CN112063643B - Expression vector and method for detecting interaction of membrane proteins in bacteria - Google Patents

Abstract

The invention discloses an expression vector and a method for detecting interaction of membrane proteins in bacteria. Firstly, constructing a double-tag protein expression vector with a maltose binding protein tag (MBP) and a histidine tag (8 XHis), and using the vector to express and purify indissoluble membrane proteins, so as to increase the solubility of the membrane proteins; then, the interaction between the membrane protein and other proteins is detected by using a pull down technology, and meanwhile, the method can also be used for screening the proteins which interact with the membrane protein in the bacterial whole cell proteins. The method for detecting interaction of the membrane proteins in bacteria breaks through the technical difficulty of indissolvable membrane proteins in prokaryotes, provides an experimental means for researching the functions of the membrane proteins in bacteria, and has important application value.

Description

Expression vector and method for detecting interaction of membrane proteins in bacteria

Technical Field

The invention relates to the technical field of genetic engineering, in particular to an expression vector and a method for detecting interaction of membrane proteins in bacteria.

Background

Protein interactions refer to the process by which two or more protein molecules form protein complexes via non-covalent bonds, and are the basis of all known cellular vital activities. Research on interactions between proteins is of great importance for deep exploration of protein functions and revealing vital activity mechanisms. The current methods for studying protein interactions mainly comprise yeast/bacteria double hybridization, phage display technology, surface plasmon resonance technology, fluorescence energy transfer technology, co-immunoprecipitation technology, pull down experiments and the like. Among them, pull down experiment has been an in vitro experimental technique for effectively verifying protein interactions due to advantages of simple operation, low cost, low requirements for instruments and equipment, and the like, and has been popular with a large number of researchers in recent years. The most widely used in the current research is GST (Glutathione-S-transferase) pull down, the basic principle is to fuse target protein and GST label, then to carry out affinity solidification on Glutathione marked magnetic beads, to incubate protein solution to be tested, to capture protein which has interaction with the target protein, to elute the conjugate, and then to carry out SDS-PAGE analysis, thus confirming the interaction between the two proteins. However, due to the larger molecular weight of the GST tag, about 26kDa, the activity of the target protein fused thereto may be affected, thereby affecting the result of the subsequent pull down. In addition, as with other in vitro protein interaction detection techniques, the precondition of the GST pull down experiment is that the target protein GST fusion protein can be folded normally in host bacteria to form active fusion protein, and can be purified with higher efficiency, and the low solubility is a difficult problem for researchers in interaction research of some indissoluble proteins. GST is a protein derived from schistosoma japonicum, and has better expression and folding effects in eukaryotic cells than in prokaryotic cells, so that GST tags are widely used in eukaryotic protein expression and pull down experiments, which are not the best choice.

Membrane proteins are proteins contained in biological membranes and are the main contributors to the function of biological membranes. Membrane proteins with single or multiple transmembrane structures are prone to aggregation, making it difficult to solubilize in host bacteria, often to obtain proteins with active functions, and thus affecting subsequent studies of membrane protein interactions. The method for purifying the membrane protein is to use a detergent to dissolve the membrane protein, but the types of detergents suitable for dissolving the membrane protein are different due to different types of the membrane protein, and a great deal of time is required to search for conditions; second, the detergent has an effect on subsequent experiments, and the process of removing the detergent can take a lot of time. Therefore, developing a pull down method suitable for detecting interactions of membrane proteins in bacteria has important significance for researching functions of the bacterial membrane proteins.

Disclosure of Invention

In view of the above, the invention provides an expression vector and a method for detecting membrane protein interaction in bacteria, which are convenient for expressing and purifying indissolvable membrane proteins in bacteria and detecting the interaction proteins of the membrane proteins of bacteria.

The technical scheme of the invention is realized as follows:

in a first aspect, the invention provides an expression vector for detecting interactions of membrane proteins in bacteria, the expression vector comprising a double-tag fragment, wherein the double-tag fragment is sequentially connected with an MBP coding gene, a thrombin recognition site coding sequence, a multiple cloning site, a His tag coding sequence and a translation termination code.

On the basis of the technical scheme, preferably, the nucleotide sequence of the double-tag fragment is shown as SEQ ID NO.1 in a sequence table.

In a second aspect, the invention provides the use of an expression vector according to the first aspect for detecting membrane protein interactions in bacteria.

In a third aspect, the present invention provides a method for constructing the expression vector of the first aspect, comprising the steps of:

s1, mixing a forward primer with a nucleotide sequence shown as SEQ ID NO.2 in a sequence table, a reverse primer with a nucleotide sequence shown as SEQ ID NO.3 in the sequence table with a high-fidelity DNA polymerase premix, and carrying out PCR reaction to obtain a PCR product which is a Th-MCS-8 xHis fragment;

s2, carrying out enzyme digestion on the plasmid pMAL-c2X, and recovering to obtain a linearized pMAL-c2X carrier fragment;

s3, simultaneously carrying out enzyme digestion on the Th-MCS-8 xHis fragment and the linearized pMAL-c2X carrier fragment by using T5 exonuclease;

s4, converting the enzyme digestion product obtained in the step S3 into escherichia coli DH5 alpha, extracting plasmids, and carrying out sequencing verification to obtain an expression vector pMAL-Th8H.

Based on the above technical solution, preferably, in step S1, the PCR reaction procedure is as follows: pre-denaturation at 98℃for 3min; denaturation at 98℃for 15s, annealing at 60℃for 60s, extension at 72℃for 30s, 10 cycles were repeated; extending at 72 ℃ for 60s; and at 20℃for 10s.

On the basis of the above technical scheme, preferably, in the step S2, the restriction enzyme is double restriction enzyme digestion with restriction enzymes EcoRI and HindIII.

In a fourth aspect, the present invention also provides a method for detecting membrane protein interactions in bacteria, comprising the steps of:

sa, constructing an expression vector pMAL-Th8H-X containing a target protein X coding gene X;

sb, converting an expression vector pMAL-Th8H-X into escherichia coli BL21, and inducing to express a fusion protein MBP-X-8 xHis;

sc, purifying the fusion protein MBP-X-8 XHis by using an affinity chromatography column;

sd, capturing the protein interacted with the target protein X through an MBP pull down experiment, or capturing the protein interacted with the target protein X through a His pull down experiment after the MBP tag is excised by thrombin;

se, checking whether the protein to be tested interacts with the target protein through SDS-PAGE, and screening the interaction protein of the target protein through mass spectrum sequencing.

On the basis of the above technical solution, preferably, in step Sa, the process of constructing the expression vector pMAL-Th8H-x includes the steps of: amplifying a target gene x by PCR, and introducing double enzyme cutting sites at two ends of the target gene x; and (3) carrying out enzyme digestion and connection on the amplified product and the vector pMAL-Th8H by using the same restriction enzyme, converting the amplified product into escherichia coli DH5 alpha, extracting plasmids, and carrying out sequencing verification to obtain the expression vector pMAL-Th8H-x.

On the basis of the above technical solution, preferably, in step Sa, the process of constructing the expression vector pMAL-Th8H-x includes the steps of: amplifying a target gene x by PCR, and introducing a vector pMAL-Th8H homologous sequence at two ends of the target gene x; simultaneously carrying out enzyme digestion on the amplified product and a vector pMAL-Th8H by using T5 exonuclease; and (3) converting the obtained enzyme digestion product into escherichia coli DH5 alpha, extracting plasmids, and sequencing and verifying to obtain an expression vector pMAL-Th8H-x.

Based on the above technical scheme, preferably, in the step Sc, the affinity chromatography column is a Ni ion affinity chromatography column or an agarose gel column with dextrin-specific ligands.

Compared with the prior art, the expression vector and the method for detecting the interaction of the membrane proteins in bacteria have the following beneficial effects:

(1) The maltose binding protein (Maltose binding protein, MBP) label used in the invention is coded by the MBP gene of the escherichia coli K12 strain, and is in native expression when expressed in escherichia coli host bacteria, so MBP can be quickly and effectively folded into a natural structure when synthesized on a ribosome, and a target protein which is being folded at the downstream can be promoted to obtain a correct structure through an isomerism reaction;

(2) The expression vector provided by the invention is provided with the MBP and His double tags, so that either the MBP or the His can be selected as a proper purification tag according to the affinity between the target protein and the chromatographic column, the purification efficiency is improved, and the interaction protein can be successfully captured through a pull down experiment;

(3) The invention detects the interaction of indissolvable membrane proteins in bacteria by using a pull down technology, and has the advantages of simple operation, high efficiency, real and reliable detection result and good repeatability.

Drawings

In order to more clearly illustrate the embodiments of the invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, it being obvious that the drawings in the following description are only some embodiments of the invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a plasmid map of the expression vector pMAL-Th8H constructed in accordance with the present invention.

FIG. 2 is a schematic diagram showing the base arrangement, annealing, and extension of primers Th8HisS and Th8HisA in example 1 of the present invention.

FIG. 3 is a schematic diagram showing the procedure for constructing the vector pMAL-Th8H using T5 exonuclease in example 1 of the present invention.

FIG. 4 shows the result of sequencing the transformant according to example 1 of the present invention compared with the pre-designed pMAL-Th8H sequence.

FIG. 5 is a SDS-PAGE electrophoresis of purified PP_0337 using pMAL-Th8H-PP_0337 and pET-28a-PP_0337 expression in example 2 of the present invention. Lanes 1 and 2 are the supernatant and pellet of BL21 whole cell lysate carrying pMAL-Th8H-PP_0337, lanes 3 and 4 are the eluate obtained by purifying PP_0337 protein with pMAL-Th8H-PP_0337 expression vector, lanes 5 and 6 are the supernatant and pellet of BL21 whole cell lysate carrying pET-28a-PP_0337, lanes 7 and 8 are the eluate obtained by purifying PP_0337 protein with pET-28a-PP_0337 expression vector, and M represents protein Marker.

FIG. 6 shows the measurement result of the phosphodiesterase activity of the PP_0337 protein purified in example 2 according to the invention. Lane 1, among others, is a blank control without protein; lane 2, 2. Mu.L PP_0337 was added; lane 3, 4 μl pp_0337 was added; lane 4 is the addition of 8 μl pp_0337.

FIG. 7 is a flow chart of the detection of the interaction of insoluble membrane protein PP_0337 according to the method of the invention.

FIG. 8 is a SDS-PAGE electrophoresis of the interaction of PP_0337 and the CheA protein detected by His pull down in example 3 of the present invention. Wherein, lane 1 is PP_0337 protein alone, lane 2 is CheA protein alone, lanes 3 and 4 are PP_0337 and proteins eluted by pull down after incubation with CheA, lanes 5 and 6 are proteins eluted by blank Ni ion affinity column and incubation with CheA, and M represents protein Marker.

FIG. 9 is a SDS-PAGE electrophoresis of the interaction of PP_0337 and the CheA protein detected by MBP pull down in example 5 of the present invention. Wherein, lane 1 is MBP-PP_0337 protein alone, lane 2 is CheA protein alone, lanes 3 and 4 are MBP-PP_0337 and proteins eluted by pull down after incubation with CheA, lanes 5 and 6 are MBP proteins and proteins eluted after incubation with CheA in a control affinity column, and M represents protein markers.

Detailed Description

The following description of the embodiments of the present invention will clearly and fully describe the technical aspects of the embodiments of the present invention, and it is apparent that the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the present invention without making any inventive effort, are intended to fall within the scope of the present invention.

The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available from conventional biochemical reagent companies unless otherwise specified.

The experimental escherichia coli DH5 alpha, BL21 and pseudomonas putida KT2440 are purchased from Beijing full gold biotechnology Co., ltd and are grown on conventional LB culture medium, and the antibiotics used for growth and the concentrations thereof are respectively as follows: 100. Mu.g/mL ampicillin Amp, 50. Mu.g/mL kanamycin Kan. The original plasmids pMAL-c2X, pET-28a and pET-52b used in the experiments were all universal vectors purchased from Beijing Wash Vietnam Biotechnology Co. The antibiotics, culture medium, protein expression inducer IPTG, protein purification column and other conventional reagents or consumables are purchased from reagent companies and are commonly found in the market.

Example 1 construction of expression vector pMAL-Th8H

The implementation is to construct a protein expression vector pMAL-Th8H, takes a commercial expression vector pMAL-c2X as a framework, designs that a sequence for encoding Thrombin (Thrombin) recognition site and 8 XHis tag (the number of His can be 6-10, the preferred number of His is 8 in the embodiment) are added at the downstream of MBP encoding gene of the protein expression vector pMAL-c2X as shown in figure 1, meanwhile, 8 common restriction enzyme sites are inserted between the Thrombin site and the 8 XHis tag, a translation termination code is inserted at the downstream of the 8 XHis tag, the total length of the sequence is 1275bp (comprising MBP encoding gene), and a specific nucleotide sequence is shown as SEQ ID NO.1 in a sequence table.

S1, synthesizing a Th-MCS-8 xHis fragment. Forward and reverse primers are respectively designed for sequences at two ends of the Th-MCS-8 xHis fragment, and then the primers are sent to third party engineering bioengineering (Shanghai) Co., ltd for synthesis, and the primer sequences are as follows:

Th8HisS5'-CCTCGGGATCGAGGGAAGGATTTCACTGGTGCCGCGCGGCAGCGAATTCGGATCCTCTAGAGTCGACCTGCAG-3'(SEQ ID NO.2)

Th8HisA5'-GACGTTGTAAAACGACGGCCAGTGCTTAGCTGCTGCCGTGATGGTGATGATGATGATGATGAAGCTTCTCGAGGGTACCCCCGGGCTGCAGGTCGACTCTAGAGGATCCGAATTC-3'(SEQ ID NO.3)

with reference to FIG. 2, 25 bases at the 5' ends of the two primers are homologous sequences on the pMAL-c2X expression vector, so that the subsequent connection with the vector by homologous recombination is facilitated; the 25 bases at the 3' end of the two primers are reverse complementary sequences, and can be paired with each other to form a double chain. After the synthesized primer dry powder was centrifuged at 12000rpm for 5min, the primer was dissolved in TE buffer (10 mmol/L Tris-HCl,1mmol/L EDTA) at pH 8.0, and the final concentration of the primer was 10. Mu. Mol/L.

Primers and high fidelity DNA polymerase premix (available from Beijing Optimago Biotech Co., ltd.) were added in accordance with the following reaction system, in a total volume of 55. Mu.L: th8HisS and Th8HisA were 2.5. Mu.L each, and high fidelity DNA polymerase premix was 50. Mu.L. After mixing evenly, carrying out amplification reaction on a PCR instrument, wherein the PCR amplification procedure is as follows: pre-denaturation at 98℃for 3min; denaturation at 98℃for 15s, annealing at 60℃for 60s, extension at 72℃for 30s, 10 cycles were repeated; extending at 72 ℃ for 60s; and at 20℃for 10s.

As shown in FIG. 2, in the PCR process, after annealing reaction, th8HisS and Th8HisA are matched by virtue of complementary sequences at the 3' end of the sequences to form partial double chains, and in the subsequent extension process, high-fidelity polymerase is amplified from two sides of the complementary sequences, and the two chains are aligned, so that two completely complementary DNA chains are obtained. After completion of the extension reaction, the synthesized fragment was recovered with a PCR product recovery kit (purchased from an organism) and named Th-MCS-8 XHis.

S2, double digestion of the vector plasmid pMAL-c2X with EcoRI and HindIII, recovering the vector fragment, wherein the original multiple cloning site on the vector is removed in the digestion process, and the formed linear vector terminal sequence corresponds to the homologous sequence site sequence added in the step S1. The linear vector fragment was formed by cleavage with EcoRI and HindIII restriction enzymes in the following manner: 15. Mu.L pMAL-c2X (50 ng/. Mu.L), 2. Mu.L Q.cut EcoRI (Takara), 2. Mu.L Q.cut HindIII (Takara), 5. Mu.L 10 XQ.cut buffer, 26. Mu.L deionized water, and a total volume of 50. Mu.L. After being evenly mixed, the mixture is stood for reaction for 1h at 37 ℃.

And (3) carrying out 1% agarose gel electrophoresis on the enzyme-digested product, carrying out 140V electrophoresis for 25min at constant pressure, then cutting off a target vector strip under an ultraviolet gel cutting instrument, and recovering the enzyme-digested vector by using a gel recovery kit (Takara), thereby obtaining a linearized pMAL-c2X vector fragment.

S3, treating the Th-MCS-8 xHis fragment and the linearized pMAL-c2X carrier fragment with T5 exonuclease to obtain a sticky end. T5 exonuclease degrades DNA in the 5 '. Fwdarw.3' direction, which degrades double-stranded DNA, single-stranded DNA and linear plasmid DNA. As shown in FIG. 3, the ends of the Th-MCS-8 XHis fragment and the pMAL-c2X vector fragment can be partially cleaved to form cohesive ends. The enzyme digestion system is as follows: 4. Mu.L of linearized pMAL-c2X vector (10 ng/. Mu.L), 6.5. Mu.L of fragment of interest (50 ng/. Mu.L), 1. Mu. L T5 exonuclease, 2. Mu.L of 10 XT 5 Exo Buffer, total volume 20. Mu.L. The enzyme digestion system is put in a water bath at 30 ℃ for 40min, then the enzyme digestion reaction is stopped on ice, and the cooled reaction product is directly used for the subsequent conversion experiment.

S4, converting the reaction product into E.coli DH5 alpha competent cells, and sequencing to determine a construction vector sequence. The conversion method comprises the following steps: adding the reaction product in the step S3 into 100 mu L of escherichia coli DH5 alpha competent cell suspension, and standing on ice for 20min; adding 700 mu L of LB liquid medium without antibiotics after heat shock for 90s in a water bath at the temperature of 42 ℃, and culturing for 60min by shaking at the temperature of 37 ℃; centrifuging at 5000rpm for 3min, removing supernatant, collecting about 100 μl of bacterial liquid, uniformly coating onto LB solid medium containing antibiotic Amp, and keeping Amp final concentration in culture dish at 100 μg/mL; inversely culturing the culture dish at 37 ℃ for 12-16 hours, and taking out when the colony grows well and is not overlapped with each other; picking colonies, and sending to a biological engineering (Shanghai) stock company for sequencing; sequencing results were analyzed by NCBI BLAST on-line alignment with the designed vector sequences. The sequencing primer sequences used were: 5'-TCCCGCAGATGTCCGCTTTC-3' as shown in SEQ ID NO.4 of the sequence Listing.

As shown in FIG. 4, the sequencing results demonstrated that the target region of the constructed plasmid was identical to the pre-designed sequence, and the constructed expression vector was named pMAL-Th8H.

Example 2 expression and purification of Membrane protein PP_0337 Using pMAL-Th8H

Pp_0337 is a phosphodiesterase in the model strain pseudomonas putida KT2440, which localizes on the cell membrane and is responsible for degrading the second messenger c-di-GMP. It is difficult to obtain soluble PP_0337 protein by conventional expression methods. This example uses the vector pMAL-Th8H constructed in example 1 to express and purify the PP_0337 protein, and the specific procedure is as follows:

s1, PCR amplification of PP_0337 coding gene. The PCR amplification is carried out on the PP_0337 coding gene by taking the pseudomonas putida KT2440 genome as a template, and the sequence of the used primers is as follows:

PP_0337S：5'-CGGGATCCATGAAAAGCCAACCCGATG-3'(SEQ ID NO.5)

PP_0337A：5'-CCCTCGAGACGCGGATAGCGCTTCAG-3'(SEQ ID NO.6)

the product was recovered using a PCR recovery kit, and the amplified product was 2676bp in length, containing all of the PP_0337 coding region except for the translation termination codon.

S2, constructing recombinant plasmids pMAL-Th8H-PP_0337 and pET-28a-PP_0337. The amplified PP_0337 coding gene and the vector pMAL-Th8H are digested with BamHI and XhoI respectively, the digested products are recovered by a DNA purification kit, after recovery, the two fragments are subjected to enzyme ligation, competent cells of E.coli DH5 alpha are transformed, and sequencing verification is carried out, and the correct plasmid is named pMAL-Th8H-PP_0337. The PP_0337 was ligated to the protein expression vector pET-28a by the same means to obtain the recombinant plasmid pET-28a-PP_0337. In the embodiment, whether the enzyme cutting site in the pMAL-Th8H vector can be normally used or not is verified, so that a restriction enzyme method is used for connecting the PP_0337 encoding gene; if restriction endonucleases cannot be used because of the inclusion of various cleavage sites in the target gene fragment, the T5 exonuclease method can be used to construct pMAL-Th8H-PP_0337, by simply adding the homologous sequence of pMAL-Th8H vector at the 5' end when designing the target gene amplification primer, and then constructing according to the procedure in example 1.

S3, the fusion protein MBP-PP_0337-8 XHis induces expression. Recombinant plasmids pMAL-Th8H-PP_0337 and pET-28a-PP_0337 are respectively introduced into competent cells of escherichia coli BL21, single colonies are selected, inoculated into 200mL of fresh LB liquid medium after shaking and overnight culture at 37 ℃, IPTG induction protein expression with the final concentration of 0.4mM is added after shaking and culture at 37 ℃ for about 4 hours, and thalli are collected after induction at 16 ℃ for 10 hours in a centrifugal way.

S4, purifying the PP_0337 protein. Adding lysis buffer (20 mM Tris-HCl, pH 7.8, 300mM KCl,10% glycerol) to the cells collected in step S3, disrupting the cells with a pressure disrupter, and filtering the cells with a 0.22 μm filter to remove the precipitate; adding Thrombin (Thrombin), and incubating at room temperature for 20min to cleave the MBP tag; purifying the PP_0337-8 XHis fusion protein by using a Ni ion affinity chromatographic column, washing the hybrid protein by using imidazole with the concentration of 20mM, washing the hybrid protein by using a lysis buffer containing imidazole with the concentration of 50mM after the hybrid protein is completely washed, and eluting the PP_0337 protein by using the lysis buffer containing imidazole with the concentration of 250mM until the protein is not detected in effluent liquid, thereby obtaining soluble PP_0337 protein. In this embodiment, the pp_0337 protein can be obtained with high efficiency by using a Ni ion affinity column (His as a purification tag), and if the purification efficiency of the Ni ion affinity column is low during the process of purifying other insoluble proteins, an agarose gel column with dextrin-specific ligands (MBP as a purification tag) can be used to purify the target protein, but it should be noted that Thrombin (Thrombin) needs to be added after the impurity protein is washed; after Thrombin is added for enzyme digestion, elution is continued, and the effluent is soluble target protein.

S5, verification of the activity of the purified PP_0337 protein. The purified PP_0337 protein was checked and verified by SDS-PAGE, and as shown in FIG. 5, the soluble PP_0337 protein was obtained by using the pMAL-Th8H-PP_0337 expression vector, whereas PP_0337 was only present in the pellet when induced by using the pET-28a-PP_0337 expression vector, and the soluble PP_0337 protein was not obtained after purification. The presence of phosphodiesterase activity in PP_0337 was detected with the isotope P32 labeled c-di-GMP, and as shown in FIG. 6, only c-di-GMP was present in the protein-free lane, pGpGG (a product of degradation of c-di-GMP) appeared after the addition of PP_0337 protein, and the amount of pGpGpGpGG gradually increased with the increase of the addition amount of PP_0337 protein, indicating that the purified PP_0337 protein had phosphodiesterase activity.

In summary, the pMAL-Th8H expression vector constructed by the invention can express insoluble membrane protein PP_0337, and the purified PP_0337 protein has normal phosphodiesterase activity.

Example 3 interaction of Membrane protein PP_0337 with CheA protein Using His pull Down experiment

The CheA protein is a chemotactic kinase widely present in various gram-negative bacteria and plays a key regulatory role in bacterial chemotactic movement. Previous studies have demonstrated interactions between the CheA and pp_0337 proteins in pseudomonas using bacterial two-hybrid methods, but this result was observed in the host bacteria escherichia coli, with no more direct visual in vitro results. In this example, the PP_0337 protein obtained in example 2 was used to visually examine whether there was an interaction between PP_0337 and CheA protein by using the pull down technique, and the flow of the operation is shown in FIG. 7. The specific operation steps are as follows:

s1, expressing and purifying the CheA protein. Firstly, taking pseudomonas putida KT2440 genome as a template, and amplifying a CheA coding gene by PCR, wherein the sequence of the used primer is as follows:

CheAsense：5'-CGGGATCCTATGAGCTTCGGCGCCGAT-3'(SEQ ID NO.7)

CheAanti：5'-CGAGCTCCGGCGGAAGAAACCAGAA-3'(SEQ ID NO.8)

CheA is not indissoluble protein, a fusion protein expression vector is constructed by using a pET-52b vector with Strep-tag II tag, the expressed fusion protein is purified by using Strep-tag resin chromatographic columns, and an expression vector construction method and a CheA protein purification method are common in various molecular cloning experimental guidelines and reagent specifications. The purified CheA protein was placed on ice for use.

S2, purifying the PP_0337 protein according to the method in the example 2, wherein the operation is carried out until the MBP label is cut off by adding Thrombin, and washing the chromatographic column with a lysis buffer containing imidazole at a concentration of 50mM until no protein is detected in the effluent, i.e.the PP_0337 protein is bound to the column. And a blank Ni ion affinity chromatographic column is arranged at the same time and used for a control experiment.

S3, adding the purified CheA protein in the step S1 into the Ni ion affinity chromatography column in the step S2, sealing by a cover, gently reversing and uniformly mixing, and uniformly distributing resin matrixes in the Ni column into the whole column; placing the column in an ice box horizontally, placing the ice box on a shaking table to shake slowly, shaking for 4 hours at 20r/min, and taking out; vertically placing a Ni ion affinity column, standing for 10min, and precipitating resin matrix in the Ni column to the bottom of the column; opening the cover to allow the protein solution to flow out, and adding a lysis buffer containing imidazole with the concentration of 20mM to wash the column until the protein is not detected in the effluent; PP_0337 and possibly bound CheA protein were eluted with lysis buffer containing imidazole at a concentration of 250mM and the eluted protein was collected. The control blank Ni column was also loaded with CheA protein and eluted, and the eluted protein was collected.

S4, preparing SDS-PAGE gel, running the protein collected in the step S3, staining with coomassie brilliant blue and observing the result. SDS-PAGE gel preparation, protein sample treatment and gel running methods are common in various molecular cloning experimental guidelines. As a result, as shown in FIG. 8, PP_0337 protein and CheA protein were simultaneously detected in the final Ni column effluent of the experimental group, while no CheA protein was detected in the Ni column effluent of the control group, indicating that the Ni column could not bind to the CheA protein, and only when PP_0337 protein and the CheA protein were bound, the CheA protein could be retained on the column, thereby allowing detection in the final effluent, thus confirming the direct interaction between PP_0337 protein and the CheA protein.

Example 4 screening of proteins interacting with PP_0337 from Pseudomonas putida KT2440 Total protein Using His pull Down experiment

S1, inducing and expressing PP_0337 protein according to the method in example 2, crushing cells, filtering with a 0.22 mu m filter membrane, adding Thrombin for 20min to cut off MBP labels, adding the whole protein into a Ni ion affinity chromatography column, and washing the mixed protein with a lysis buffer containing imidazole with the concentration of 20mM and 50mM in sequence until no protein is detected in effluent. And a blank Ni ion affinity chromatographic column is arranged at the same time and used for a control experiment.

S2, culturing pseudomonas putida KT2440 200mL by using an LB liquid culture medium, performing shake culture at 30 ℃ for 12 hours, and centrifugally collecting thalli; adding a lysis buffer solution, crushing cells, filtering with a 0.22 mu m filter membrane, and adding the cell lysis solution into the Ni ion affinity chromatography column in the step S1; sealing with a cover, gently reversing and uniformly mixing to uniformly distribute the resin matrix in the Ni column in the whole column; placing the column in an ice box horizontally, placing the ice box on a shaking table to shake slowly, shaking for 6 hours at 20r/min, and taking out; vertically placing a Ni ion affinity column, standing for 10min, and precipitating resin matrix in the Ni column to the bottom of the column; opening the cover to allow the protein solution to flow out, and adding a lysis buffer containing imidazole with the concentration of 20mM to wash the column until the protein is not detected in the effluent; PP_0337 and bound protein were eluted with lysis buffer containing imidazole at 250mM concentration and the eluted protein was collected. The control blank Ni column was similarly loaded with an equal amount of cell lysate and eluted, and the eluted protein was collected.

S3, preparing SDS-PAGE gel, running the protein collected in the step S2, staining with coomassie brilliant blue and observing the result. SDS-PAGE gel preparation, protein sample treatment and gel running methods are common in various molecular cloning experimental guidelines. And (3) observing SDS-PAGE experimental results, comparing proteins flowing out of the Ni ion affinity column of the control group, finding out protein bands which are not in the control group except PP_0337 in the experimental group, cutting out the protein bands, and carrying out mass spectrometry by a large gene company to determine the proteins and the coding genes of the cut-out bands.

S4, constructing an expression vector of the protein to be detected according to a mass spectrum sequencing result, and detecting whether interaction exists between the protein to be detected and the PP_0337 protein according to the method in the embodiment 3.

Example 5 interaction of Membrane protein PP_0337 with CheA protein Using MBP pull Down experiment

In this example, the interaction between the membrane protein pp_0337 and the CheA protein was detected by MBP pull down experiments, and the specific procedure is as follows:

s1, purifying the CheA protein by the method of example 3.

S2, the fusion protein MBP-PP_0337-8 XHis is induced to be expressed according to the method of the example 2; as a control, introduction of plasmid pMAL-c2X into E.coli BL21 induced expression of MBP-tagged protein alone. Two groups of cells were lysed and the proteins were purified using agarose gel columns with dextrin-specific ligands.

After the cell lysate of the experimental group is loaded onto the column, the cell lysate is washed by the lysis buffer until no protein flows out, and only MBP-P_0337-8 XHis fusion protein is remained on the column by default; similarly, control cell lysates were added to the purification column and rinsed with the same buffer until no protein was eluted.

S3, adding the CheA protein purified in the step S1 into two groups of purification columns (an experimental group and a control group) in the step S2, sealing by a cover, and gently reversing and uniformly mixing to uniformly distribute resin matrixes in the purification columns in the whole column; placing the column in an ice box horizontally, placing the ice box on a shaking table to shake slowly, and shaking for 4 hours at 20 r/min; vertically placing the purification column, standing for 10min, and precipitating the resin matrix in the purification column to the bottom of the column; the lid was opened, the protein solution was allowed to flow out, washed with lysis buffer until no protein was eluted, and then eluted with lysis buffer containing 10mM maltose, MBP/MBP-P_0337-8 XHis fusion protein and protein bound thereto were eluted, and the eluted protein was collected.

S4, preparing SDS-PAGE gel, running the protein collected in the step S3, staining with coomassie brilliant blue and observing the result. SDS-PAGE gel preparation, protein sample treatment and gel running methods are common in various molecular cloning experimental guidelines. As a result, as shown in FIG. 9, MBP-P_0337-8 XHis fusion protein and CheA protein were simultaneously detected in the effluent of the purification column of the experimental group, while only MBP protein was present in the effluent of the purification column of the control group, without CheA protein, indicating that the purification column could not bind to CheA protein, and only MBP-P_0337-8 XHis fusion protein was bound to CheA protein, the cheA protein was retained, thus the direct interaction between PP_0337 protein and cheA protein was detected in the effluent.

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, alternatives, and improvements that fall within the spirit and scope of the invention.

Sequence listing

<110> university of agriculture in China

<120> an expression vector and method for detecting interactions of membrane proteins in bacteria

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1275

<212> DNA

<213> (Artificial sequence)

<400> 1

atgaaaatcg aagaaggtaa actggtaatc tggattaacg gcgataaagg ctataacggt 60

ctcgctgaag tcggtaagaa attcgagaaa gataccggaa ttaaagtcac cgttgagcat 120

ccggataaac tggaagagaa attcccacag gttgcggcaa ctggcgatgg ccctgacatt 180

atcttctggg cacacgaccg ctttggtggc tacgctcaat ctggcctgtt ggctgaaatc 240

accccggaca aagcgttcca ggacaagctg tatccgttta cctgggatgc cgtacgttac 300

aacggcaagc tgattgctta cccgatcgct gttgaagcgt tatcgctgat ttataacaaa 360

gatctgctgc cgaacccgcc aaaaacctgg gaagagatcc cggcgctgga taaagaactg 420

aaagcgaaag gtaagagcgc gctgatgttc aacctgcaag aaccgtactt cacctggccg 480

ctgattgctg ctgacggggg ttatgcgttc aagtatgaaa acggcaagta cgacattaaa 540

gacgtgggcg tggataacgc tggcgcgaaa gcgggtctga ccttcctggt tgacctgatt 600

aaaaacaaac acatgaatgc agacaccgat tactccatcg cagaagctgc ctttaataaa 660

ggcgaaacag cgatgaccat caacggcccg tgggcatggt ccaacatcga caccagcaaa 720

gtgaattatg gtgtaacggt actgccgacc ttcaagggtc aaccatccaa accgttcgtt 780

ggcgtgctga gcgcaggtat taacgccgcc agtccgaaca aagagctggc aaaagagttc 840

ctcgaaaact atctgctgac tgatgaaggt ctggaagcgg ttaataaaga caaaccgctg 900

ggtgccgtag cgctgaagtc ttacgaggaa gagttggcga aagatccacg tattgccgcc 960

actatggaaa acgcccagaa aggtgaaatc atgccgaaca tcccgcagat gtccgctttc 1020

tggtatgccg tgcgtactgc ggtgatcaac gccgccagcg gtcgtcagac tgtcgatgaa 1080

gccctgaaag acgcgcagac taattcgagc tcgaacaaca acaacaataa caataacaac 1140

aacctcggga tcgagggaag gatttcactg gtgccgcgcg gcagcgaatt cggatcctct 1200

agagtcgacc tgcagcccgg gggtaccctc gagaagcttc atcatcatca tcatcaccat 1260

cacggcagca gctaa 1275

<210> 2

<211> 73

<212> DNA

<213> (Artificial sequence)

<400> 2

cctcgggatc gagggaagga tttcactggt gccgcgcggc agcgaattcg gatcctctag 60

agtcgacctg cag 73

<210> 3

<211> 115

<212> DNA

<213> (Artificial sequence)

<400> 3

gacgttgtaa aacgacggcc agtgcttagc tgctgccgtg atggtgatga tgatgatgat 60

gaagcttctc gagggtaccc ccgggctgca ggtcgactct agaggatccg aattc 115

<210> 4

<211> 20

<212> DNA

<213> (Artificial sequence)

<400> 4

tcccgcagat gtccgctttc 20

<210> 5

<211> 27

<212> DNA

<213> (Artificial sequence)

<400> 5

cgggatccat gaaaagccaa cccgatg 27

<210> 6

<211> 26

<212> DNA

<213> (Artificial sequence)

<400> 6

ccctcgagac gcggatagcg cttcag 26

<210> 7

<211> 27

<212> DNA

<213> (Artificial sequence)

<400> 7

cgggatccta tgagcttcgg cgccgat 27

<210> 8

<211> 25

<212> DNA

<213> (Artificial sequence)

<400> 8

cgagctccgg cggaagaaac cagaa 25

Claims (8)

1. An expression vector for detecting membrane protein interactions in bacteria, characterized in that: the double-tag fragment is sequentially connected with an MBP coding gene, a thrombin recognition site coding sequence, a multiple cloning site, a His tag coding sequence and a translation termination code, and the nucleotide sequence of the double-tag fragment is shown as SEQ ID NO.1 in a sequence table; the bacteria are pseudomonas putida;

the construction method of the expression vector comprises the following steps:

s1, mixing a forward primer with a nucleotide sequence shown as SEQ ID NO.2 in a sequence table, a reverse primer with a nucleotide sequence shown as SEQ ID NO.3 in the sequence table with a high-fidelity DNA polymerase premix, and carrying out PCR reaction to obtain a PCR product which is a Th-MCS-8 xHis fragment;

s2, carrying out enzyme digestion on the plasmid pMAL-c2X, and recovering to obtain a linearized pMAL-c2X carrier fragment;

s3, simultaneously carrying out enzyme digestion on the Th-MCS-8 xHis fragment and the linearized pMAL-c2X carrier fragment by using T5 exonuclease;

s4, converting the enzyme digestion product obtained in the step S3 into escherichia coli DH5 alpha, extracting plasmids, and carrying out sequencing verification to obtain an expression vector pMAL-Th8H.

2. The expression vector for detecting membrane protein interactions in bacteria of claim 1, wherein in step S1, the PCR reaction procedure is: pre-denaturation at 98℃for 3min; denaturation at 98℃for 15s, annealing at 60℃for 60s, extension at 72℃for 30s, 10 cycles were repeated; extending at 72 ℃ for 60s; and at 20℃for 10s.

3. The expression vector for detecting membrane protein interactions in bacteria of claim 1, wherein: in step S2, the restriction is double restriction with restriction enzymes EcoRI and HindIII.

4. Use of the expression vector of claim 1 for detecting membrane protein interactions in pseudomonas putida.

5. A method for detecting membrane protein interactions in pseudomonas putida comprising the steps of:

sa, constructing an expression vector pMAL-Th8H-X containing a gene X encoding a target protein X by using the expression vector pMAL-Th8H for detecting membrane protein interactions in bacteria according to claim 1;

sb, converting an expression vector pMAL-Th8H-X into escherichia coli BL21, and inducing to express a fusion protein MBP-X-8 xHis;

sc, purifying the fusion protein MBP-X-8 XHis by using an affinity chromatography column;

sd, capturing the protein interacted with the target protein X through an MBP pull down experiment, or capturing the protein interacted with the target protein X through a His pull down experiment after the MBP tag is excised by thrombin;

se, checking whether the protein to be tested interacts with the target protein through SDS-PAGE, and screening the interaction protein of the target protein through mass spectrum sequencing.

6. The method for detecting membrane protein interactions in pseudomonas putida according to claim 5, wherein, in step Sa, the process of constructing the expression vector pMAL-Th8H-x comprises the steps of: amplifying a target gene x by PCR, and introducing double enzyme cutting sites at two ends of the target gene x; and (3) carrying out enzyme digestion and connection on the amplified product and the vector pMAL-Th8H by using the same restriction enzyme, converting the amplified product into escherichia coli DH5 alpha, extracting plasmids, and carrying out sequencing verification to obtain the expression vector pMAL-Th8H-x.

7. The method for detecting membrane protein interactions in pseudomonas putida according to claim 5, wherein, in step Sa, the process of constructing the expression vector pMAL-Th8H-x comprises the steps of: amplifying a target gene x by PCR, and introducing a vector pMAL-Th8H homologous sequence at two ends of the target gene x; simultaneously carrying out enzyme digestion on the amplified product and a vector pMAL-Th8H by using T5 exonuclease; and (3) converting the obtained enzyme digestion product into escherichia coli DH5 alpha, extracting plasmids, and sequencing and verifying to obtain an expression vector pMAL-Th8H-x.

8. The method for detecting membrane protein interactions in pseudomonas putida according to claim 5, wherein: in the step Sc, the affinity chromatography column is a Ni ion affinity chromatography column or an agarose gel column with dextrin specific ligands.

Images