JP2011200133A - Method for producing genetically modified microorganism - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for producing a genetically modified microorganism more efficiently and for wider use.SOLUTION: In a method for producing a genetically modified microorganism including the use of a transformation method using a conjugative transfer from a donor microorganism to a recipient microorganism, the method uses a plasmid for genetic modification including: a base sequence region deficient in a target gene and its flanking base sequence in the recipient microorganism; a conjugative transfer initiation region functioning in the donor microorganism; a replication initiation region; a resistance gene to a chemical to which the recipient microorganism is sensitive; and a conditional lethal gene to the recipient microorganism.

Description

  The present invention relates to a method for genetically modifying a microorganism by using a transformation method utilizing conjugative transfer from a donor microorganism to a recipient microorganism. Specifically, by using the above-described transformation method using conjugative transmission, for example, a target gene in the genome is deleted or inactivated, or another gene is introduced into the gene, and thus genetically modified. The present invention relates to a method for producing microorganisms.

  Rhodococcus bacteria are known as industrially useful microbial catalysts because of their physical strength, organic solvent resistance, redox ability, ability to accumulate large amounts of enzymes, etc. in cells. For example, Rhodococcus bacteria are used for the production of amides or acids by enzymatic hydration or hydrolysis of nitriles (Patent Documents 1 and 2). In addition, it is also known as a high-resolution microbial species for persistent compounds (Patent Documents 3 to 6). By utilizing its ability, application studies for various useful substance production and environmental purification have been promoted. Yes. For example, production of useful substances from petroleum by desulfurization or bioremediation when oil spills into the environment can be mentioned.

  In addition, attempts have been made to modify Rhodococcus bacteria to more useful ones by genetic recombination methods (Patent Documents 7 to 9). For example, in order to efficiently promote genetic manipulation of Rhodococcus bacteria, development of host-vector systems has been promoted. Searching for new plasmids (Patent Documents 10 to 12) and development of vectors (Patent Documents 13 to 19) Non-Patent Document 1) and the like have been performed.

  In this way, the usefulness of Rhodococcus bacteria becomes clear, and in addition to the development of conventional genetic recombination techniques, the development of a technique for modifying Rhodococcus bacteria itself as a host to have the desired characteristics according to the purpose of use Has been expected.

JP-A-2-470 JP-A-3-251192 European Patent No. 188316 European Patent No. 204555 European Patent No. 348901 European Patent Application No. 307926 Japanese Unexamined Patent Publication No. 4-21379 JP-A-6-25296 JP-A-6-303791 Japanese Patent Laid-Open No. 4-148685 JP-A-4-330287 Japanese Unexamined Patent Publication No. 7-255484 Japanese Patent Laid-Open No. 5-64589 JP-A-8-56669 U.S. Pat.No. 4,920,054 JP-A-8-173169 Japanese Patent Laid-Open No. 10-248578 JP 2006-180843 A JP 2006-50967 Gazette

Journal of Bacteriology, vol. 170, p. 638-645 (1988)

  In order to utilize Rhodococcus bacteria more effectively, it is effective to modify or redesign metabolic pathways by modifying the genome of Rhodococcus bacteria in addition to conventional useful protein expression by genetic recombination. The modification of the Rhodococcus genus genome includes a state in which the function of the gene inherent in the Rhodococcus genus genome is not expressed (loss of function) and the function of the gene not originally provided in the Rhodococcus genus genome. There are two types of preparation (function addition). The loss of function includes specifically deleting or inactivating a target gene on the genome of Rhodococcus bacteria. In addition, in order to impart a function, a gene that does not originally exist on the genome (for example, a gene derived from another species) is introduced into the genome.

  Examples of a technique for deleting or inactivating a gene present on the genome include a method using homologous recombination. This can be achieved by inserting a drug resistance marker gene or the like between target genes by homologous recombination so that they do not function (inactivation), or replacing them with a sequence that does not contain part or all of the target gene. In this method, the target gene itself is deleted and the expression itself is stopped.

  As a method of introducing other genes that do not originally exist on the genome, as in the case of the above deletion or inactivation, a method of introducing the target gene into the target position on the genome using homologous recombination, or non-homologous And a method of introducing into a random position on the genome using recombination. In the case of introduction by homologous recombination, the actual contents are the reverse of the above deletion, and the target gene is introduced by substituting the region that originally does not contain the gene with the sequence that contains the gene to be introduced and its regulatory region. Is the method. In the case of random introduction, a transposable element such as a transposon that functions in the host is used, but there is a problem that the introduction position on the genome cannot be controlled.

  In addition, when a gene is deleted by the above method, the loss of the gene function and the addition of a new function (derived from the replaced gene) are obtained by using a sequence in which the target gene is replaced with the sequence of another gene. Can be performed simultaneously.

  Since some homologous recombination techniques have been established in some microorganisms such as E. coli and yeast, the target gene can be deleted or inactivated or other genes can be introduced relatively easily.

  An electroporation method or the like is known as a gene introduction method for homologous recombination in Rhodococcus bacteria. The electroporation method is a typical transformation method in Rhodococcus bacteria, but when applied to homologous recombination, Rhodococcus bacteria and its related bacteria have the characteristic that non-homologous recombination is likely to occur. Therefore, there is a problem that the target homologous recombination strain can be obtained only with a very low probability. Other gene introduction methods for homologous recombination include a method using conjugation transfer (conjugate transfer method), but this method is hardly applied to Rhodococcus bacteria. Therefore, in Rhodococcus bacteria, there is no established method for efficiently or universally deleting or inactivating a target gene or introducing another gene.

  Under such circumstances, development of a technique for deleting or inactivating a target gene or introducing another gene more efficiently and universally to microorganisms such as Rhodococcus bacteria, and thus more efficient. Development of a method for producing microorganisms such as Rhodococcus bacteria that have been genetically modified genetically and universally has been desired.

  The present invention has been made in consideration of the above situation, and provides the following method for producing a genetically modified microorganism.

That is, the present invention is as follows.
(1) A method for producing a genetically modified microorganism comprising using a transformation method utilizing conjugative transfer from a donor microorganism to a recipient microorganism, comprising the following steps (a) to (d): Said method comprising.

(A) a step of producing a microorganism having enhanced resistance to a drug to which the donor microorganism to be used for conjugation transmission is sensitive as a recipient microorganism;
(B) As a donor microorganism, (i) a base sequence region containing a target gene in a recipient microorganism and its surrounding base sequence (i-1) a base sequence region in which the target gene is deleted, (i- 2) a base sequence region in which the target gene is inactivated, (i-3) a base sequence region in which the gene is replaced with another gene, or (i-4) another gene and its regulation within the region A base sequence region into which a sequence containing the region is inserted; (ii) a conjugation initiation region that functions in the donor microorganism; (iii) a replication initiation region that functions in the donor microorganism; and (iv) a drug to which the recipient microorganism is sensitive. Producing a microorganism transformed with a plasmid for genetic modification comprising a resistance gene and (v) a conditionally lethal gene for the recipient microorganism;
(C) a step of producing a transformant of the recipient microorganism by performing conjugative transfer from the donor microorganism produced in (b) to the recipient microorganism produced in (a); and (d ) A step of culturing the transformant produced in (c) under a culture condition in which the conditionally lethal gene can function.

In the production method of the present invention, for example, Escherichia coli can be used as the donor microorganism, and Rhodococcus bacteria can be used as the recipient microorganism. Here, examples of the genus Rhodococcus include Rhodococcus rhodochrous and Rhodococcus erythropolis.
(2) A genetically modified microorganism obtained by the production method described in (1) above.
(3) A method for producing a protein, comprising culturing the microorganism according to (2) above as a host and collecting a target protein from the obtained culture.

  According to the present invention, a target gene can be deleted or inactivated, or other genes can be introduced into a microorganism, particularly a microorganism such as Rhodococcus bacteria, more efficiently and universally. In addition, a method for producing a genetically modified microorganism can be provided. Specifically, the present invention relates to industrially useful microorganisms such as Rhodococcus bacteria, and the alteration or redesign of metabolic pathways by deletion or inactivation of target genes, introduction of other genes, etc. In terms of facilitating efficient production of substances using microorganisms as a host, it can be said to be extremely excellent industrially.

BRIEF DESCRIPTION OF THE DRAWINGS It is the schematic shown about the homologous recombination etc. which occur on the said bacterial genome in each process at the time of deleting the kanamycin resistance gene of Rhodococcus genus bacteria by the manufacturing method of this invention. It is a figure which shows the gene map of plasmid pKM043 for gene modification. (A) It is a figure which shows the result of having succeeded in isolating kanamycin sensitivity strain | stump | stock Rh (DELTA) Km-01. (B) It is a figure which shows the result of having confirmed that the area | region corresponding to kanamycin resistance gene length about 0.5 kb is deleted from the genome in Rh (DELTA) Km-01 strain | stump | stock. (A) It is a figure which shows the result of having succeeded in isolating kanamycin sensitivity strain | stump | stock Rh (DELTA) Km-10. (B) It is a figure which shows the result of having confirmed that the kanamycin resistance gene has been deleted from the genome of RhΔKm-10.

  Hereinafter, the present invention will be described in detail. The scope of the present invention is not limited to these descriptions, and other than the following examples, the scope of the present invention can be appropriately changed and implemented without departing from the spirit of the present invention.

It should be noted that all publications cited in the present specification, for example, prior art documents, publications, patent publications and other patent documents are incorporated herein by reference.

1. Outline of the present invention When a target gene is deleted or inactivated, or another gene is introduced, a gene-modifying plasmid is introduced into the gene on the genome by homologous recombination (hereinafter referred to as homologous recombination strain). ) Is the most important step. In the electroporation method, it is introduced into the target bacterium in the form of double-stranded DNA, but in the conjugation transfer method, a model that is introduced in the state of single-stranded DNA has been proposed and incorporated into the genome of the target bacterium. The mechanisms that are used may differ between the two. When introduction was carried out by electroporation, it was inserted outside the target gene with high efficiency (non-homologous recombination occurred).

  When genetic recombination is performed, it is considered that the higher the ability of the selection marker, the easier the optimization of the selection conditions and the easier the target recombinant strain can be obtained. Therefore, to obtain a homologous recombination strain efficiently, a high-performance selection marker may be prepared. When deleting or inactivating a target gene using the conjugation transfer method, or introducing another gene, a recombinant strain (donor microorganism) of the donor microorganism and a recipient microorganism (recipient microorganism) Since both growth with non-recombinant strains must be inhibited, two types of selection markers (drug resistance markers) are required. In the present specification, the recipient microorganism refers to a target microorganism to be genetically modified as referred to in the present invention.

  Examples of the plasmid used for the conjugation transfer method include plasmid pK19mob (Gene 145, 69-73 (1994)). pK19mob is available from distribution agencies such as the National BioResource Project (NBRP). Since this plasmid has a kanamycin resistance gene as a selection marker, kanamycin can inhibit the growth of non-recombinant strains of recipient microorganisms. In addition, in order to inhibit the growth of the donor microorganism, the recipient microorganism needs to have a selection marker that acts strongly on the donor microorganism but hardly affects the growth of the recipient microorganism. However, the recipient microorganism does not necessarily have such a strong selection marker. For example, if the recipient microorganism is Rhodococcus, Rhodococcus is known to be resistant to some drugs, but its resistance is weak and is not sufficient as a marker for conjugation transmission .

Therefore, the present inventor has previously prepared a mutant strain of a microorganism that exhibits sufficient resistance to a high concentration of drug, and uses the mutant strain as a recipient. It was found that recombination becomes possible. The present invention has been completed based on such findings.

2. Method for Producing Genetically Modified Microorganism The method for producing a genetically modified microorganism according to the present invention (hereinafter referred to as “the production method of the present invention”), as described above, from a donor microorganism to a recipient microorganism. A method for producing a genetically modified recipient microorganism comprising using a transformation method utilizing conjugation transfer, comprising the following steps (a) to (d).

(A) a step of producing a microorganism having enhanced resistance to a drug to which the donor microorganism to be used for conjugation transmission is sensitive as a recipient microorganism;
(B) As a donor microorganism, the following (i) to (v):
(i) In the base sequence region containing the target gene in the recipient microorganism and the surrounding base sequence (i-1) The base sequence region from which the target gene has been deleted, (i-2) An activated nucleotide sequence region, (i-3) a nucleotide sequence region in which the gene is replaced with another gene, or (i-4) a sequence containing another gene and its regulatory region is inserted into the region. Base sequence region,
(ii) a junction transmission initiation region that functions in the donor microorganism;
(iii) a replication initiation region that functions in the donor microorganism,
(iv) a resistance gene to a drug to which the recipient microorganism is sensitive; and
(v) producing a transformed microorganism using a gene-modifying plasmid containing a conditional lethal gene for the recipient microorganism;
(C) A step of producing a transformant of the recipient microorganism by performing conjugation transfer from the donor microorganism produced in the step (b) to the recipient microorganism produced in the step (a). And (d) culturing the transformed microorganism of the recipient microorganism produced in the step (c) under culture conditions in which the conditional lethal gene can function.

2.1. Process (a)
In the step (a), a microorganism having enhanced resistance to a drug to which a donor microorganism used for conjugation transmission is sensitive is produced as a recipient microorganism used for conjugation transmission.

  In the production method of the present invention, a recipient microorganism, that is, a microorganism to be genetically modified as referred to in the present invention is not limited, and examples thereof include Rhodococcus bacteria, Bacillus bacteria, Pseudocardia bacteria, and Geobacillus. Preferably, genus bacteria, Pseudomonas bacteria, Gordonia bacteria, Corynebacterium bacteria, Nocardia bacteria, Mycobacterium bacteria, etc., among them Rhodococcus bacteria have a strong cell wall and contain proteins, etc. It is more preferable in that it is suitable for use as a microbial catalyst because the contents of the microbial cells do not leak.

  Here, examples of the genus Rhodococcus include, for example, Rhodococcus rhodochrous J1, M8 (SU1731814), M33 (VKM Ac-1515D), ATCC 184, ATCC 999, ATCC 4001, ATCC 4273, ATCC 4276, ATCC 9356. , ATCC 12483, ATCC 12674, ATCC 13808, ATCC 14341, ATCC 14347, ATCC 14350, ATCC 15905, ATCC 15998, ATCC 17041, ATCC 17043, ATCC 17895, ATCC 19067, ATCC 19149, ATCC 19150, ATCC 21243, ATCC 21291, ATCC 21785, ATCC 21924, ATCC 21999, ATCC 29670, ATCC 29672, ATCC 29675, ATCC 33258, ATCC 33275, ATCC 39484, IFO 3338, IFO 14894, JCM 3202, NCIMB 11215, NCIMB 11216, Rhodococcus erythropolis PR4 (NBRC 100887), NBRC 12320, NBRC 15567, NBRC 16296, IFM 155, DSM 743, DSM 9675, DSM 43200, JCM 6821, JCM 6822, JCM 6823, JCM 6824, JCM 6827, DSM 11397, DSM 44522, JCM 2895, JCM 2893, JCM 2894, IAM 1400, IAM 1503, Rhodococcus opacus pacus) B4 and the like.

  Examples of bacteria belonging to the genus Bacillus include, for example, Bacillus smithii, Bacillus subtilis, Bacillus brevis, Bacillus amyloliquefaciens, Bacillus licheniformis (Bacillus licheniformis). Etc. are preferable.

  Preferred examples of the genus Pseudocardia include Pseudonocardia thermophila, Pseudonocardia autotrophica, and the like.

  Preferred examples of the genus Geobacillus include Geobacillus thermoglucosidasius, Geobacillus kaustophilus, Geobacillus thermoleovorans, and the like.

  Preferred examples of Pseudomonas bacteria include Pseudomonas putida, Pseudomonas chlororaphis, Pseudomonas marginalis, and the like.

Preferred examples of the genus Gordonia include Gordonia terrae.
Preferred examples of the genus Corynebacterium include Corynebacterium glutamicum, Corynebacterium efficiens, and the like.

  Preferred examples of Nocardia bacteria include Nocardia YS-20021 strain (CN1584024) and Nocardia JBRs strain (GenBank accession number: AY141130).

  When performing conjugation transfer, a microorganism (recipient microorganism) used as a recipient needs a drug resistance marker for inhibiting the growth of a donor microorganism. Therefore, when a microorganism having no drug resistance or a microorganism having poor drug resistance is used as a recipient, it is necessary to produce a mutant having sufficient drug resistance that allows drug selection. Here, considering the drug resistance of a microorganism (donor microorganism) used as a donor during conjugation transmission, a drug that exhibits sensitivity to the donor microorganism is preferable. Here, being sensitive to a drug means that microorganisms cannot grow in the drug-containing medium. Further, “tolerant to a drug” means that microorganisms can sufficiently grow even in a drug-containing medium.

  Specifically, chloramphenicol, ampicillin, kanamycin, trimethoprim, gentamicin, nardicic acid, carbenicin, thiostrepton, tetracycline, streptomycin and the like are preferable, and chloramphenicol and ampicillin are more preferable.

  The method for producing a recipient microorganism with enhanced drug resistance as described above is not limited. For example, by using (a) natural mutagenesis method, (b) mutagenesis method using ultraviolet irradiation or mutagen, (c) random mutation introduction tool such as EZ-Tn5 (Epicentre), etc. A method of artificially introducing a drug resistance gene originally not possessed by the recipient microorganism into the genome of the microorganism, and (d) a method of introducing a plasmid for acquiring antibiotic resistance separately from the gene modification plasmid in advance. Preferable examples include natural mutagenesis.

  The natural mutagenesis method is to subculture a target microorganism in a medium containing a desired drug, to induce natural mutation in a microorganism that is originally impossible or difficult to grow in the medium. This is a method for obtaining a strain that can grow even in the medium containing a high concentration of the drug.

The extent to which the drug resistance of the recipient microorganism is enhanced can be adjusted as appropriate depending on the recipient microorganism used, the donor microorganism and the selected drug, but the growth of the recipient microorganism is not suppressed, and It is preferable to enhance the concentration based on a drug concentration that sufficiently inhibits the growth of the donor microorganism. For example, when Rhodococcus bacterium is used as the recipient microorganism, Escherichia coli is used as the donor microorganism, and chloramphenicol is used as the selective agent, chloramphenicol is 30 to 200 mg / L, preferably 50 to 200 by spontaneous mutation. It is desirable to obtain a recipient microorganism (chloramphenicol resistant strain) that can grow in a medium containing mg / L.

2.2. Process (b)
In step (b), a microorganism transformed with a predetermined gene modifying plasmid is produced as a donor microorganism to be used for conjugation transmission. As a plasmid for gene modification, that is, a plasmid for modifying a target gene in a recipient microorganism, a plasmid containing the above-described configurations (i) to (v) (gene / base sequence etc.) is used.

  In order to transfer the plasmid from the donor microorganism to the recipient microorganism, in addition to oriT, the mob gene and tra gene (s) are minimally required. mob is a gene encoding an oriT-specific nick enzyme, and when this enzyme acts on oriT, transfer from the donor microorganism to the recipient microorganism (of the genetically modified plasmid) is initiated. tra is a general term for a large number of gene groups, and is composed of gene groups involved in sex cilia formation, junction tube formation, and junction control. The mob gene and tra gene (s) do not necessarily have to be on the genetically modified plasmid, but may be integrated on another plasmid (helper plasmid) or on the donor microbial genome (protein nucleic acid enzyme 38, 60- 68 (1993)).

  In the production method of the present invention, the donor microorganism may be any microorganism that can be conjugated and transferred to the recipient microorganism, and is not limited. However, the donor microorganism needs to satisfy the minimum requirements for the conjugated transfer. Therefore, when the oriT, mob gene, and tra gene (s) are provided on the gene modification plasmid to be used, there is no particular limitation as long as each can function, but on the gene modification plasmid to be used. If only oriT is provided in the microorganism, it is necessary to use a microorganism having the mob gene and tra gene (s) corresponding to oriT. As a combination of a microorganism serving as a donor and a plasmid for gene modification, for example, a combination of E. coli S17-1 and pK19mob is preferable. Since the E. coli S17-1 genome has the tra gene (s) derived from plasmid RP4 and pK19mob has the RP4-derived oriT and mob genes, respectively, it can be used as a donor microorganism.

  Here, the sequence of (i) was deleted in the base sequence region containing the target gene in the recipient microorganism to be modified and the base sequence around the gene (i-1) A base sequence region, (i-2) a base sequence region in which the gene is inactivated, (i-3) a base sequence region in which the gene is replaced with another gene, or (i-4) within the region. This is a base sequence region into which a sequence including another gene and its regulatory region is inserted.

  Isolation (cloning) of the base sequence including the target gene and the base sequence around the gene from the genome of the recipient microorganism, or the target region (homologous region) for gene insertion is a gene library Or a known technique such as PCR.

  Although the base sequence around the target gene is not limited, the longer the homologous region (base sequence around the target gene) with the genome of the recipient microorganism, the more efficiently homologous recombination can occur. It is preferable to use a longer sequence as long as it does not interfere with cloning. For example, the homologous region upstream and downstream of the gene is preferably a sequence containing a base sequence of 100 to 3000 bp, more preferably a sequence containing a base sequence of 500 to 2000 bp.

  The method for producing the base sequence region (i) described above using the isolated base sequence is not particularly limited, and a known technique such as PCR method or excision or replacement of a target gene portion using a restriction enzyme is used. Can be used.

  The deleted gene referred to in (i-1) is a gene in which a part or all of the target gene encoded in the genome of the recipient microorganism is deleted, or a part or all of the promoter sequence is deleted. And those in which a part or all of the gene related to the regulation of expression of the gene is deleted, etc., and these deleted regions may be single or a combination of two or more. Good.

  The inactivated gene referred to in the above (i-2) is, for example, a target gene encoded in the genome of a recipient microorganism or a gene related to expression regulation of the gene, for example, a foreign base such as a drug resistance gene. Examples include those modified by introducing a sequence or the like into a gene that does not express its original function. The foreign base sequence and the like at this time are not limited as long as the gene can be brought into a state in which it is not normally expressed. Accordingly, it is not always necessary to encode any gene, but a recipient microorganism that does not significantly inhibit the growth of the microorganism is preferable.

  Examples of the base sequence obtained by substituting the gene with another gene as described in (i-3) above include chimeric sequences in which a sequence encoding a target gene is replaced with one encoding another gene. When this sequence is used in the practice of the present invention, the target gene cannot be expressed, and at the same time, the substituted gene can be expressed (under the condition that the target gene is expressed). In this case, the gene to be replaced is not particularly limited, but preferably a gene that does not significantly inhibit the growth of the microorganism when functionally expressed in the recipient microorganism.

  The base sequence obtained by inserting a sequence containing another gene and its regulatory region into the region mentioned in the above (i-4) includes the gene to be inserted into the genome of the recipient microorganism and its regulatory region (inserted gene etc. ) Is sandwiched between two homologous regions. The two homologous regions may be adjacent or separated on the genome. The insertion position of the inserted gene or the like is not particularly limited, but it is preferable to select a position that does not affect the expression of other genes due to the insertion. In particular, it is more preferable to select a position that does not significantly inhibit the growth of the recipient microorganism. The inserted gene and the like are not particularly limited, but those that do not significantly inhibit the growth of the microorganism when functionally expressed in the recipient microorganism are preferable.

  The junction transmission start region of (ii) is not limited as long as it includes a base sequence serving as a junction transmission start point in the donor microorganism to be used. For example, a sequence containing a junction transfer initiation region derived from F plasmid, oriT derived from plasmid R6K, oriT derived from plasmid RP4 is preferable.

  The replication initiation region (iii) is not limited as long as it contains a base sequence that can function as a self-replication origin of the plasmid for gene modification in the donor microorganism used. For example, it is preferable to use a region containing the replication origin derived from plasmid pMB1 and broad host range plasmid RK2, and derivatives thereof.

  The resistance gene of (iv) is not limited as long as it is a resistance gene for a drug to which a recipient microorganism (for example, Rhodococcus genus bacteria) subjected to conjugation transmission is sensitive. For example, a kanamycin resistance gene, an ampicillin resistance gene, a gentamicin resistance gene, a thiostrepton resistance gene, a carbenicin resistance gene and the like are preferable, and among them, the kanamycin resistance gene is more preferable.

  The conditional lethal gene of (v) is not limited as long as it is a gene that can be introduced into the genome of a recipient microorganism and has an action of causing the microorganism to die when exposed to a specific condition. For example, the sacB gene is preferable. The sacB gene encodes an enzyme that produces a harmful substance having a lethal effect on a microorganism using sucrose as a substrate when a microorganism (for example, Rhodococcus genus bacteria) possessing and expressing the gene is cultured in a sucrose-containing medium. It is a gene to do.

The gene-modifying plasmid used for conjugation transfer may be constructed based on any vector, and the kind thereof is not particularly limited. Examples of the vector to be used include pBR322, pSC101, pACYC184, pACYC177, pTrc99A, pUC18, pUC19, pUC118, pUC119, pHSG298, pHSG299, pSP64, pSP65, pGEM-3, pGEM-3Z, pGEM-3Zf (-), pGEM -4p, GEM-4Z, Bluescript M13 +, Bluescript M13-, pK19mob, pK18mob, pK18mobsacB and the like. Among them, it is more preferable to use pK19mob, pK18mob, and pK18mobsacB (Schaefer et al., Gene, vol. 45, p. 69-73 (1994)) that already have RP4-derived oriT and mob inside the plasmid.

The configurations of (i) to (v) in the plasmid for gene modification are not particularly limited with respect to the arrangement, and may be arranged in any order. The construction of the plasmid for gene modification including the structures (i) to (v) can be performed using a known gene recombination technique.

In the step (b), a genetically modified plasmid having each of the above-described structures is introduced into a microorganism used as a donor to produce a transformed microorganism, that is, a donor microorganism used for conjugation transmission. At this time, as a transformation method, a method known as a transformation method for microorganisms, such as an electroporation method or a calcium chloride method, can be used.

2.3. Process (c)
In step (c), conjugation transfer from the donor microorganism produced in step (b) to the recipient microorganism produced in step (a) is performed. Usually, the cell suspensions of the donor microorganism and the recipient microorganism are mixed and spread uniformly on a suitable plate medium (for example, LB medium) to allow the two microorganisms to be joined. In the joining, the gene modification plasmid in the donor microorganism moves into the recipient microorganism, homologous recombination occurs in the homologous sequence of the recipient microorganism's genome and the above plasmid, and a part or large part of the gene modification plasmid is formed. A portion is introduced onto the genome of the microorganism. This conjugation produces a transformant of the recipient microorganism, that is, a homologous recombinant strain.

The desired homologous recombination strain in this step (c) is one in which the gene-modifying plasmid is introduced upstream or downstream of the target gene by single crossover. Confirmation of whether or not the desired homologous recombination strain can be performed by utilizing the drug resistance of the recipient microorganism itself and the drug resistance derived from the gene modification plasmid. Specifically, a desired homologous recombination strain can be selected by culturing the microorganism after the conjugation in a medium containing both drugs (for example, a medium containing kanamycin and chloramphenicol).

2.4. Process (d)
In the step (d), the recipient microorganism homologous recombination strain (homologous recombination microorganism) produced in the step (c) is cultured under a culture condition in which the conditionally lethal gene derived from the gene modifying plasmid can function. The culture conditions under which the conditional lethal gene can function are not particularly limited as long as the conditional lethal gene functions. For example, when the conditional lethal gene is the sacB gene, culture using a sucrose-containing medium is used.

  Under the culture conditions, the homologous recombination microorganism having the conditionally lethal gene is difficult to grow. A recipient microorganism from which the nucleotide sequence region derived from the gene-modifying plasmid containing the region has been removed (dropped) can be obtained.

  However, among the microorganisms obtained by the culture, those in which the target gene in the recipient microorganism is deleted, inactivated, replaced with another gene as originally intended, or introduced. And those that are not (including those in which the function of the original target gene has been restored by homologous recombination at the time of dropping, or those in which no gene transfer has occurred, that is, microorganisms in which genetic modification has not occurred) Yes. Therefore, the desired recipient microorganism can usually be selected by further culturing under further culturing conditions.

  As another culturing condition, culturing under the culturing condition capable of confirming the function of the target gene or the substituted or inserted gene is preferable. For example, when the modification of the microorganism is a deletion, inactivation, or substitution of a drug gene, a strain that cannot grow or is extremely difficult to grow when cultured in a medium containing the drug, That is, it can be selected as a microorganism genetically modified by the production method of the present invention. If confirmation of the function is not easy, a desired microorganism can be selected by extracting a genome from the recipient microorganism and analyzing the sequence of the modified region.

As described above, since the genetically modified microorganism obtained by the production method of the present invention does not leave a trace of the gene modification plasmid on the genome, the steps (b) to (d) of the present invention are repeated. It is possible to modify the same strain multiple times.

3. Protein production method The genetically modified microorganism obtained by the production method of the present invention described above is also included in the scope of the present invention. The microorganism may be a plasmid in which a certain protein is highly expressed, for example, an expression vector into which a nitrile hydratase that is a catalyst for acrylamide production can be expressed separately.

  In the present invention, it is possible to provide a method for producing a protein, which comprises culturing using the genetically modified microorganism as a host and collecting the target protein from the obtained culture.

  In the method for producing a protein, the method for culturing a microorganism can be performed according to a usual method.

  As a medium for cultivating microorganisms, any medium can be used as long as it contains a carbon source, nitrogen source, inorganic salts, etc. that can be assimilated by microorganisms and can efficiently cultivate microorganisms. It may be used. Examples of the carbon source include carbohydrates such as glucose, fructose, sucrose and starch, organic acids such as acetic acid and propionic acid, alcohols such as ethanol and propanol, and hydrocarbons such as hexane, decane, dodecane and tetradecane. Examples of the nitrogen source include ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, ammonium salts of organic acids such as ammonium phosphate or other nitrogen-containing compounds, peptone, meat extract, corn steep liquor, and the like. Examples of the inorganic substance include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, and calcium carbonate.

  Although culture conditions are not limited, For example, it can carry out at the temperature of 10 to 45 degreeC, Preferably it is 10 to 40 degreeC for 5 to 120 hours, Preferably it is about 5 to 100 hours. In some cases, a small amount of pre-culture can be performed prior to the main culture.

  For example, when culturing using a transformant of Rhodococcus bacteria as a host, it is preferably carried out at 4 to 40 ° C., preferably 20 to 35 ° C. under aerobic conditions such as shaking culture or aeration and agitation culture. The culture is preferably timely adjusted with an inorganic or organic acid, an alkaline solution or the like.

  Further, in order to prevent the expression vector from falling off from the transformant during culturing, the culturing may be performed in a state where selective pressure is applied by a drug selection marker as necessary. For example, when a transformant transformed with a vector containing a kanamycin resistance gene is cultured, kanamycin may be added to the medium as needed during the culture.

  As described above, when cultured under an appropriate culture condition that matches the properties of the host microorganism, the heterologous protein (target protein) can be obtained in a high yield in the culture, that is, the culture supernatant, the cultured cells, or the bacteria. It can accumulate in at least one of the crushed material. These solutions containing heterologous proteins are referred to as “cultures”.

  When the target protein is produced in the microbial cells after culturing, the target protein can be used as it is, or the target protein can be collected by crushing the microbial cells. In either case, if necessary, the medium can be removed and washed by solid-liquid separation operations such as centrifugation and membrane filtration. Centrifugation is not particularly limited as long as it can supply centrifugal force for sedimentation of bacterial cells, and a cylindrical shape, a separation plate shape, or the like can be used. As a centrifugal force, it can carry out at about 500G-20,000G, for example. The membrane filtration may be either a microfiltration (MF) membrane or an ultrafiltration (UF) membrane as long as the desired solid-liquid separation can be achieved, but it is usually preferable to use a microfiltration (MF) membrane.

  The target protein can also be collected by disrupting the cells. Cell disruption methods include ultrasonic treatment, high-pressure treatment using a French press or homogenizer, grinding treatment using a bead mill, collision treatment using an impact crushing device, enzyme treatment using lysozyme, cellulase, pectinase, etc. Examples include liquid treatment, lysis induction treatment with phage, and the like, and any of these methods can be used alone or in combination as necessary.

On the other hand, when the target protein is produced outside the cells, the culture solution may be used as it is, or the cells may be removed by centrifugation, filtration or the like as described above. Thereafter, if necessary, the target protein is collected from the culture by extraction with ammonium sulfate precipitation, and further, if necessary, dialysis, various chromatography (gel filtration, ion exchange chromatography, affinity chromatography, etc.) alone or It can also be purified by using a suitable combination.

Hereinafter, the present invention will be described more specifically by way of examples. However, the technical scope of the present invention is not limited to these examples.

Construction of plasmid pKM043 for kanamycin resistance gene deletion (production of plasmid for gene modification)
The sacB gene in pDNR-1r (manufactured by Clontech Laboratories) was amplified by PCR using primers SAC-01 (SEQ ID NO: 1) and SAC-02 (SEQ ID NO: 2) to which an NspV cleavage site was added, and about 1.9 kb A sacB gene fragment was obtained. Amplification conditions are as follows.

Primer:
SAC-01: 5'-GGTTCGAATACCTGCCGTTCACTATTATTTAGTG-3 '(SEQ ID NO: 1)
SAC-02: 5'- GGTTCGAATCGGCATTTTCTTTTGCGTTTTTATTTG -3 '(SEQ ID NO: 2)

Reaction solution composition:
Sterile water 22 μl
2 x PrimeSTAR (Takara Bio) 25 μl
SAC-01 (SEQ ID NO: 1) 1 μl
SAC-02 (SEQ ID NO: 2) 1 μl
pDNR-1r (manufactured by clontech) (100-fold dilution) 1 μl
Total volume 50 μl

Temperature cycle:
30 cycles of reaction at 98 ° C for 10 seconds, 55 ° C for 15 seconds and 72 ° C for 150 seconds

After digesting the sacB gene fragment with the restriction enzyme NspV (Takara Bio), it is connected to the NspV site of pK19mob (available from the National BioResource Project (National BioResource Project E. coli strain Cloning Vector Collection)), and the sacB gene is resistant to kanamycin A plasmid pK19mobsacB1 introduced downstream of the gene and in the same direction was constructed.

Rhodococcus rhodochrous KM-02 (National Institute of Advanced Industrial Science and Technology Patent Biological Deposit Center; Accession Number: FERM P-14457) in 100 ml of MY medium (0.5% polypeptone, 0.3% bact yeast extract, 0.3% malt extract ) And shake-cultured at 30 ° C., the genome was isolated by the method of Saito and Miura (Biochim. Biophys. Acta 72, 619 (1963)). A plasmid library was prepared by inserting the KM-02 genome incompletely digested with the restriction enzyme EcoRI into the pTrc99 multicloning site. E. coli JM109 was transformed with the plasmid library, and LB plate (1% Bact tryptone, 0.5% bact yeast extract, 1%) containing kanamycin sulfate (40 μg / ml) and IPTG (isopropyl-β-thiogalactoside) (1 mM) A transformant showing kanamycin resistance was selected using NaCl, 1.5% agar). A plasmid was extracted from this transformant and named pKM031.

pKM031 was cleaved with the restriction enzyme HindIII (manufactured by Takara Bio Inc.) to construct a plasmid pKM041 in which a fragment of about 3.3 kb containing the kanamycin resistance gene derived from the KM-02 strain and its peripheral sequence was inserted into the HindIII site of pUC18.

The entire length (about 0.5 kb) of the kanamycin resistance gene in pKM041 was deleted to obtain plasmid pKM042. Deletion was performed by PCR using primers KMD-01 (SEQ ID NO: 3) and KMD-02 (SEQ ID NO: 4) designed to anneal 10 bases on both sides of the region to be deleted. PCR amplification conditions are as follows.

Primer:
KMD-01: 5'-GACCATTGTTCCAGGTCGACTGGGACGAGT-3 '(SEQ ID NO: 3)
KMD-02: 5'-ACTCGTCCCAGTCGACCTGGAACAATGGTC-3 '(SEQ ID NO: 4)

Reaction solution composition:
Sterile water 38.5 μl
10 × PfuTurbo buffer 5 μl
dNTP (25 mM each) 3 μl
KMD-01 (SEQ ID NO: 3) 1 μl
KMD-02 (SEQ ID NO: 4) 1 μl
pKM041 1.5 μl
PfuTurbo (STRATAGENE) 1 μl
Total volume 50 μl

Temperature cycle:
95 ° C 60 seconds reaction 1 cycle, 95 ° C 50 seconds, 60 ° C 50 seconds and 72 ° C 16 minutes reaction 30 cycles, 72 ° C 7 minutes reaction 1 cycle

pKM042 was cleaved with the restriction enzyme HindIII, and the sequence around the kanamycin resistance gene was about 2.8 kb (
Plasmid pKM043 was constructed in which the kanamycin resistance gene deleted) was inserted into the HindIII site of pK19mobsacB1 (see FIG. 2).

In the above plasmid pKM043 production procedure, GFX PCR DNA band and Gel Band Purification kit (manufactured by GE Healthcare) is used for purification of DNA fragments and PCR products cleaved by restriction enzymes, and DNA Ligation Kit <Mighty Mix for DNA-to-DNA connection. > (Manufactured by Takara Bio Inc.), and QIAprep miniprep kit (manufactured by QIAGEN) was used for plasmid extraction.

Drug resistance-enhanced mutant with natural mutagenesis: Production of RhCm ^SR- 01 strain (production of recipient microorganism)
Rhodococcus rhodochrous ATCC 12674 strain is subcultured in a medium containing a higher concentration of chloramphenicol to induce spontaneous mutation and tolerant to 200 mg / L chloramphenicol Strain RhCm ^SR- 01 strain was isolated. Details of the subculture are as follows.

ATCC 12674 strain MYK plate containing 10 mg / L chloramphenicol (0.5% polypeptone, 0.3% bact yeast extract, 0.3% malt extract, 0.2% KH ₂ PO ₄ , 0.2% K ₂ HPO ₄ , 1.5% agar) And inoculated at 30 ° C. for 3 days. The grown colonies were inoculated into MYK medium (0.5% polypeptone, 0.3% bact yeast extract, 0.3% malt extract, 0.2% KH ₂ PO ₄ , 0.2% K ₂ HPO ₄ ) containing 10 mg / L chloramphenicol. And cultured for 2 days at 30 ° C. and 200 rpm. Next, 0.1% of the culture solution was inoculated into MYK medium containing 40 mg / L chloramphenicol and cultured at 30 ° C. and 200 rpm for 2 days.

The subculture was repeated while gradually increasing the chloramphenicol concentration, and finally the culture solution was inoculated on a MYK plate containing 200 mg / L chloramphenicol. If the growth rate was slow during subculture, the number of days of culture was extended by 2-3 days. The number of subcultures is 4 (chloramphenicol content: subculture in the order of 10, 40, 100, 200 (mg / ml)). The appearing colony was further inoculated twice on a MYK plate containing 200 mg / L chloramphenicol to form a single colony, thereby isolating the RhCm ^SR- 01 strain.

ATCC 12674 Kanamycin-sensitive strain: Production of RhΔKm-01 strain Escherichia coli S17-1λpir was transformed with pKM043 and grown overnight at 37 ° C. on a 50 mg / L kanamycin sulfate-containing LB plate. S17-1λpir / pKM043 was suspended in LB medium, centrifuged (room temperature, 4500 ppm, 2 min), and the cells were collected, washed once with LB, and resuspended in LB.

RhCm ^SR- 01 was plated on a MYK plate and cultured at 30 ° C. for 3 days. About tens of colonies on the MYK plate are scraped off and suspended in 0.9% NaCl, centrifuged (room temperature, 15000 ppm, 2 min), and the cells are collected, washed once with 0.9% NaCl, and reconstituted in LB. Suspended.

The two suspensions were gently mixed at a ratio of 1: 1, inoculated on an LB plate, and cultured overnight at 30 ° C. (conjugate transfer of pKM043). Since one of the target gene and the selectable marker is a kanamycin resistance gene, selection was performed at a kanamycin concentration at which a wild strain cannot normally grow. For actual selection, a MYK plate (0.5% polypeptone, 0.3% bact yeast extract, 0.3% malt extract, 0.2% KH ₂ PO ₄ , 0.2%) containing kanamycin sulfate 200 mg / L and chloramphenicol 50 mg / L K ₂ HPO ₄ , 1.5% agar) was used.

  After confirming by plasmid PCR that plasmid pKM043 has been introduced into the genome by homologous recombination, use sacB counter-selection system (WO 01/31050) by culturing on MYK plate containing 10% sucrose ), The pK19mobsacB1-derived sequence was removed from the ATCC 12674 genome. By replica plating on a kanamycin-containing LB plate, a kanamycin sensitive strain RhΔKm-01 that could not grow under conditions containing 10 mg / L kanamycin sulfate was successfully isolated (see FIG. 3A). As a result of genome analysis of the wild strain and the RhΔKm-01 strain by PCR, it was confirmed that the region corresponding to the kanamycin resistance gene length of about 0.5 kb was deleted from the genome in the RhΔKm-01 strain (FIG. 3B). reference).

Application to other kanamycin-resistant Rhodococcus bacteria
Rhodococcus erythropolis PR4 (Biological Resource Division, National Institute of Technology and Evaluation; Accession Number: NBRC 100887), whose entire genome sequence is published on DB, also has a homolog of the kanamycin resistance gene of ATCC 12674. As a result of the homology search, the kanamycin resistance genes of both strains showed high homology of 96.1% match (base sequence), so gene deletion using pKM043 was performed. LB or an LB plate was used as a base medium for culturing at each stage.

Since PR4 was also confirmed to have weak chloramphenicol resistance like other ATCC 12674, a mutant strain showing resistance to 120 mg / L Cm in the same manner as in Example 2. RhCm ^SR- 09 was prepared and isolated. The number of subcultures is 7 (chloramphenicol content: passage in the order of 10, 20, 30, 60, 80, 100, 120 (mg / ml)).

  A kanamycin sensitive strain RhΔKm-10 was isolated by the same method as in Example 3 (see FIG. 4A). It was confirmed that the kanamycin resistance gene was deleted from the genome of RhΔKm-10 (see FIG. 4B).

SEQ ID NO: 1 synthetic DNA
Sequence number 2: Synthetic DNA
Sequence number 3: Synthetic DNA
Sequence number 4: Synthetic DNA

Claims (6)

A method for producing a genetically modified microorganism comprising using a transformation method utilizing conjugative transfer from a donor microorganism to a recipient microorganism, comprising the following steps (a) to (d): Said method.
(A) a step of producing a microorganism having enhanced resistance to a drug to which the donor microorganism to be used for conjugation transmission is sensitive as a recipient microorganism;
(B) As a donor microorganism, (i) a base sequence region containing a target gene in a recipient microorganism and its surrounding base sequence (i-1) a base sequence region in which the target gene is deleted, (i- 2) a base sequence region in which the target gene is inactivated, (i-3) a base sequence region in which the gene is replaced with another gene, or (i-4) another gene and its regulation within the region A base sequence region into which a sequence containing the region is inserted; (ii) a conjugation initiation region that functions in the donor microorganism; (iii) a replication initiation region that functions in the donor microorganism; and (iv) a drug to which the recipient microorganism is sensitive. Producing a microorganism transformed with a plasmid for genetic modification comprising a resistance gene and (v) a conditionally lethal gene for the recipient microorganism;
(C) a step of producing a transformant of the recipient microorganism by performing conjugative transfer from the donor microorganism produced in (b) to the recipient microorganism produced in (a); and (d ) A step of culturing the transformant produced in (c) under a culture condition in which the conditionally lethal gene can function.   The method according to claim 1, wherein the donor microorganism is Escherichia coli.   The method according to claim 1 or 2, wherein the recipient microorganism is a Rhodococcus bacterium.   The method according to claim 3, wherein the Rhodococcus bacterium is Rhodococcus rhodochrous or Rhodococcus erythropolis.   A genetically modified microorganism obtained by the method according to any one of claims 1 to 4.   A method for producing a protein, comprising culturing the microorganism according to claim 5 as a host and collecting a target protein from the obtained culture.