JP2001258577A - Polygalacturonase - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a polygalacturonase that acts on polygalacturonic acid in an exo manner, has an optimal pH around 8, i.e., in an alkaline region, exhibits a protopectinase activity, and is useful as an enzyme used for a detergent for clothes and for treating fibers, and to provide a polygalacturonase gene that permits producing the polygalacturonase as a single product and in a large amount. SOLUTION: A polygalacturonase having a protopectinase activity 30% or more that of the maximal protopectinase at least at a pH from 8 to 11, a microorganism producing the polygalacturonase, a gene encoding the polygalacturonase, a recombination vector containing the gene, a transformant containing the recombination vector, and method for producing the polygalacturonase using these are provided.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to polygalacturonase useful as a detergent, a fiber treatment agent and the like, and a gene encoding the same.

[0002]

2. Description of the Related Art Polygalacturonase, generally called pectinase, is a hydrolase that degrades polygalacturonic acid (pectic acid) and pectin. Such polygalacturonase is
It has been used mainly as an enzyme for the food industry due to its acidic-weak acidity, but has recently been attempted to be used as a detergent enzyme for clothing. 226599, JP-B 6-395
No. 96, WO98 / 06809, etc.).

When polygalacturonase is used in a detergent for clothing, it is necessary that the enzyme acts in an alkaline region and is stable to detergent components such as a surfactant and a chelating agent. In addition, since pectic substance on cotton fiber exists as protopectin, a polygalacturonase having a protopectinase activity that acts on insoluble protopectin to release pectin in an alkaline region is required.

Conventionally, an endo-type polygalacturonase produced by Bacillus sp. Strain P-4-N (JP-B-48-6557) has been reported as an alkali-optimized polygalacturonase. However, such an enzyme is an enzyme having a low chelate resistance requiring calcium ions for the reaction, and is difficult to apply to a detergent. Recently, utilization of pectate lyase having protopectinase activity as a detergent has been considered (Japanese Patent Application Laid-Open No. H11-140489). However, a polygalacturonase that acts in an alkaline region and has protopectinase activity has not been known at all.

An object of the present invention is to provide a polygalacturonase which is stable to detergent components such as a surfactant and a chelating agent, acts in an alkaline region and has protopectinase activity, a gene encoding the same, and a genetic engineering technique. To provide a method for efficiently mass-producing the polygalacturonase.

[0006]

Means for Solving the Problems The present inventors have found that among enzymes produced by microorganisms in soil, they act in an alkaline region and are stable to detergent components such as surfactants and chelating agent-resistant components. A polygalacturonase having protopectinase activity was found, and a gene encoding the polygalacturonase was cloned and a production technique was successfully established by genetic recombination.

That is, the present invention relates to at least pH 8-11.
A polygalacturonase having a protopectinase activity of 30% or more of the maximum protopectinase activity in
And a microorganism that produces the polygalacturonase.

Further, the present invention provides a gene encoding the polygalacturonase, a recombinant vector containing the gene, a transformant containing the recombinant vector, and a method for producing polygalacturonase using the same. Is what you do.

[0009]

BEST MODE FOR CARRYING OUT THE INVENTION The polygalacturonase of the present invention has a protopectinase activity, that is, a protopectin degrading activity at least at pH 8 to 11. The protopectin-degrading activity degrades and solubilizes the polygalacturonic acid portion of protopectin (A type). The protopectinase activity was measured by using a basting thread (substrate) in each of the following buffer solutions: McClubane's buffer (pH 5 to 7), Tris-HCl buffer (pH 7 to 9), and glycine-sodium hydroxide (pH 9 to 11). After placing in a reaction solution containing calcium chloride and polygalacturonase and reacting for a predetermined temperature and time, pectin released in the supernatant was measured by the orcinol-hydrochloric acid method, and the amount of pectin produced was measured. The ratio of the amount of pectin produced at each pH to the amount of pectin produced at the optimum reaction pH, that is, the relative ratio to the maximum protopectinase activity was evaluated.

[0010] Further, it has a polygalacturonase activity, that is, a polygalacturonic acid hydrolysis activity even in an alkaline region. The polygalacturonase activity is exo-type and produces digalacturonic acid. As described above, the polygalacturonase of the present invention acts on both insoluble natural pectin protopectin and polygalacturonic acid, which is a part thereof, in the alkaline region to produce digalacturonic acid. It is effective for removing dirt attached to the protopectin, food spills and stains of foods having a high content of insoluble pectin such as ketchup and jam.

[0011] The polygalacturonase of the present invention is further stable to detergents and chelating agents. For example,
Retains 80% or more activity in a solution containing 0.2% sodium dodecyl sulfate. In a solution containing 2 mM EDTA, 80
% Activity.

The polygalacturonase of the present invention preferably further has the following enzymatic properties. (1) Action: It acts on polygalacturonic acid (pectic acid), pectin and protopectin, and exo-hydrolyzes the α-1,4 bond of polygalacturonic acid to produce digalacturonic acid. (2) Optimal reaction pH: around pH 8 (Tris-HCl buffer) (3) Optimal reaction temperature: about 50 ° C. (Tris-HCl buffer,
(pH 8.0) (4) pH stability: pH 7-11.5 (30 ° C., 30 minutes treatment) (5) Heat resistance: stable up to about 50 ° C. (Tris-HCl buffer, pH 8.0, 30 minutes treatment) (6) Molecular weight: about 105000 (gel filtration method) (7) Isoelectric point: around pH 4.6 (isoelectric focusing)

The polygalacturonase of the present invention is produced, for example, by culturing a polygalacturonase-producing bacterium having protopectinase activity and collecting the bacterium from the culture.

The bacteria producing the polygalacturonase of the present invention include bacteria belonging to the genus Bacillus , for example, KSM-
P358 strain can be mentioned. The KSM-P35
Eight strains have the following mycological properties:

A Morphological properties (a) Cell shape and size: Bacillus (0.6-0.8 × 2.
(B) Polymorphism: no (c) Mobility: yes (d) Spores (size, shape, position, presence or absence of swelling): oval, 0.6-0.8 × 1 0.2 to 1.6 μm, semi-edge, swelling (e) Gram stain: undefined (does not grow on CVT agar medium) (f) Acid-fast: negative (g) Growth on gravy agar medium: white, all Form a colony on the edge

B Physiological Properties (a) Reduction of nitrate: + (b) Denitrification:-(c) MR test:-(d) VP test:-(e) Indole formation:-(f) Hydrogen sulfide Production:-(g) Starch hydrolysis:-(h) Gelatin hydrolysis: + (i) Casein hydrolysis: + (j) Use of citric acid:-(k) Use of inorganic nitrogen:-(l) Urease: + (M) Oxidase: + (n) Catalase: + (o) Litmus milk: no change in color tone is observed (p) Growth temperature range: 18 to 41 ° C (q) Growth pH range: pH 7 to 9 (r) Growth under anaerobic conditions: not growing (s) OF test:-(t) Gas production from glucose:-(u) Resistance to sodium chloride: not growing at 2% (v) Acid production from sugar: No acid formation from the following saccharides was observed. Galactose, xylose, arabinose, sucrose, glucose, mannitol, mannose, inositol, sorbitol, trehalose,
Lactose, glycerin, maltose, fructose,
Raffinose, melibiose, soluble starch

Regarding the morphology and physiological properties of the KSM-P358 strain, see Bergey's Manual of Systematic Bacterio.
As a result of a comparative study in accordance with the description of "B. logy" (Williams & Wilkins, 1984), this strain was considered to be a strain closely related to Bacillus brevis . However, its properties are known Ba
cillus brevis and does not match, because it does not match the properties of other bacteria of the genus Bacillus, the novel bacteria of the genus Bacillus as the present strain to the Agency of Biotechnology Institute Bacillus sp. KSM-P358 (Bacillus sp. KSM -P358 ; FERM
P-17560).

In order to produce the polygalacturonase of the present invention using a polygalacturonase-producing bacterium such as KSM-P358 strain, the strain is placed in a medium containing an assimilable carbon source, nitrogen source and other essential nutrients. Inoculation and shaking culture or aeration and stirring culture may be performed according to a conventional method. The pH of the medium is preferably adjusted to 7-9.

The collection and purification of polygalacturonase from the culture thus obtained can be carried out according to a general method. That is, the cells can be removed from the culture by centrifugation or filtration, and the target enzyme can be concentrated from the obtained culture supernatant by a conventional method. The enzyme solution or the dried powder thus obtained can be used as it is, but can be further crystallized or granulated by a known method.

The polygalacturonase derived from Bacillus sp. KSM-P358 has the following enzymatic properties.

The measurement of polygalacturonase activity was carried out as follows. [Standard enzyme activity measurement method] 0.2 mL of 0.5 M Tris-HCl buffer (pH 8.0) was placed in a test tube, and 0.2 mL of 1% (w /
v) Polygalacturonic acid (ICN Biomedical; l
ot14482, adjusted to pH 6.8 with sodium hydroxide solution), 0.5 mL of deionized water was added, and the temperature was kept at 30 ° C. for 5 minutes. After adding 0.1 mL of appropriately diluted enzyme solution (diluted with deionized water) and reacting for 20 minutes, 1 mL of dinitrosalicylic acid reagent was added, and the color of reducing sugar was developed in boiling water for 5 minutes. went. After quenching in ice water, 4 mL of deionized water was added, and the absorbance at 535 nm was measured to determine the amount of reducing sugar produced. A blank was prepared by adding a dinitrosalicylic acid reagent to a reaction solution treated without adding an enzyme solution, and then adding an enzyme solution to develop a color in the same manner. One unit (1 U) of the enzyme was an amount that produced 1 μmol of reducing sugar corresponding to D-galacturonic acid per minute under the above reaction conditions.

(1) Substrate specificity Instead of polygalacturonic acid, pectins (28, 67, 93%) having different degrees of esterification were used as substrates, and the reaction rate was examined by a standard activity measurement method. Pectin with 28% esterification degree (Sigma; lot74H1092) has about 50
%, Pectin having a degree of esterification of 67% (Sigma; lot 7
4H1093) was degraded at a reaction rate of about 5%, but pectin having a degree of esterification of 93% (Sigma; lot2
5H0123) did not show any decomposition activity under these conditions. Next, a single 30 cm basting thread (gold bell) (about 25 mg) was used as a substrate, and a commercially available detergent solution for clothing [0.067% (w / v)] and an enzyme (0.2 U) were added. The reaction was performed for 1 hour. The reaction solution (2 mL) was centrifuged, and pectin released in the supernatant was measured by the orcinol-hydrochloric acid method. As a result, about 45
μg of pectin release was observed. It acted on protopectin on the surface of cotton fiber and had protopectinase activity belonging to type A.

(2) Decomposition mode of the substrate 0.05 U of the enzyme was added to a reaction solution comprising 50 mM Tris-HCl buffer (pH 7.5), 0.2% polygalacturonic acid and 0.2 mM calcium chloride, and To 0.25 mL. About 10 μL of the solution reacted at 30 ° C. for 30 minutes was spotted on a thin-layer chromatography plate (kiesel gel 60: Merck), and n-butanol: acetic acid: water = 5: 2: 3 (v /
The development was performed in the solvent system of v). Anisaldehyde-sulfuric acid solution was used for the detection of the reactants.
Color was developed in a dryer at 00 ° C. for 10 minutes. As a result, only digalacturonic acid was detected as a reaction product, and the enzyme was an exo-type polygalacturonase. Also,
2 g of basting thread, 0.067% commercial clothing detergent, 10 mM
2 U of the enzyme was added to a reaction solution composed of glycine-sodium hydroxide buffer (pH 10.5) to make the total volume 20 mL.
The reaction was performed at 30 ° C. for 1 to 8 hours. As a result of performing sampling over time and performing thin-layer chromatography by the above method, monogalacturonic acid and digalacturon were detected 1 hour after the reaction. From this, it also acted on protopectin in exo form.

(3) Optimum reaction pH of polygalacturonase activity pH of McClubane's buffer (pH 5-7), Tris-HCl buffer (pH 7-9), glycine-sodium hydroxide buffer (pH 9-11) As a result of examining the optimum reaction pH using each buffer (100 mM), this enzyme showed the highest reaction rate in Tris-HCl buffer at pH 8.0 and a maximum activity of 50 to 50 in the pH 5 to 9 range. % Or more (FIG. 1).

(4) Optimum reaction of protopeticinase activity
Using a 30 cm basting thread (Kinuzuri) (25 mg) as a pH substrate, McClubane's buffer solution (pH 5-7), Tris-
Each buffer (50 mM) of hydrochloric acid buffer (pH 7 to 9) and glycine-sodium hydroxide buffer (pH 9 to 11), 0.4 mM
Polygalacturonase (0.2 U) was added to a reaction solution (2 mL) containing the above calcium chloride, reacted at 30 ° C. for 1 hour, and pectin released in the supernatant was measured by the orcinol hydrochloric acid method. As a result, this enzyme showed the highest reaction rate in Tris-HCl buffer at pH 8.0. Also, pH
A wide range of 5 to 11 showed 30% or more of the maximum activity (FIG. 2).

(5) Optimum reaction temperature: 10 ° C. in 100 mM Tris-HCl buffer (pH 8.0)
As a result of performing an enzyme reaction at each temperature of 80 ° C. and examining the optimum reaction temperature, this enzyme showed an optimum reaction temperature near 50 ° C.
The activity was 50% or more of the maximum activity in the range of 0 ° C to 60 ° C. When 1 mM calcium chloride was added to the reaction system, the optimum reaction temperature shifted to around 55 ° C. and the reaction rate on the high temperature side was increased. That is, the activity was 50% or more of the maximum activity in the range of 40 ° C to 70 ° C (Fig. 3).

(6) Stable pH range McClubane's buffer (pH 2 to 8), glycine-sodium hydroxide buffer (pH 7 to 11.5), potassium chloride-sodium hydroxide buffer (pH 10 to 12.5) The enzyme was added to each of the above buffer solutions (50 mM), incubated at 30 ° C. for 30 minutes, and the remaining activity was measured. As a result, the enzyme was found to have a residual activity in a glycine-sodium hydroxide buffer solution (pH 9.5). Is 100%, the pH is 80% in the range of 7 to 11.5.
The above residual activity was shown (FIG. 4). The addition of 1 mM calcium chloride in each treatment did not affect the stability of the enzyme.

(7) Heat resistance The enzyme was added to a 50 mM Tris-HCl buffer (pH 8.0), and the remaining activity was measured after being kept at a temperature of 5 ° C. to 80 ° C. for 30 minutes. The enzyme has 50
It was very stable up to 60 ° C. and rapidly deactivated above 60 ° C. (FIG. 5). The addition of 1 mM calcium chloride at each temperature did not affect the stability of the enzyme.

(8) Molecular weight a. Gel filtration method: 20 mM containing 100 mM sodium chloride
The enzyme was loaded on a Toyopearl HW55 column (1.5 × 65 cm) equilibrated with a Tris-HCl buffer (pH 7.0) and eluted at a flow rate of about 36 mL / h. Catalase (232000), aldolase (15
8000), bovine serum albumin (67,000), and ovalbumin (43000), a calibration curve was prepared from the respective eluate amounts and molecular weights, and the molecular weight of the enzyme was estimated to be about 105,000. b. SDS-polyacrylamide electrophoresis: The enzymatically active fraction eluted by gel filtration was concentrated and subjected to SDS-electrophoresis using 7.5% acrylamide gel. Using myosin (200000), β-galactosidase (116200), phosphorylase (97400), and bovine serum albumin (67000) as standard proteins, a calibration curve was prepared from the respective mobilities and molecular weights, and the molecular weight of the enzyme was determined. , About 103,000.

(9) Isoelectric point PAG-Plate (Pharmacia; pH 3.5 to 9.
Isoelectric focusing of this enzyme was performed using 5). After immersing the electrophoresed gel in a 10 mM phosphate buffer (pH 7.0), an agar plate containing polygalacturonic acid [1.0%
Polygalacturonic acid, 0.1% potassium monohydrogen phosphate,
1.0% sodium chloride, 50 mM Tris-HCl buffer (pH 7.5), 1.0% agar]. 37 ° C, 3
After incubating for 1 hour, the gel was removed and a 1% cetyltrimethylammonium bromide solution was poured. The isoelectric point of the present enzyme is around pH 4.6 according to the protein mobility of the portion where the lysis spot with activity occurs after about 10 minutes, the isoelectric point of the standard protein (Bio-Rad), and the calibration curve obtained from the mobility. Met.

(10) Amino terminal sequence After SDS-electrophoresis of the present enzyme, the protein was blotted onto an immobron membrane (Millipore) and stained with Coomassie brilliant blue solution. Molecular weight 103000
After cutting out and cutting out the nearby protein band, the amino terminal sequence was determined using a protein sequencer (type 476A: Applied Biosystems). As a result, the ninth amino terminal sequence of this enzyme is Lys
-Ser-Glu-Gly- (Pro or Ser
or Ala) -Pro-Asn-Ala-Pro.

(11) Influence of Various Compounds The effect of various compounds on the activity of the present enzyme was examined by adding each compound to the reaction system at a predetermined concentration and measuring the activity. The inhibition was about 60% with p-chloromercury benzoic acid (0.5 mM) and about 35% with citric acid (5 mM). For EDTA (2, 5 mM), about 2
0%, 75% inhibition, and EGTA (5 mM) inhibited about 65%, respectively, but did not completely inactivate but showed chelator resistance (Table 1).

[0033]

[Table 1]

(12) Influence of surfactant As a result of examining the reactivity of the enzyme in a reaction system in which various surfactants were added to a concentration of 0.2% (w / v), a high concentration of surfactant The enzyme expressed 80% or more of the activity as compared with the control in the presence of (Table 2).

[0035]

[Table 2]

(13) Influence of metal salts As a result of adding 1 mM of various metal salts to the standard reaction system and examining the effect on enzyme activity, this enzyme was found to be calcium chloride, magnesium chloride, manganese chloride, ferrous chloride, Ferric activated to 116-135% of the control. On the other hand, it was inhibited by zinc chloride and copper chloride at about 95% and 85%, respectively. It was then inhibited by about 70% and 60% by nickel chloride and cobalt chloride (Table 3).

[0037]

[Table 3]

The polygalacturonase-producing bacteria described above, a microorganism belonging to the genus Bacillus For example <br/> example, preferably Bacillus s
p. From the KSM-P358 strain (FERM P-17560) or the like, it is possible to clone a gene encoding the polygalacturonase of the present invention by, for example, a method of cloning a target gene by a shotgun method, a PCR method, or the like. it can.

The polygalacturonase gene of the present invention comprises
For example, those encoding an amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence in which one or several amino acids of the amino acid sequence are deleted, substituted or added are preferable. Here, deletion, substitution or addition (hereinafter sometimes referred to as mutation) of an amino acid in the amino acid sequence does not limit the number and site of the mutated amino acid as long as polygalacturonase activity is not lost. Absent. Further, at the N-terminal in the amino acid sequence of SEQ ID NO: 1, one to several amino acids may be added or deleted.

Amino acids 1 to 953 shown in SEQ ID NO: 1
Among the enzymes, Erwinia chrysant is an exo-type polygalacturonase.
hemi PehX (He and Collmer, J. Bacteriol., 172, 4988
4995, 1990), Ralstonia Solanacearum PehB (Huahg and
Allen, J. Bacteriol., 179, 7369-7378, 1997) and 29.1% and 28.5% homology, respectively. Polygalacturonase consisting of the amino acid shown in SEQ ID NO: 1 An enzyme having a novel sequence that has not been reported before.

The polygalacturonase gene of the present invention preferably encodes the amino acid sequence of SEQ ID NO: 1 or a variant thereof as described above. Alternatively, those having a base sequence in which several bases are deleted, substituted or added are preferable.

To prepare a recombinant vector containing a polygalacturonase gene, the polygalacturonase gene may be incorporated into any vector suitable for expressing the gene in the intended host. Such vectors include:
When E. coli is used as a host, pUC18, pUC19, pUC18
BR322 and the like. When Bacillus subtilis is used as a host, p.
UB110 and the like.

Transformation of a host with the thus obtained recombinant vector is carried out by a conventional method, for example, the protoplast method, the competent cell method, the electroporation method and the like. Preferably microorganisms as the host, Baci
Gram-positive bacteria such as genus llus (Bacillus subtilis) and Streptomyces (actinomycetes); Gram-negative bacteria such as Escherichia coli (Escherichia coli); genus Saccharomyces (yeast), genus Aspergillus (mold)
And the like.

By culturing the obtained transformant and collecting polygalacturonase from the culture, polygalacturonase can be obtained. The cultivation may be performed by inoculating a medium containing a carbon source, a nitrogen source and other essential nutrients that can be used by microorganisms, and conducting the culture according to a conventional method. From the thus obtained culture solution, polygalacturonase can be obtained by a method according to generally known methods for collecting and purifying enzymes.

[0045]

EXAMPLES Example 1 Screening of polygalacturonase-producing bacteria Soil in various parts of Japan was suspended in sterilized water at 80 ° C and 20 ° C.
After heat treatment for a minute, the composition was applied to an agar plate medium having the following composition. Three
The culture was allowed to stand still in a 0 ° C. incubator for 3 to 5 days, and after growth of the bacteria, the mixture was cooled in a refrigerator. Those in which lysed spots due to the degradation of pectin were detected around the grown bacteria were selected, single colonies were repeated, and the ability to produce polygalacturonic acid-degrading enzyme was tested. Many strains thus obtained mainly produced pectate lyase, among which Bacillus sp.KSM-P35 was produced as a polygalacturonase-producing bacterium.
Eight shares were obtained.

[0046]

[Table 4]

[0047] Example 2 Bacillus sp. KSM-P358 strain Bacillus obtained by polygalacturonase production aforementioned screening sp. KSM
The culture of -P358 strain was performed aerobically for 2 days at 30 ° C. by adding 50 mL of medium to a 500 mL Sakaguchi flask. The medium composition was as follows: 0.5% (w / v) pectin, 1.5% polypeptone S, 0.5% yeast extract, 1.0% fish meat extract, 0.
1% potassium dihydrogen phosphate, 0.02% magnesium sulfate heptahydrate, 50 mM Tris-HCl buffer (pH 8.6, sterilized separately). The polygalacturonase activity produced in the culture was measured by adding 2 mM EDTA to completely inactivate the pectate lyase activity. By this measuring method, a production amount of 200 to 400 U / L per culture solution was obtained.

Example 3 Purification of Polygalacturonase The culture of Bacillus sp. KSM-P358 was centrifuged (800
0 × g, 15 minutes, 4 ° C.) to obtain a supernatant (2 L). This is put into a dialysis membrane and polyethylene glycol 20000
(Wako Pure Chemical Industries) was sprinkled to concentrate the internal solution. Further, concentration and desalting were performed using an ultrafiltration module (AIP1010: Asahi Kasei). The resulting concentrate (100 mL) is 1 mM
The column was applied to a DEAE Toyopearl 650M column (3 × 15 cm: Tosoh) equilibrated with a 20 mM Tris-HCl buffer (pH 7.0) containing dithiothreitol. The unadsorbed protein was washed and eluted with about 500 mL of the equilibration buffer, and then the adsorbed protein was eluted by a concentration gradient elution method using a buffer solution (each 500 mL) containing 0 to 0.2 M sodium chloride. . The polygalacturonase activity was eluted near the sodium chloride concentration of about 0.1M. Next, the same purification operation was performed using a DEAE Toyopearl 650M column to obtain a polygalacturonase fraction containing no pectate lyase activity (100 mL). The active fraction was concentrated by ultrafiltration (YM10 membrane: Amicon), and a 20 mM Tris-HCl buffer (pH 7.0) containing 0.1 M sodium chloride and 1 mM dithiothreitol was used.
Toyopearl HW55 column (1.
5 × 65 cm: Tosoh). The polygalacturonase active fraction eluted with the same buffer was collected (10 mL, 4 mL).
2U, 14 mg protein). The polygalacturonase fraction obtained by the above purification procedure exhibited the above-mentioned enzymatic properties.

[0049] In Example 4 Bacillus sp. KSM-P358 strain for preparation of chromosomal DNA Bacillus sp. KSM-P358 strain polypeptone S (Nippon Seiyaku) liquid medium mainly composed, overnight shaking culture at 30 ° C., Seed culture was performed. This seed culture was inoculated into a similar medium, and cultured with shaking for about 8 hours to obtain a main culture. Saito and Miura method (Biochim. Biophys. Acta, 72, 619-629, 1963) from cells recovered from the main culture by centrifugation
Prepared a chromosomal DNA.

[0050] Example 5 Bacillus sp. KSM-P358 polygalacturonase partial amino acid sequence 1) Determination of the N-terminal amino acid sequence Bacillus sp. Enzyme purified by various chromatography from a culture of KSM-P358 strain protein sequencer 476A (manufactured by PE Applied Biosystems), and the N-terminal amino acid sequence was determined to have 9 residues. The resulting sequence is Lys-Ser-Glu-Gly- (Pro or Ser or Ala) -Pro-Asn-
Ala-Pro.

2) Determination of Intermediate Amino Acid Sequence by Lysyl Endopeptidase Decomposition The purified enzyme was subjected to SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis).
Lysyl endopeptidase (manufactured by Wako Pure Chemical Industries, Ltd.) in a weight ratio of about 1/1000 was added to the enzyme recovered from the polyacrylamide gel of 25% in a 60 mM Tris-HCl buffer (pH 9). The temperature was kept at 15 ° C. for 15 hours. UL
After subjecting the sample collected by TRAFREE MC spin column (0.45 μm PVDF membrane, manufactured by Millipore) to SDS-PAGE, PVDF was performed using Milliblot type I (manufactured by Millipore).
The membrane was electroproduced and the transferred PVDF membrane was stained with Coomassie brilliant blue. P after staining
Cut out the stained protein band from the VDF membrane,
The sample was supplied to a protein sequencer 476A. The amino acid sequence (intermediate amino acid sequence A) obtained from the lysyl endopeptidase partially degraded product is Asn-Ile-Leu-Phe-Arg-Asn-Asn-A
la-Leu-Glu-Gly.

3) Determination of Intermediate Amino Acid Sequence by Degradation of V8 Protease
Boiled for 10 minutes at a temperature of about 1/60 by weight
Of V8 protease (manufactured by Boehringer Mannheim) at 110 ° C. in 110 mM Tris-HCl buffer (pH 8.5).
For 15 hours. The recovered sample was subjected to SDS-PAGE
And excise the protein band from the PVDF membrane after electroplating.
476A. The amino acid sequence (intermediate amino acid sequence B) obtained from the V8 protease partial degradation product was Phe-Glu- (Thr
or Asn or Arg) -Ala-Arg-Pro-Tyr- (Gly or Pro)-(Alao
r Ile) -Gly-Ala-Pro.

Example 6 Cloning of P358 polygalacturonase gene From the N-terminal amino acid sequence of the purified enzyme, a primer using the mixed base shown in SEQ ID NO: 3 was prepared. Similarly, based on the intermediate amino acid sequence A obtained from the lysyl endopeptidase partial degradation product, the primers shown in SEQ ID NOs: 4 and 5 and the primers shown in SEQ ID NO: 6 from the amino acid sequence B of the V8 protease partial degradation product Was prepared. Bacillus sp. K prepared in Example 4 using these primers
PCR was performed using the chromosomal DNA of the SM-P358 strain as a template. In the combination of the primers of SEQ ID Nos. 3 and 4 and the combination of the primers of SEQ ID Nos. 5 and 6, about 1.3 kb
The amplified fragments of p and 1.1 kbp were obtained, and as a result of the nucleotide sequence analysis, the deduced amino acid sequence matched each amino acid sequence.
It turned out to be part of the P358 polygalacturonase gene. Primers shown in SEQ ID NOs: 7 and 8 were prepared based on the base sequences of these PCR amplified fragments, and these primers and chromosomal DNA were cut with a restriction enzyme Eco RI and then self-closured with T4 DNA Ligase. The mold DN
As A, inverse PCR was performed. The nucleotide sequence of the thus-obtained amplified fragment of about 3.0 kbp was analyzed, and primers shown in SEQ ID NOS: 9 and 10 were prepared from the determined nucleotide sequence. These primers were combined with the chromosomal DNA of Bacillus sp. Is performed as a template, and the total length is about 4.5 kb.
The p358 polygalacturonase gene fragment of p was obtained.

Example 7 Determination of base sequence of P358 polygalacturonase gene Using 0.5 to 1 μg of the PCR amplified fragment prepared in Example 6 as a template, BigDye Terminator Cycle Sequencing Kit (P
A sequence analysis sample was prepared using E Applied Biosystems Co., Ltd., and the base sequence of the P358 polygalacturonase gene was determined with a 377 DNA sequencer (PE Applied Biosystems Co., Ltd.) (SEQ ID NO: 1).
3). As a result, P358 polygalacturonase had 29 nucleotides as shown at base numbers 540 to 3479 in SEQ ID NO: 13.
The enzyme was found to be encoded by a nucleotide sequence of 40 residues and composed of 980 amino acid residues. Furthermore, in the amino acid sequence, an N-terminal amino acid sequence determined from the purified enzyme and an intermediate amino acid sequence determined from the protease partial degradation product were confirmed. The molecular weight of polygalacturonase consisting of 953 amino acids from the N-terminal amino acid sequence to the stop codon (TAA) was estimated to be 103,810 Da.

Example 8 P358 polygalacturonase
Preparation of expression plasmid P358 polygalacturonase inheritance determined in Example 7
Based on the nucleotide sequence of the
A primer was prepared and prepared in Example 4.Bacillus s
p. Perform PCR using chromosomal DNA of KSM-P358 strain as template
And DNA encoding P358 polygalacturonase
The fragment was amplified. At this time, the primer to be used
Multi-color of Smid Vector pHY300PLK (Yakult)
Can be efficiently cloned into
So that the restriction enzymeSalI,XbaI recognition sequence added
I let you. Plasmid vectors pHY300PLK and P358 polygala
Restriction enzyme for PCR amplified fragment of cutronase geneSalI,
XbaAfter digestion with I, GFX PCR DNA and Gel Band Purif
Purification using ication Kit (Pharmacia)
Was. The purified sample was mixed at a weight ratio of 1: 1.
Then, the sample was ligated with T4 DNA Ligase.
Using,E.coli HB101 competent cell (Takara Shuzo)
Was transformed. From among the obtained transformants
Select an arbitrary transformant, and select a transformant from the selected transformant.
Prepare a rasmid and insert this plasmid into the restriction enzyme.Sal
I,XbaDigested with I. PCR by agarose electrophoresis
The plasmid in which insertion of the amplified fragment was confirmed was called pHYK358PEC.
(FIG. 6).

Example 9 Production of Polygalacturonase by Bacillus subtilis Transformant Using pHYK358PEC Using a plasmid pHYK358PEC, a protoplast method (Chang
and Choen. Mol. Gen. Genet., 168, 111-115, 1978)
Was used to transform Bacillus subtilis ISW1214 strain (Yakult). 15 μg / mL of the obtained transformant
Inoculated in LB medium containing tetracycline at 30 ° C
And shake culture was performed overnight to obtain seed culture. This seed culture solution was inoculated at a concentration of 1% (v / v) into 40 mL of a main culture medium containing polypeptone S, corn steep liquor, and maltose as main components, and cultured with shaking at 30 ° C. and 120 rpm for 4 days. . The production of recombinant polygalacturonase is
It was about 1000-3000 U / L under these culture conditions.

Example 10 Characteristics of Recombinant Polygalacturonase The culture supernatant obtained in Example 9 was adsorbed on an anion exchange resin, purified by elution with a sodium chloride concentration gradient, and purified. As a result of examining the properties of the recombinase, the properties were in good agreement with those of wild-type P358 polygalacturonase, as shown below.

1) Optimum reaction pH Instead of the standard enzyme activity measurement method, the optimum reaction pH was determined by using 50 mM Tris-HCl buffer (pH 7 to 9.5) and 50 mM glycillin-sodium hydroxide buffer (pH 9 to 11). Where
This enzyme showed the highest reaction rate in Tris-HCl buffer (pH 8.0).

2) Molecular Weight The molecular weight was determined by SDS-PAGE (12.5% acrylamide gel) using a standard protein for electrophoresis (manufactured by Bio-Rad). As a result, the molecular weight of the present enzyme was estimated to be about 105 kDa. .

3) Protopectinase activity One 30 cm disciplined thread (marked with gold bell) (25 mg) was used as a substrate.
A 50 mM glycine-sodium hydroxide buffer (pH 10) containing 4 mM calcium chloride was used as an enzyme reaction solution, and 0.2%
U enzyme (polygalacturonase activity) was added to make the final solution volume 2.0 mL. After performing the reaction at 30 ° C. for 1 hour, the pectin released in the supernatant was measured by the orcinol-hydrochloric acid method. As a result, it was confirmed that about 40 μg of pectin was released per 0.2 U of polygalacturonase under the above conditions.

[0061]

Industrial Applicability The polygalacturonase of the present invention acts on polygalacturonic acid exoally, but the optimal reaction pH
It is useful as a detergent enzyme for clothing and an enzyme for fiber treatment because it has a pH of around 8, maintains its activity even in an alkaline region, and exhibits protopectinase activity.
Further, by using the polygalacturonase gene of the present invention, the polygalacturonase can be produced singly and in large quantities.

[0062]

[Sequence List] SEQUENCE LISTING <110> KAO CORPOLATION <120> Polygalacturonase <130> P03261207 <150> JP P2000-006926 <151> 2000-01-14 <160> 13 <170> PatentIn Ver. 2.1 <210> 1 <211> 953 <212> PRT <213> Bacillus sp.KSM-P358 <400> 1 Lys Ser Glu Gly Ser Pro Asn Ala Pro Ser Ser Pro Val Asn Leu Gln 1 5 10 15 Ile Pro Gly Leu Ala Phe Asp Asp Asp Ser Ile Thr Leu Val Trp Glu 20 25 30 Lys Pro Lys His Tyr Asn Asp Ile Val Asp Phe Asn Ile Tyr Met Asn 35 40 45 Lys Lys Lys Ile Gly Ser Ala Leu Glu Asp Asn Ser Gly Pro Ala Lys 50 55 60 Ala Tyr Ile Asp Asn Phe Tyr Glu Asn Ile Asp Lys Asp Asn Phe His 65 70 75 80 Glu Lys Ile Leu Ile His Asn Phe Lys Ala Asn Asn Leu Lys Pro Asn 85 90 95 Lys Ser Tyr Glu Phe Tyr Val Thr Ser Val Asn Ala Glu Gly Thr Glu 100 105 110 Ser Ala Pro Ser Asn Lys Ile Val Gly Lys Thr Thr Lys Val Pro Glu 115 120 125 Ile Phe Asn Ile Val Asp Tyr Gly Ala Ile Pro Asp Asp Asp Ser Lys 130 135 140 Asp Thr Glu Ala Ile Gln Ala Ala Ile Asp Ala Ala Thr Pro Gly Ser 145 150 155 160 Lys Val Leu Ile Pro Asp Gly Lys Phe Ile Thr Gly Glu Leu Trp Leu 165 170 175 Lys Ser Asp Met Thr Leu Gln Val Asp Gly Tyr Leu Leu Gly Ser Pro 180 185 190 Asp Ala Glu Asp Tyr Ser Thr Asn Phe Trp Leu Tyr Asp Tyr Ser Thr 195 200 205 Asp Glu Arg Ser Tyr Ser Leu Ile Asn Ala His Thr Tyr Asp Tyr Gly 210 215 220 Ser Leu Lys Asn Ile Arg Ile Val Gly Thr Gly Ile Ile Asp Gly Asn 225 230 235 240 Gly Trp Lys Tyr Asp Lys Asn His Pro Thr Arg Asp Glu Leu Gly Asn 245 250 255 Glu Leu Pro Arg Tyr Val Ala Gly Asn Asn Ser Lys Val Thr Gly Asn 260 265 270 Val Lys Val Glu Asn Gly Lys Met Ser Pro Leu Asp Leu Asn Ser Glu 275 280 285 Asn Thr Leu Gly Ile Leu Ala Ala Asn Gln Ser Tyr Ala Ala Gln Glu 290 295 300 Met Gly Met Asp Ala Lys Ser Ala Tyr Ala Ala Arg Ser Asn Leu Ile 305 310 315 320 Thr Val Arg Gly Val Asp Gly Met Tyr Tyr Glu Gly Ile Thr Gln Leu 325 330 335 Asn Pro Ala Asn His Gly Ile Val Asn Leu His Ser Lys Asn Ile Val 340 345 350 Ile Asn Gly Thr Ile Ser Lys Thr Tyr Asp Gly Asn Asn Ala Asp Gly 355 360 365 Tyr Glu Phe Gly Asp Ser Gln Asn Ile Met Val Phe Asn Asn Phe Val 370 375 380 Asp Thr Gly Asp Asp Ala Ile Asn Phe Ala Ser Gly Met Gly Gln Ala 385 390 395 400 Ala Ala Lys Ser Glu Pro Thr Gly Asn Ala Trp Ile Phe Asn Asn Tyr 405 410 415 Ile Arg Glu Gly His Gly Gly Val Val Thr Gly Ser His Thr Gly Gly 420 425 430 Trp Ile Gln Asp Phe Leu Val Glu Asp Asn Ile Met Tyr Lys Thr Asp 435 440 445 Val Gly Leu Arg Ser Lys Thr Asn Thr Pro Met Gly Gly Gly Ala Lys 450 455 460 Asn Ile Leu Phe Arg Asn Asn Ala Leu Glu Gly Ile Asp Gly Asp Gly 465 470 475 480 480 Pro Phe Val Phe Thr Ser Ala Tyr Thr Asp Ala Asn Ala Ala Ile Gln 485 490 490 495 Tyr Glu Pro Ala Glu Val Ile Ser Gln Phe Arg Asp Met Glu Ile Val 500 505 510 Asp Thr Thr Val Arg Asn Gln Gly Gly Ser Asn Lys Gln Ala Ile Leu 515 520 525 Val Asn Gly Asn Asn Ser Ala Gly Glu Val Tyr His Glu Asn Ile Thr 530 535 540 Phe Lys Asn Val Lys Phe Asp Asn Val Tyr Ser Val Asn Met Asp Tyr 545 550 555 560 Ala Lys Asp Phe Lys Phe Ile Asn Val Ser Phe Thr Asn Val Lys Asp 565 570 575 Asn Gly Gly Asn Pro Trp Arg Ile Lys Asn Ser Thr Gly Phe Val Phe 580 585 590 Glu Asn Thr Thr Thr Ala Pro Ile Asp Ala Thr Gln Lys Pro Glu Trp 595 600 605 Ala Glu Asp Thr Ile Ile Asn Ala Gly Ser Ser Pro Asp Gly Lys Asn 610 615 620 Val Thr Leu Thr Trp Ser Glu Ala Thr Asp Asn Val Gly Val Ser Gly 625 630 635 640 Tyr Thr Ile Tyr Lys Asp Arg Glu Lys Leu Gly Gln Asp Tyr Thr Thr 645 650 655 655 Thr Asn Leu Thr Ser Phe Thr Val Asp Gly Leu Ala Pro Ala Thr Glu 660 665 670 Tyr Thr Phe Lys Val Glu Ala Thr Asp Ala Thr Gly Asn Arg Thr Ser 675 680 685 Asn Gly Pro Glu Ile Lys Val Met Thr Asn Gly Glu Ala Asp Gln Thr 690 695 700 Ala Pro Val Leu Pro Lys Asn Thr Lys Ile Ser Glu Ser Thr Thr Lys 705 710 715 720 Ile Pro Ser Ser Asp Thr Phe Ser Gly Lys Asn Val Asn Val Val Tyr 725 730 735 Thr Gly Phe Thr Trp Thr Ser Ile Thr Trp Asp Ala Ala Ser Asp Asp 740 745 750 Thr Gly Ile Ala Gly Tyr Asn Val Tyr Ala Asn Gly Glu Leu Asn Gly 755 760 765 Phe Ala Thr Ser Asn Lys Tyr Thr Leu Thr Arg Leu Glu Pro Gly Thr 770 775 780 780 Lys Tyr Asn Ile Glu Val Glu Ala Val Asp Ile Ala Gly Asn Thr Ala 785 790 790 795 800 Pro Tyr Asn Ser Val Leu Glu Phe Glu Thr Ala Arg Pro Tyr Pro Ile 805 810 815 Gly Ala Pro Ser Phe Asp Gly Gly Leu Asp Ala Lys Ile Asn Ser Asp 820 825 830 Gly Thr Ser Val Thr Leu Ser Trp Asn Ala Ala Lys Ala Leu Asn Gln 835 840 845 Asp Val Ile Gly Tyr Arg Val Tyr Val Asn Gly Gln Pro Met Lys Ser 850 855 860 Glu Gly Ala Pro Phe Thr Pro Ile Asn Ser Glu Met Thr Thr Ser Asp 865 870 875 880 Thr Asn Tyr Thr Val Thr Gly Leu Lys Gln Gly Lys Arg Tyr Thr Phe 885 890 895 Lys Val Glu Ala Val Gly His Ala Ser Lys Tyr Ser Lys Arg Glu Arg 900 905 910 Leu Ser Asp Val Leu Pro Asn Gly Leu Leu Glu Val Ser Gly Tyr Arg 915 920 925 Trp Ser Gly Phe Gly Pro Ser Val Asp Val His Leu Ile Pro Gly Lys 930 935 940 Ala Lys Ser Glu Gln Ala Lys Ser Lys 945 950

<210> 2 <211> 2862 <212> DNA <213> Bacillus sp. aagcgtatat cgataatttc tatgaaaata tcgataagga taatttccat 240 gaaaagattc ttatccataa ttttaaggct aacaatctaa aaccaaataa atcctacgaa 300 ttttatgtaa catctgtgaa tgctgaaggg acggaatcgg caccttccaa taaaattgta 360 ggaaaaacaa caaaggtacc agagattttt aatattgtag attatggggc aataccagat 420 gatgatagta aggatacaga agccattcaa gcagccattg atgctgcaac acctggttca 480 aaggtgttaa taccagatgg aaaatttatc accggagaat tatggcttaa atcagatatg 540 actttacaag tggatggata tttacttggc tcaccggatg ctgaagacta cagtaccaat 600 ttctggctat atgattattc tacagatgaa cgttcttatt cactcatcaa tgcacataca 660 tacgattacg gcagtttgaa aaacattcgt atcgtgggca ctggtatcat tgatgggaat 720 gggtggaaat atgataagaa tcatcctacc agagatgaac ttgggaatga attaccacgt 780 tacgt ctg gcaacaattc aaaagtaact ggaaatgtaa aggtcgaaaa cggaaagatg 840 agcccactag atcttaattc tgaaaataca ttgggaatct tagcagcaaa tcaatcatat 900 gccgcacaag aaatgggcat ggacgcgaag tccgcttatg cagctcgttc caatctgatt 960 accgttcgtg gcgtagatgg aatgtattac gaaggaatta cccagcttaa tcctgcaaat 1020 cacgggattg taaaccttca tagtaagaac attgtaataa atggcaccat ttccaaaacg 1080 tatgatggca ataatgcaga tggatacgag tttggtgatt ctcaaaatat aatggtattt 1140 aataactttg ttgatacagg cgatgatgct attaatttcg cgtcaggaat gggacaagca 1200 gcagcaaaga gtgagccaac aggaaatgct tggattttca ataactatat tcgtgagggt 1260 catggcgggg ttgttaccgg tagtcataca ggtggctgga tccaggactt tttagtagaa 1320 gacaatatca tgtataaaac agatgtaggt ttacgcagta agacaaatac cccaatgggt 1380 ggtggggcaa aaaatatcct tttcagaaac aatgcattgg agggtattga cggagacggc 1440 ccatttgtct tcacttccgc ttatacagat gcaaatgctg caatccaata tgaaccagca 1500 gaggtcatct ctcaatttag agatatggag attgttgata caaccgttcg aaatcaaggt 1560 ggaagtaaca agcaagcgat tcttgtaaat ggtaataata gcgctggcga agtatatcac 1620 gaaaatatta ctttc aaaaa cgttaaattt gataatgtct attccgtaaa tatggattat 1680 gcaaaggact tcaaatttat taatgtatct tttacaaacg ttaaagataa tggcggaaac 1740 ccatggagaa taaaaaattc tacgggattt gtgtttgaaa atacaacaac agcaccaatt 1800 gatgctacac aaaaaccaga atgggcagaa gatacaatta ttaatgccgg gtcatcacct 1860 gatggaaaaa acgttacttt aacatggagt gaagcgactg ataatgttgg tgtctcgggt 1920 tacacaatct acaaagatcg tgaaaaactt ggtcaagatt atacaactac aaacctcaca 1980 agttttactg tggatggact ggcaccagct acagaataca catttaaagt ggaagcaact 2040 gatgcaacag gaaatcgtac ttcgaatggg ccagaaatta aggtaatgac aaatggtgaa 2100 gctgatcaaa cagcacctgt tctcccaaag aatacaaaga tttcagaatc aacaactaaa 2160 attcctagca gtgatacttt tagtggaaag aatgtcaacg tggtgtatac tgggtttact 2220 tggacttcta ttacttggga tgctgctagt gatgacacgg gaattgctgg ttataacgtt 2280 tatgcaaatg gtgagttaaa tggatttgca acatccaata aatacacctt aacacgacta 2340 gagcctggca caaaatataa tattgaagtc gaagcagttg acattgcagg taatacggca 2400 ccttataata gtgtactaga atttgaaaca gccagacctt acccaatcgg cgcgccttcc 2460 tttgatggtg gtttagatgc aaaaattaat tcagatggaa ctagcgtaac tctatcatgg 2520 aacgctgcaa aggcactaaa tcaagatgta atcggatacc gcgtatatgt gaatggtcaa 2580 cctatgaagt ctgaaggagc tccatttaca cctattaatt cagaaatgac tacatctgat 2640 acaaactata ctgtaacagg attaaaacaa ggaaaacgat atacatttaa agtagaagca 2700 gtcggtcatg caagtaaata ctctaagaga gaaagactct cagatgtact tccaaatggt 2760 cttcttgagg tctcaggata tagatggagt ggatttggac caagtgtcga tgttcatcta 2820 attcctggta aagcaaaaag tgaacaagca aaatcaaagt aa 2862

<210> 3 <211> 26 <212> DNA <213> Artificial Sequence <400> 3 aardnsgarg gnnsnccnaa ygcncc 26

<210> 4 <211> 32 <212> DNA <213> Artificial Sequence <400> 4 cctycnarng crttrttnck raanardatr tt 32

<210> 5 <211> 32 <212> DNA <213> Artificial Sequence <400> 5 aayathytnt tymgnaayaa ygcnytngar gg 32

<210> 6 <211> 26 <212> DNA <213> Artificial Sequence <400> 6 nrynssrtan ggnckngcnk ytckaa 26

<210> 7 <211> 24 <212> DNA <213> Artificial Sequence <400> 7 ttatcgatat acgcttttgc tggc 24

<210> 8 <211> 24 <212> DNA <213> Artificial Sequence <400> 8 acaccttaac acgactagag cctg 24

<210> 9 <211> 28 <212> DNA <213> Artificial Sequence <400> 9 cgacattata atacacgggt tacacagc 28

<210> 10 <211> 29 <212> DNA <213> Artificial Sequence <400> 10 agaaaaggtt tgtattcaag tcataatgg 29

<210> 11 <211> 36 <212> DNA <213> Artificial Sequence <400> 11 gttctaggaa agcatgtcga catcagagcc tcatgc 36

<210> 12 <211> 34 <212> DNA <213> Artificial Sequence <400> 12 cagctctaga aagacgatac gagttaatta gtac 34

<210> 13 <211> 3813 <212> DNA <213> Bacillus sp. KSM-P358 <220><221> CDS <222> (540) .. (3479) <220><221> mat_peptide <222> (621) .. (3479) <220><221> sig_peptide <222> (540) .. (620) <400> 13 gatgttattc agatataaca 180 cctatattag agaaaaataa tttatttccc aaaagattgt agaaagatac aaagagtttg 240 gtaaaagtga ttagaccaag cttttttgtc tatggtaatc atttcatctg gagataatca 300 caagttcaca aaggactttt tgattaggta aatagaacta taattatcga aatattcaat 360 aaagtgattg tatacgtttc caatagaagc ggttaacata gattggaaat atcagatttt 420 cttaaaaata tgaaccttta tatcgcggtg tctctgcgcc aaaaaaggtt tatataaaat 480 ttaaatagaa aggagaaagt ttagtagatt ttcaaaaaac aataaggtgg ttgaagcat 539 ttg aaa agt ctt aaa gtt aat gga gtt tta ttt tta att tta cta tta 587 Met Lys Ser Leu Lys Val Asn Gly Val Leu Phe Leu Ile Leu Leu Leu -25 -20 -15 gtt ttt agt agc ttt agc gga gca gtt tat gca aag tcg gaa gga tcg 635 Val Phe Ser Ser Phe Ser Gly Ala Val Tyr Ala Lys Ser Glu Gly Ser -10 -5 -1 15 ccc aat gca cct tca tca cct gtt aat tta cag att cca ggc ctt gct 683 Pro Asn Ala Pro Ser Ser Pro Val Asn Leu Gln Ile Pro Gly Leu Ala 10 15 20 ttt gat gac gac agc att act ctt gtt tgg gaa aaa cca aag cat tat 731 Phe Asp Asp Asp Ser Ile Thr Leu Val Trp Glu Lys Pro Lys His Tyr 25 30 35 aat gac atc gtt gat ttt aac atc tat atg aat aag aag aaa att gga 779 Asn Asp Ile Val Asp Phe Asn Ile Tyr Met Asn Lys Lys Lys Ile Gly 40 45 50 agc gct ttg gaa gac aat agt ggg cca gca aaa gcg tat atc gat aat 827 Ser Ala Leu Glu Asp Asn Ser Gly Pro Ala Lys Ala Tyr Ile Asp Asn 55 60 65 ttc tat gaa aat atc gat aag gat aat ttc cat gaa aag att ctt atc 875 Phe Tyr Glu Asn Ile Asp Lys Asp Asn Phe His Glu Lys Ile Leu Ile 70 75 80 85 cat aat ttt aag gct aac aat cta aaa cca aat aaa tcc tac gaa ttt 923 His Asn Phe Lys Ala Asn Asn Leu Lys Pro Asn Lys Ser Tyr Glu Phe 90 95 100 tat gta aca tct gtg aat gct gaa ggg acg gaa tcg gca cct tcc aat 971 Tyr Val Thr Ser Val Asn Ala Glu Gly Thr Glu Ser Ala Pro Ser Asn 105 110 115 aaa att gta gga aaa aca aca aag gta cca gag att ttt aat att gta 1019 Lys Ile Val Gly Lys Thr Thr Lys Val Pro Glu Ile Phe Asn Ile Val 120 125 130 gat tat ggg gca ata cca gat gat gat agt aag gat aca gaa gcc att 1067 Asp Tyr Gly Ala Ile Pro Asp Asp Asp Ser Lys Asp Thr Glu Ala Ile 135 140 145 caa gca gcc att gat gct gca aca cct ggt tca aag gtg tta ata cca 1115 Gln Ala Ala Ile Asp Ala Ala Thr Pro Gly Ser Lys Val Leu Ile Pro 150 155 160 165 gat gga aaa ttt atc acc gga gaa tta tgg ctt aaa tca gat atg act 1163 Asp Gly Lys Phe Ile Thr Gly Glu Leu Trp Leu Lys Ser Asp Met Thr 170 175 180 tta caa gtg gat gga tat tta ctt ggc tca ccg gat gct gaa gac tac 1211 Leu Gln Val Asp Gly Tyr Leu Leu Gly Ser Pro Asp Ala Glu Asp Tyr 185 190 195 agt acc aat ttc tgg cta tat gat tat tct aca gat gaa cgt tct tat 1259 Ser Thr Asn Phe Trp Leu Tyr Asp Tyr Ser Thr Asp Glu Arg Ser Tyr 200 205 210 tca c tc atc aat gca cat aca tac gat tac ggc agt ttg aaa aac att 1307 Ser Leu Ile Asn Ala His Thr Tyr Asp Tyr Gly Ser Leu Lys Asn Ile 215 220 225 cgt atc gtg ggc act ggt atc att gat ggg aat ggg tgg aaatat gat 1355 Arg Ile Val Gly Thr Gly Ile Ile Asp Gly Asn Gly Trp Lys Tyr Asp 230 235 240 245 aag aat cat cct acc aga gat gaa ctt ggg aat gaa tta cca cgt tac 1403 Lys Asn His Pro Thr Arg Asp Glu Leu Gly Asn Glu Leu Pro Arg Tyr 250 255 260 gtt gct ggc aac aat tca aaa gta act gga aat gta aag gtc gaa aac 1451 Val Ala Gly Asn Asn Ser Lys Val Thr Gly Asn Val Lys Val Glu Asn 265 270 275 gga aag atg agc cca cta gat ctt aat tct gaa aat aca ttg gga atc 1499 Gly Lys Met Ser Pro Leu Asp Leu Asn Ser Glu Asn Thr Leu Gly Ile 280 285 290 tta gca gca aat caa tca tat gcc gca caa gaa atg ggc atg gac gcla A47A Leu Asn Gln Ser Tyr Ala Ala Gln Glu Met Gly Met Asp Ala 295 300 305 aag tcc gct tat gca gct cgt tcc aat ctg att acc gtt cgt ggc gta 1595 Lys Ser Ala Tyr Ala Ala Arg Ser Asn Leu Ile Thr Val Arg Gly Va l 310 315 320 325 gat gga atg tat tac gaa gga att acc cag ctt aat cct gca aat cac 1643 Asp Gly Met Tyr Tyr Glu Gly Ile Thr Gln Leu Asn Pro Ala Asn His 330 335 340 ggg att gta aac ctt cat agt aag aac att gta ata aat ggc acc att 1691 Gly Ile Val Asn Leu His Ser Lys Asn Ile Val Ile Asn Gly Thr Ile 345 350 355 tcc aaa acg tat gat ggc aat aat gca gat gga tac gag ttt ggt gat 1739 Ser Lys Thr Tyr Asp Gly Asn Asn Ala Asp Gly Tyr Glu Phe Gly Asp 360 365 370 tct caa aat ata atg gta ttt aat aac ttt gtt gat aca ggc gat gat 1787 Ser Gln Asn Ile Met Val Phe Asn Asn Phe Val Asp Thr Gly Asp Asp 375 380 385 gct att aat ttc gcg tca gga atg gga caa gca gca gca aag agt gag 1835 Ala Ile Asn Phe Ala Ser Gly Met Gly Gln Ala Ala Ala Lys Ser Glu 390 395 395 400 405 cca aca gga aat gct tgg att ttc aat aac gat attgt ggt cat 1883 Pro Thr Gly Asn Ala Trp Ile Phe Asn Asn Tyr Ile Arg Glu Gly His 410 415 420 ggc ggg gtt gtt acc ggt agt cat aca ggt ggc tgg atc cag gac ttt 1931 Gly Gly Val Val Thr Gly Ser His Thr Gly Gly Trp Ile Gln Asp Phe 425 430 435 tta gta gaa gac aat atc atg tat aaa aca gat gta ggt tta cgc agt 1979 Leu Val Glu Asp Asn Ile Met Tyr Lys Thr Asp Val Gly Leu Arg Ser 440 445 450 aag aca aat acc cca atg ggt ggt ggg gca aaa aat atc ctt ttc aga 2027 Lys Thr Asn Thr Pro Met Gly Gly Gly Ala Lys Asn Ile Leu Phe Arg 455 460 465 aac aat gca ttg gag ggt att gac gga gac ggc cca ttt gtc Ascn act 2075 Ala Leu Glu Gly Ile Asp Gly Asp Gly Pro Phe Val Phe Thr 470 475 480 485 tcc gct tat aca gat gca aat gct gca atc caa tat gaa cca gca gag 2123 Ser Ala Tyr Thr Asp Ala Asn Ala Ala Ile Gln Tyr Glu Pro Ala Glu 490 495 500 gtc atc tct caa ttt aga gat atg gag att gtt gat aca acc gtt cga 2171 Val Ile Ser Gln Phe Arg Asp Met Glu Ile Val Asp Thr Thr Val Arg 505 510 515 aat caa ggt gga agt aac aag caa gcg att ctt gta aat ggt aat aat 2219 Asn Gln Gly Gly Ser Asn Lys Gln Ala Ile Leu Val Asn Gly Asn Asn 520 525 530 agc gct ggc gaa gta tat cac gaa aat att act ttc aaa aac gtt aaa 2267 Ser Ala Gly Glu Val Tyr His Glu Asn Ile Thr Phe Lys Asn Val Lys 535 540 545 ttt gat aat gtc tat tcc gta aat atg gat tat gca aag gac ttc aaa 2315 Phe Asp Asn Val Tyr Ser Val Asn Met Asp Tyr Ala Lys Asp Phe Lys 550 555 560 565 ttt att aat gta tct ttt aca aac gtt aaa gat aat ggc gga aac cca 2363 Phe Ile Asn Val Ser Phe Thr Asn Val Lys Asp Asn Gly Gly Asn Pro 570 575 580 tgg aga ata aaa aat tct acg gga ttt gtg ttt gaa aca aca aca 2411 Trp Arg Ile Lys Asn Ser Thr Gly Phe Val Phe Glu Asn Thr Thr Thr 585 590 595 gca cca att gat gct aca caa aaa cca gaa tgg gca gaa gat aca att 2459 Ala Pro Ile Asp Ala Thr Gln Lys Pro Glu Trp Ala Glu Asp Thr Ile 600 605 610 att aat gcc ggg tca tca cct gat gga aaa aac gtt act tta aca tgg 2507 Ile Asn Ala Gly Ser Ser Pro Asp Gly Lys Asn Val Thr Leu Thr Trp 615 620 625 agt gaa gcg act gat aat gtt ggt gtc tcg ggt tac aca atc tac aaa 2555 Ser Glu Ala Thr Asp Asn Val Gly Val Ser Gly Tyr Thr Ile Tyr Lys 630 635 640 645 gat cgt gaa aaa ctt ggt caa gat tat aca act aca aac ctc aca agt 26 03 Asp Arg Glu Lys Leu Gly Gln Asp Tyr Thr Thr Thr Asn Leu Thr Ser 650 655 660 ttt act gtg gat gga ctg gca cca gct aca gaa tac aca ttt aaa gtg 2651 Phe Thr Val Asp Gly Leu Ala Pro Ala Thr Glu Tyr Thr Phe Lys Val 665 670 675 gaa gca act gat gca aca gga aat cgt act tcg aat ggg cca gaa att 2699 Glu Ala Thr Asp Ala Thr Gly Asn Arg Thr Ser Asn Gly Pro Glu Ile 680 685 690 aag gta atg aca aat ggt gaa gct gat caa aca gca cct gtt ctc cca 2747 Lys Val Met Thr Asn Gly Glu Ala Asp Gln Thr Ala Pro Val Leu Pro 695 700 705 aag aat aca aag att tca gaa tca aca act aaa att cct agc agt gat 2795 Lys Asn Thr Lys Ile Ser Glu Ser Thr Thr Lys Ile Pro Ser Ser Asp 710 715 720 725 act ttt agt gga aag aat gtc aac gtg gtg tat act ggg ttt act tgg 2843 Thr Phe Ser Gly Lys Asn Val Asn Val Val Tyr Thr Gly Phe Thr Trp 730 735 740 act tct att act tgg gat gct gct agt gat gac acg gga att gct ggt 2891 Thr Ser Ile Thr Trp Asp Ala Ala Ser Asp Asp Thr Gly Ile Ala Gly 745 750 755 tat aac gtt tat gca aat ggt gag tta aat gga ttt gca aca tcc aat 2939 Tyr Asn Val Tyr Ala Asn Gly Glu Leu Asn Gly Phe Ala Thr Ser Asn 760 765 770 aaa tac acc tta aca cga cta gag cct ggc aca aaa tat aat att gaa 2987 Lys Tyr Thr Leu Thr Arg Leu Glu Pro Gly Thr Lys Tyr Asn Ile Glu 775 780 785 gtc gaa gca gtt gac att gca ggt aat acg gca cct tat aat agt gta 3035 Val Glu Ala Val Asp Ile Ala Gly Asn Thr Ala Pro Tyr Asn Ser Val 790 795 800 805 cta gaa ttt gaa aca gcc aga cct tac cca atc ggc gcg cct tcc ttt 3083 Leu Glu Plu Glu Thr Ala Arg Pro Tyr Pro Ile Gly Ala Pro Ser Phe 810 815 820 gat ggt ggt tta gat gca aaa att aat tca gat gga act agc gta act 3131 Asp Gly Gly Leu Asp Ala Lys Ile Asn Ser Asp Gly Thr Ser Val Thr 825 830 835 cta tca tgg aac gct gca aag gca cta aat caa gat gta atc gga tac 3179 Leu Ser Trp Asn Ala Ala Lys Ala Leu Asn Gln Asp Val Ile Gly Tyr 840 845 850 cgc gta tat gtg aat ggt caa cct atg aag tct gaa gga gct cca ttt 3227 Arg Val Tyr Val Asn Gly Gln Pro Met Lys Ser Glu Gly Ala Pro Phe 855 860 865 aca cct att aat tca gaa atg act aca tct gat aca aac tat act gta 3275 Thr Pro Ile Asn Ser Glu Met Thr Thr Ser Asp Thr Asn Tyr Thr Val 870 875 880 885 aca gga tta aaa aaa gga aaa cga tat aca ttt aaa gta gaa gca gtc 3323 Thr Gly Leu Lys Gln Gly Lys Arg Tyr Thr Phe Lys Val Glu Ala Val 890 895 900 ggt cat gca agt aaa tac tct aag aga gaa aga ctc tca gat gta ctt 3371 Gly His Ala Ser Lys Tyr Ser Lys Arg Glu Arg Leu Ser Asp Val Leu 905 910 915 cca aat ggt ctt ctt gag gtc tca gga tat aga tgg agt gga ttt gga 3419 Pro Asn Gly Leu Leu Glu Val Ser Gly Tyr Arg Trp Ser Gly Phe Gly 920 925 930 cca agt gtc gat gtt cat cta att cct ggt gca gca aaa agt gaa caa 3467 Pro Ser Val Asp Val His Leu Ile Pro Gly Lys Ala Lys Ser Glu Gln 935 940 945 gca aaa tca aag taaagatatg tgtgaattaa ttgagtgtga ttttcatctt 3519 Ala Lys Ser Lys 950 ttttatattg atcactgatatctattattattatcatgact aatgaatacc 3639 attgaaaaga taaggagggg atttttttgt taatttgcag gctagtagga ttatgaacaa 3699 g tatcttatg aatctgttgc gaggatctcg taaatgccca attaaaatta ggcgatgcaa 3759 tcaggcacaa tacccaatta tcgtacataa tttgttgagg aaagtctttg aaat 3813

[Brief description of the drawings]

FIG. 1. Effect of pH on polygalacturonase activity of the present invention
FIG.

FIG. 2 is a graph showing the effect of pH on protopectinase activity of the present invention.

FIG. 3 is a graph showing the effect of temperature on polygalacturonase activity of the present invention.

FIG. 4. Effect of polygalacturonase stability of the present invention
It is a figure which shows the influence of pH.

FIG. 5 is a graph showing the effect of temperature on the stability of polygalacturonase of the present invention.

FIG. 6: Polygalacturonase gene ( Bacillus sp. KSM
-P358 strain) into a plasmid vector (pHY300PLK) and constructed polygalacturonase expression secretion vector pH
It is a figure which shows YK358PEC.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 9/26 (C12N 1/21 // (C12N 15/09 ZNA C12R 1: 125) C12R 1:07) (C12N 9/26 (C12N 1/21 C12R 1: 125) C12R 1: 125) C12N 15/00 ZNAA (C12N 9/26 5/00 A C12R 1: 125) C12R 1:07) (72) Inventor Tanijima Noriyuki 2606 Kabane-cho, Akaga-cho, Haga-gun, Tochigi Pref. In Kao Co., Ltd. (72) Inventor Norihiko Higaki 2606 Kabashi-cho, Kaiga-cho, Haga-gun, Tochigi Pref. In Kao Co., Ltd. (72) Inventor Yoko Kaito Akabane, Kaiga-cho, Haga-gun, Tochigi 2606 Inside Kao Corporation Research Institute (72) Inventor Toru Kobayashi 2606 Kao Corporation Kaiga-cho Akabane, Haga-gun Tochigi Prefecture Inside (72) Inventor Shuji Kawai Red-shelled Kaimachi-cho, Haga-gun Tochigi Prefecture Feather 2606 Kao Corporation Research Laboratory F-term (reference) 4B024 AA03 AA05 BA12 CA04 DA06 DA07 EA04 FA17 GA11 HA03 4B050 CC01 CC03 DD02 FF04E FF05E FF11E FF12E LL02 LL04 4B065 AA15Y AA19X AA26CA13 BA15 CA02

Claims (11)

[Claims] 1. A polygalacturonase having a protopectinase activity of at least 30% of the maximum protopectinase activity at pH 8 to 11. 2. The polygalacturonase according to claim 1, which has a protopectinase activity of 30% or more of the maximum protopectinase activity at pH 5 to 11. 3. When polygalacturonic acid is used as a substrate,
The polygalacturonase according to claim 1 or 2, which produces digalacturonic acid. 4. The composition according to claim 1, which has the following enzymatic properties:
Polygalacturonase according to any one of the above. (1) Action: It acts on polygalacturonic acid (pectic acid), pectin and protopectin, and exo-hydrolyzes the α-1,4 bond of polygalacturonic acid to produce digalacturonic acid. (2) Optimal reaction pH: around pH 8 (Tris-HCl buffer) (3) Optimal reaction temperature: about 50 ° C. (Tris-HCl buffer,
(pH 8.0) (4) pH stability: pH 7-11.5 (30 ° C., 30 minutes treatment) (5) Heat resistance: stable up to about 50 ° C. (Tris-HCl buffer, pH 8.0, 30 minutes treatment) (6) Molecular weight: about 105000 (gel filtration method) (7) Isoelectric point: around pH 4.6 (isoelectric focusing) 5. A Bacillus sp. KS which produces the polygalacturonase according to any one of claims 1 to 4.
M-P358 ( Bacillus sp. KSM-P358; FERM P-1756
0). 6. A gene encoding the polygalacturonase according to any one of claims 1 to 4. 7. The gene according to claim 6, which encodes the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence in which one or several amino acids of the amino acid sequence are deleted, substituted or added. 8. The gene according to claim 6, which has the nucleotide sequence shown in SEQ ID NO: 2 or a nucleotide sequence in which one or several bases of the base sequence are deleted, substituted or added. 9. A recombinant vector containing the gene according to any one of claims 6 to 8. 10. A transformant comprising the recombinant vector according to claim 9. 11. A method for producing polygalacturonase, which comprises culturing the transformant according to claim 10.