 screening of Pseudomonas putida KT2440 holoprotein for interaction with PP _0337 Using the His pull down assay

S1, PP _0337 protein was expressed by induction as in example 2, after disrupting the cells, filtering the disrupted cells with a 0.22 μm filter and treating with Thrombin for 20min to cleave off the MBP tag, and then the whole protein was applied to a Ni ion affinity column, and the contaminating proteins were washed with lysis buffers containing 20mM and 50mM imidazole in turn until no protein was detected in the effluent. Meanwhile, a blank Ni ion affinity chromatographic column is arranged for a control experiment.

S2, culturing pseudomonas putida KT 2440200 mL by using an LB liquid culture medium, performing shake culture at 30 ℃ for 12h, and centrifugally collecting thalli; adding lysis buffer solution and breaking cells, filtering with 0.22 μm filter membrane, and adding cell lysis solution into Ni ion affinity chromatography column in step S1; sealing with a cover, and slightly reversing and uniformly mixing to uniformly distribute the resin matrix in the Ni column in the whole column; the column is horizontally placed in an ice box, the ice box is placed on a shaking table to be slowly shaken for 6 hours at a speed of 20r/min and then taken out; vertically placing a Ni ion affinity column, standing for 10min, and allowing a resin matrix in the Ni column to precipitate to the bottom of the column; the lid was opened to allow the protein solution to flow out, and lysis buffer containing 20mM imidazole was added to rinse the column until no protein was detected in the effluent; PP _0337 and bound proteins were eluted with lysis buffer containing imidazole at a concentration of 250mM, and the eluted proteins were collected. The same amount of cell lysate was added to the control blank Ni column and eluted, and the eluted protein was collected.

S3, preparing SDS-PAGE gel, running the protein collected in the step S2, staining with Coomassie brilliant blue and observing the result. SDS-PAGE gel preparation, protein sample processing, and gel running methods are commonly found in various molecular cloning protocols. And observing the SDS-PAGE experimental result, comparing proteins flowing out of the Ni ion affinity column of the control group, finding out protein bands which do not exist in the control group except PP _0337 in the experimental group, cutting the protein bands, sending the cut protein bands to Huada gene company for mass spectrum sequencing, and determining the proteins and the coding genes in the cut protein bands.

S4, constructing an expression vector of the protein to be detected according to the mass spectrum sequencing result, and detecting whether the protein to be detected and the PP _0337 protein have interaction or not according to the method in the embodiment 3.

Example 5 detection of the interaction of the Membrane protein PP _0337 with the CheA protein Using the MBP pull down experiment

In this example, an MBP pull down experiment was used to detect the interaction between membrane protein PP _0337 and the CheA protein, and the specific operation steps were as follows:

s1, the method of the same example 3 expresses and purifies the CheA protein.

S2, inducing and expressing the fusion protein MBP-PP _0337-8 XHis according to the method of the embodiment 2; as a control, plasmid pMAL-c2X was introduced into E.coli BL21 to induce expression of MBP-tagged protein alone. The two groups of cells were lysed and the proteins were purified using agarose gel columns with dextrin-specific ligands.

After the cell lysate of the experimental group is loaded on the column, the cell lysate is washed by a lysis buffer solution until no protein flows out, and only MBP-P _0337-8 XHis fusion protein is remained on the column by default; similarly, control cell lysates were added to the purification column and washed with the same buffer until no protein was eluted.

S3, adding the CheA protein purified in the step S1 into the two groups of purification columns (experimental group and control group) in the step S2, sealing the two groups of purification columns by using a cover, and slightly and evenly mixing the two groups of purification columns in a reverse mode to ensure that the resin matrix in the purification columns is evenly distributed in the whole columns; the column is horizontally placed in an ice box, the ice box is placed on a shaking table to be slowly shaken for 4 hours at the speed of 20 r/min; vertically placing a purification column, standing for 10min, and allowing the resin matrix in the purification column to precipitate to the bottom of the column; the cap was opened to allow protein fluid to flow out, the column was washed with lysis buffer until no protein flowed out, then eluted with lysis buffer containing 10mM maltose, MBP/MBP-P _0337-8 XHis fusion protein and protein bound thereto were eluted, and the eluted protein was collected.

S4, preparing SDS-PAGE gel, running the protein collected in the step S3, staining with Coomassie brilliant blue and observing the result. SDS-PAGE gel preparation, protein sample processing, and gel running methods are commonly found in various molecular cloning protocols. As shown in FIG. 9, MBP-P _0337-8 XHis fusion protein and CheA protein were simultaneously detected in the effluent of the experimental group purification column, while only MBP protein and no CheA protein were detected in the effluent of the control group purification column, indicating that the purification column could not bind to CheA protein, and only MBP-P _0337-8 XHis fusion protein and CheA protein were bound, the CheA protein was retained, thereby indicating that there was a direct interaction between PP _0337 protein and CheA protein in the effluent.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> university of agriculture in Huazhong

<120> an expression vector and method for detecting membrane protein interaction in bacteria

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1275

<212> DNA

<213> (Artificial sequence)

<400> 1

atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60

ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120

ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180

atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240

accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300

aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360

gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420

aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480

ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540

gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600

aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660

ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720

gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780

ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc aaaagagttc 840

ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900

ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960

actatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020

tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080

gccctgaaag acgcgcagac taattcgagc tcgaacaaca acaacaataa caataacaac 1140

aacctcggga tcgagggaag gatttcactg gtgccgcgcg gcagcgaatt cggatcctct 1200

agagtcgacc tgcagcccgg gggtaccctc gagaagcttc atcatcatca tcatcaccat 1260

cacggcagca gctaa 1275

<210> 2

<211> 73

<212> DNA

<213> (Artificial sequence)

<400> 2

cctcgggatc gagggaagga tttcactggt gccgcgcggc agcgaattcg gatcctctag 60

agtcgacctg cag 73

<210> 3

<211> 115

<212> DNA

<213> (Artificial sequence)

<400> 3

gacgttgtaa aacgacggcc agtgcttagc tgctgccgtg atggtgatga tgatgatgat 60

gaagcttctc gagggtaccc ccgggctgca ggtcgactct agaggatccg aattc 115

<210> 4

<211> 20

<212> DNA

<213> (Artificial sequence)

<400> 4

tcccgcagat gtccgctttc 20

<210> 5

<211> 27

<212> DNA

<213> (Artificial sequence)

<400> 5

cgggatccat gaaaagccaa cccgatg 27

<210> 6

<211> 26

<212> DNA

<213> (Artificial sequence)

<400> 6

ccctcgagac gcggatagcg cttcag 26

<210> 7

<211> 27

<212> DNA

<213> (Artificial sequence)

<400> 7

cgggatccta tgagcttcgg cgccgat 27

<210> 8

<211> 25

<212> DNA

<213> (Artificial sequence)

<400> 8

cgagctccgg cggaagaaac cagaa 25

Claims (10)

1. An expression vector for detecting membrane protein interactions in bacteria, comprising: the kit comprises a double-label fragment, wherein the double-label fragment is sequentially connected with an MBP coding gene, a thrombin recognition site coding sequence, a multiple cloning site, a His label coding sequence and a translation termination code.

2. The expression vector for detecting membrane protein interaction in bacteria according to claim 1, wherein: the nucleotide sequence of the double-label fragment is shown as SEQ ID NO.1 in the sequence table.

3. Use of the expression vector of claim 1 for detecting membrane protein interactions in bacteria.

4. A method for constructing the expression vector of claim 1, comprising the steps of:

s1, mixing a forward primer with a nucleotide sequence shown as SEQ ID NO.2 in the sequence table and a reverse primer with a nucleotide sequence shown as SEQ ID NO.3 in the sequence table with the high-fidelity DNA polymerase premix for PCR reaction to obtain a PCR product of a Th-MCS-8 × His fragment;

s2, carrying out enzyme digestion on the plasmid pMAL-c2X, and recovering to obtain a linearized pMAL-c2X vector fragment;

s3, carrying out enzyme digestion on the Th-MCS-8 × His fragment and the linearized pMAL-c2X vector fragment by using T5 exonuclease;

s4, transforming the enzyme digestion product obtained in the step S3 into escherichia coli DH5 alpha, extracting a plasmid, and performing sequencing verification to obtain an expression vector pMAL-Th 8H.

5. The method for constructing an expression vector according to claim 4, wherein in step S1, the PCR reaction program comprises: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 15s, annealing at 60 ℃ for 60s, extension at 72 ℃ for 30s, repeating for 10 cycles; extension at 72 ℃ for 60 s; 20 ℃ for 10 s.

6. The method of claim 4, wherein the expression vector is constructed by: in step S2, the restriction enzyme is double-digested with restriction enzymes EcoRI and HindIII.

7. A method for detecting membrane protein interactions in bacteria, comprising the steps of:

sa, constructing an expression vector pMAL-Th8H-X containing the target protein X coding gene X;

sb, transforming an expression vector pMAL-Th8H-X into escherichia coli BL21, and inducing and expressing fusion protein MBP-X-8 xHis;

sc, purifying the fusion protein MBP-X-8 XHis by using an affinity chromatography column;

sd, capturing the protein interacting with the target protein X through an MBP pull down experiment, or capturing the protein interacting with the target protein X through an His pull down experiment after cutting off an MBP label by thrombin;

and Se, verifying whether the protein to be detected interacts with the target protein through SDS-PAGE, and screening the interacting protein of the target protein through mass spectrometry sequencing.

8. The method for detecting membrane protein interactions in bacteria according to claim 7, wherein in step Sa, the process for constructing the expression vector pMAL-Th8H-x comprises the steps of: PCR amplifying a target gene x, and introducing double enzyme cutting sites at two ends of the target gene x; and carrying out enzyme digestion and ligation on the amplification product and the vector pMAL-Th8H by using the same restriction enzyme, transforming the amplification product and the vector pMAL-Th8H into escherichia coli DH5 alpha, extracting a plasmid, and carrying out sequencing verification to obtain an expression vector pMAL-Th 8H-x.

9. The method for detecting membrane protein interactions in bacteria according to claim 7, wherein in step Sa, the process for constructing the expression vector pMAL-Th8H-x comprises the steps of: PCR amplifying a target gene x, and introducing vector pMAL-Th8H homologous sequences at two ends of the target gene x; carrying out enzyme digestion on the amplification product and a vector pMAL-Th8H by using T5 exonuclease; and transforming the obtained enzyme digestion product into escherichia coli DH5 alpha, extracting a plasmid, and performing sequencing verification to obtain an expression vector pMAL-Th 8H-x.

10. The method for detecting membrane protein interactions in bacteria according to claim 7, wherein: in the step Sc, the affinity chromatographic column is a Ni ion affinity chromatographic column or an agarose gel column with dextrin specificity petunidin.

Images