JP2013255486A - Genetically modified variant of rhodococcus bacterium, and method for producing the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a Rhodococcus bacterium in which modification of a target gene is easy by losing heterologous foreign DNA-inserting ability.SOLUTION: There is provided a variant of a Rhodococcus bacterium in which a gene encoding a protein associated with insertion of a heterologous foreign DNA into the genome is deleted or deactivated. There is also provided a method for producing the genetically modified Rhodococcus bacterium including the introduction of a gene structure containing a sequence homologous to at least a part of the genome of the variant into the variant of the Rhodococcus bacterium.

Description

  The present invention relates to a method for modifying the target sequence of the genome of a bacterium belonging to the genus Rhodococcus. Specifically, the present invention relates to the bacterium in which non-homologous foreign DNA insertion ability of the bacterium is lost and the target gene modification is facilitated, and a method for producing the bacterium.

Bacteria belonging to the genus Rhodococcus (hereinafter referred to as "Rhodococcus bacteria") are industrially useful because of their physical strength, organic solvent resistance, redox ability, ability to accumulate large amounts of enzymes, etc. in cells. Known as a novel microbial catalyst. For example, Rhodococcus bacteria are used for the production of amides or acids by enzymatic hydration or hydrolysis of nitriles (Patent Documents 1 and 2). It is also known as a high-resolution microbial species for persistent compounds (Patent Documents 3 to 6), and by utilizing its capabilities, it is considered to be applied to the production of various useful substances and environmental purification. Is underway. Examples of such applications include the production of useful substances from petroleum by desulfurization, or bioremediation when oil spills into the environment.
In addition, attempts have been made to modify Rhodococcus bacteria to more useful ones by genetic recombination methods (Patent Documents 7 to 9). For example, in order to efficiently promote genetic manipulation of Rhodococcus bacteria, development of host-vector systems has been promoted. Searching for new plasmids (Patent Documents 10 to 12), development of vectors (Patent Documents 13 to 20) Non-Patent Document 1) and the like have been performed. As the usefulness of Rhodococcus bacteria becomes clear in this way, in addition to the development of conventional genetic recombination techniques, the method of modifying Rhodococcus bacteria itself as a host to have desired characteristics according to the purpose of use. Development has been expected.
By the way, recombination of DNA in cells is a phenomenon that occurs in various situations. For example, when damage such as cleavage occurs in genomic DNA, or when foreign DNA enters the cell for some reason and is incorporated into genomic DNA. Is known to occur when Much knowledge has been obtained about the mechanism of DNA recombination by vigorous research on DNA repair. In repairing DNA double-strand breaks (DSB), which are serious DNA damages, it has become clear that two major repair pathways are functioning in eukaryotes such as mammals and yeast. Yes. One is recombination between homologous sequences between DNA sequences (homologous recombination, HR), and the other is DBS by direct ligation of DNA ends without using DNA homology. Non-homologous recombination (NHEJ: non-homologous end joining). Which of HR and NHEJ functions preferentially depends on the species. In this regard, in filamentous fungi, there are examples in which the efficiency of homologous recombination has been improved by reducing or losing the function of ATP-dependent DNA ligase IV, which is the key enzyme of NHEJ, or the DNA end-binding protein Ku. It has been reported (Patent Document 21, Patent Document 22).
DSB repair by homologous recombination in prokaryotes has been studied using E. coli as a model organism, and it is known that a recombinase called RecA and a RecBCD complex (a complex consisting of a helicase and a nuclease) are involved. It has been. DSB repair by non-homologous end joining has been studied using mycobacteria as model organisms, and two proteins, DNA end-binding protein (Ku) and ATP-dependent DNA ligase, are involved in DSB repair. (Non-Patent Document 2). However, there are no studies on non-homologous recombination of foreign DNA into the genome as seen in Rhodococcus bacteria, and the Mycobacterium bacteria have the above-mentioned characteristics found in Rhodococcus bacteria. It is unknown whether it is.

JP-A-2-470 JP-A-3-251192 European Patent No. 188316 European Patent No. 204555 European Patent No. 348901 European Patent Application No. 307926 Japanese Unexamined Patent Publication No. 4-21379 JP-A-6-25296 JP-A-6-303791 Japanese Patent Laid-Open No. 4-148685 JP-A-4-330287 Japanese Unexamined Patent Publication No. 7-255484 Japanese Patent Laid-Open No. 5-64589 JP-A-8-56669 U.S. Pat.No. 4,920,054 JP-A-8-173169 Japanese Patent Laid-Open No. 10-248578 JP 2006-180843 A JP 2006-50967 Gazette JP 2008-154552 JP JP 2006-158269 JP JP 2007-300857 JP

Journal of Bacteriology, vol. 170, p. 638-645 (1988) Molecular Microbiology 79, 316-330 (2011)

As mentioned above, in order to more effectively utilize Rhodococcus bacteria that have been applied to the industrial field, in addition to the expression of useful proteins by conventional genetic recombination, specific genes on the genome of Rhodococcus bacteria are specifically selected. It is effective to modify or redesign metabolic pathways by deleting or inactivating them.
As a technique for deleting or inactivating a gene present on the genome, a method utilizing homologous recombination can be mentioned. When a gene is deleted or inactivated by homologous recombination in a Rhodococcus bacterium, the target gene deletion strain or inactivated strain can be obtained even using the electroporation method, which is a normal transformation method. Is very difficult. This is thought to be because “non-homologous” recombination preferentially occurs, rather than “homologous” recombination to the target gene on the genome.
Regarding Rhodococcus bacteria, there are no examples of the above-mentioned mechanisms for DNA repair, etc., and it is clear what mechanism is involved in heterologous recombination of foreign DNA into the genome. It was not.
An object of the present invention is to provide a Rhodococcus bacterium that loses the ability to insert non-homologous foreign DNA and can easily modify a target gene.

The present inventors have clarified a protein involved in non-homologous recombination of Rhodococcus bacteria and suppressed its function, thereby losing the non-homologous foreign DNA insertion ability of the bacteria, and target gene modification The present inventors have found that it is possible to easily produce Rhodococcus bacteria and have completed the present invention.
Specifically, the present invention is as follows.
The present invention relates to a Rhodococcus bacterium mutant in which a gene encoding a protein involved in heterologous foreign DNA fragment insertion into a genome is deleted or inactivated.
The present invention produces a genetically modified Rhodococcus bacterium comprising introducing a gene construct comprising a sequence homologous to at least a part of the genome of the mutant strain into the Rhodococcus bacterium mutant of the present invention. It is also a method.
In the present invention, the term “foreign DNA fragment” refers to a DNA fragment derived from a species different from the host Rhodococcus bacterium, a DNA fragment derived from the same species as the host Rhodococcus bacterium, and a plurality of It refers to a chimeric DNA fragment composed of DNA fragments derived from these species. The chimeric DNA fragment may contain a sequence derived from a host Rhodococcus bacterium.

  According to the Rhodococcus bacterium mutant of the present invention, the genome modification of the Rhodococcus bacterium is facilitated. Therefore, the metabolic pathway can be modified or redesigned more efficiently for the Rhodococcus bacterium. This makes it possible to more easily carry out efficient substance production using the bacterium as a host or the like.

FIG. 4 is a diagram showing a gene map of PR4 strain LigD (ATP-dependent DNA ligase, accession no: YP_002767969) gene deletion plasmid pTJ002. FIG. 3 is a diagram showing a gene map of PR4 strain ICL (isocitrate lyase, accession no: YP_002765021) gene disruption plasmids pTJ007, pTJ008, and pTJ009. It is a figure which shows the result of having confirmed that the ICL gene on the genome of PR4KSΔLigD strain was destroyed. It is a figure which shows the alignment of the LigD homologue derived from several Rhodococcus genus bacteria. It is a figure which shows the result of having confirmed that the NHase gene on the genome of a J1-CmΔRΔligD strain was deleted.

Hereinafter, the present invention will be described in detail. The scope of the present invention is not limited to these descriptions, and other than the following examples, the scope of the present invention can be appropriately changed and implemented without departing from the spirit of the present invention.
It should be noted that all publications cited in the present specification, for example, prior art documents, publications, patent publications and other patent documents are incorporated herein by reference.

1. Microorganisms having target heterologous recombination genes Rhodococcus bacteria (hereinafter sometimes referred to as “microorganisms of the present invention”) that have lost the ability to insert non-homologous foreign DNA into the genome according to the present invention are genomes. This is a mutant strain in which a gene involved in heterologous foreign DNA insertion (hereinafter, “non-homologous recombination gene”) has been deleted or inactivated.
As Rhodococcus bacteria, Rhodococcus rhodochrous J1, M8 (SU1731814), M33 (VKM Ac-1515D), ATCC 184, ATCC 999, ATCC 4001, ATCC 4273, ATCC 4276, ATCC 9356, ATCC 12483, ATCC 12674, ATCC 13808, ATCC 14341, ATCC 14347, ATCC 14350, ATCC 15905, ATCC 15998, ATCC 17041, ATCC 17043, ATCC 17895, ATCC 19067, ATCC 19149, ATCC 19150, ATCC 21243, ATCC 21291, ATCC 21785, ATCC 21924, ATCC 21999, ATCC 29670, ATCC 29672, ATCC 29675, ATCC 33258, ATCC 33275, ATCC 39484, IFO 3338, IFO 14894, JCM 3202, NCIMB 11215, NCIMB 11216, Rhodococcus erythropolis PR4 (NBRC 100887), NBRC 12320, NBRC 15567, NBRC 16296, IFM 155, DSM 743, DSM 9675, DSM 43200, JCM 6821, JCM 6822, JCM 6823, JCM 6824, JCM 6827, DSM 11397, DSM 44522, JCM 2895, JCM 2893, JCM 2894 , IAM 1400, IAM 1503, SK121, Rhodococcus pyrid inovorans) MW3, S85-2, PA, AK37, PYJ-1, Rhodococcus opacus B4, PD630, Rhodococcus jostii RHA1, etc., Rhodococcus imtechensis, Rhodococcus imtechensis equi) 103S, ATCC 33707.
The non-homologous recombination gene in the present invention refers to a gene encoding a protein (non-homologous recombination protein) involved in heterologous foreign DNA insertion into the genome in Rhodococcus bacteria, that is, a non-homologous recombination gene. Point to. Examples of the heterologous recombination gene include a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 21. The protein represented by SEQ ID NO: 1 is a protein possessed by Rhodococcus erythropolis PR4 whose whole genome information is disclosed, and is annotated with LigD (ATP-dependent DNA ligase, accession no: YP_002767969). In the present invention, it has been clarified that non-homologous foreign DNA insertion in the PR4 strain is suppressed by losing the function of the gene annotated as LigD (LigD homolog gene). As described above, LigD is known to function as a key enzyme for NHEJ in mycobacterial bacteria, so that the NHEJ pathway is involved in heterologous foreign DNA insertion found in Rhodococcus. Guessed. The protein represented by SEQ ID NO: 21 is a protein possessed by Rhodococcus rhodochrous J1 and is a protein having homology with ATP-dependent DNA ligase. In the present invention, it has been clarified that the homologous recombination ability of the J1 strain is improved by deleting a gene having homology with the ATP-dependent DNA ligase.
The heterologous recombinant gene of the present invention includes an amino acid sequence obtained by deleting, substituting, or adding one or several amino acids in the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 21, and A protein having a function involved in heterologous insertion of foreign DNA into the genome; and a protein comprising an amino acid sequence having 60% or more homology with a protein comprising the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 21 And a protein having a function involved in the insertion of foreign DNA into the genome.
These proteins are also annotated as LigD in multiple strains of Rhodococcus bacteria other than PR4 and J1 strains, and have high homology with the “non-homologous recombination proteins” of the PR4 and J1 strains. It encodes a protein. These are also presumed to be involved in heterologous foreign DNA insertion in each strain. As a protein having high homology (homology) with PR4 strain and J1 strain “non-homologous recombination protein”, Rhodococcus erythropolis SK121 LigC (ATP-dependent DNA ligase, accession no: ZP_04383046; SEQ ID NO: 13; sequence) The homology with the amino acid sequence of No. 1 is 98%, the homology with the amino acid sequence of SEQ ID No. 21 is 63%), and LigD of Rhodococcus opacus B4 (ATP-dependent DNA ligase, accession no: YP_002782304; SEQ ID NO: 14; The homology with the amino acid sequence of SEQ ID NO: 1 is 73%, the homology with the amino acid sequence of SEQ ID NO: 21 is 66%), the DNA ligase of Rhodococcus josti RHA1 (ATP-dependent, accession no: YP_704987; SEQ ID NO: 15; 73% homology with the amino acid sequence of SEQ ID NO: 1, 65% homology with the amino acid sequence of SEQ ID NO: 21), ATP-dependent DNA ligase (accession no: EID78745; SEQ ID NO: 16; sequence of Rhodococcus imtekensis RKJ300) Number 1 73% homology with the non-acid sequence, 66% homology with the amino acid sequence of SEQ ID NO: 21), DNA ligase (accession no: EHI44149; SEQ ID NO: 17; SEQ ID NO: 1) of Rhodococcus opacus PD630 Is 73%, homology with the amino acid sequence of SEQ ID NO: 21 is 65%), Rhodococcus equii 103S ATP-dependent DNA ligase (accession no: YP_004005863; SEQ ID NO: 18; SEQ ID NO: 1 with the amino acid sequence of SEQ ID NO: 1) Homology 68%, 62% homology with the amino acid sequence of SEQ ID NO: 21), Rhodococcus equi Ecc ATCC 33707 DNA ligase (accession no: ZP_08155867; SEQ ID NO: 19; homology with the amino acid sequence of SEQ ID NO: 1 68%, 62% homology with the amino acid sequence of SEQ ID NO: 21), ATP-dependent DNA ligase (accession no: ZP_09308731) of Rhodococcus pyridinovorans AK37; SEQ ID NO: 20; homology with the amino acid sequence of SEQ ID NO: 1 is 61 %, Homology with the amino acid sequence of SEQ ID NO: 21 It includes 95%), and the like. The alignment of each LigD homolog found in the above species is shown in FIG.
The heterologous recombination gene of the present invention includes DNA comprising a sequence complementary to the PR4 strain LigD gene represented by SEQ ID NO: 2 and the PR4 strain LigD homolog gene, or the J1 strain represented by SEQ ID NO: 22. A gene that hybridizes under stringent conditions with each of the LigD gene and DNA containing a sequence complementary to the J1 strain LigD homolog gene and encodes a protein involved in heterologous foreign DNA insertion into the genome Is also included.
Here, stringent conditions refer to conditions in which only specific hybridization occurs and non-specific hybridization does not occur. Stringent conditions are sequence-dependent, but can usually be optimized by setting the salt concentration lower than general hybridization conditions or by adding formamide.
For example, hybridization at 42 ° C in a buffer containing 5xSSC, 1% SDS and 50% formamide, or hybridization at 65 ° C in a buffer containing 5xSSC and 1% SDS (both With washing at 65 ° C. with 0.2 × SSC and 0.1% SDS). Those skilled in the art, in addition to the conditions such as salt concentration and temperature of the buffer, various conditions such as probe (DNA fragment containing a sequence complementary to the target gene) concentration, probe length, reaction time, etc. The conditions for specifying the heterologous recombination gene of the present invention can be appropriately set.

2. Method for producing microorganism in which target heterologous recombination gene is deleted or inactivated The method for deleting or inactivating target nonhomologous recombination gene is not limited, and any method can be applied. Good. For example, a method of transforming Rhodococcus bacteria with a plasmid having a sequence homologous to the gene or its peripheral sequence can be used. As a transformation method, an electroporation method, a junction transfer method, or the like can be used.
The technique of transformation of Rhodococcus bacteria by electroporation is well known in the field to which the technology of the present invention belongs. For details of the transformation method, Journal of General Microbiology 138: 1003-1010 can be referred to.
Here, when the electroporation method is used as the method for deletion or inactivation, it is difficult to find a desired homologous recombination microorganism because an overwhelmingly large number of non-homologous recombination strains appear. In the present invention, the joint transmission method is particularly preferable. JP, 2011-200133, A can be referred to for details of the transformation method by the junction transfer method.
Specifically, for example, by using a transformation method using conjugative transfer from a donor microorganism to a recipient microorganism, the method for deleting or inactivating a target heterologous recombinant gene of the present invention is used. And the microorganisms of this invention can be obtained by the method characterized by including the following process (a)-(d). The transformation by the junction transfer method in the present invention is preferably performed by a method including the following steps (a) to (d).
(a) As a recipient microorganism, a Rhodococcus bacterium having a selective marker (hereinafter referred to as “donor microorganism growth inhibition marker”) showing resistance to growth conditions that inhibits the growth of a donor microorganism is introduced or enhanced. Process;
(b) a step of producing a microorganism transformed with a non-homologous recombinant gene loss-of-function plasmid comprising the following (i) to (v) as a donor microorganism;
(i) a base sequence region in which the gene is deleted or inactivated in the base sequence including the target heterologous recombinant gene in the recipient microorganism and the surrounding base sequence,
(ii) a junction transmission initiation region that functions in the donor microorganism;
(iii) a replication initiation region that functions in the donor microorganism,
(iv) a selection marker (hereinafter referred to as a “recipient microorganism growth inhibition marker”) that exhibits resistance to growth conditions that inhibit the growth of the recipient microorganism, and
(v) Conditionally lethal genes for recipient microorganisms
(c) producing a transformant of the recipient microorganism by performing conjugation transfer from the donor microorganism produced in step (b) to the recipient microorganism produced in step (a); and
(d) A step of culturing the transformant prepared in the step (c) under a culture condition in which the conditionally lethal gene can function.
The Rhodococcus bacterium used as a recipient in the deletion or inactivation method is not particularly limited.
In the case of gene deletion or inactivation using conjugative transfer, the growth of both the recombinant strain of the donor microorganism (donor microorganism) and the non-recombinant strain of the recipient microorganism (recipient microorganism) is inhibited. Therefore, two kinds of selection markers (donor microbial growth inhibition marker and recipient microbial growth inhibition marker) are necessary. The donor microorganism growth inhibition marker must be possessed by the recipient microorganism itself. The recipient microorganism growth inhibition marker must be contained in a plasmid for loss of function of the heterologous recombination gene. Details of both markers will be described in the following steps.

2-1. Process (a)
In the step (a), a Rhodococcus bacterium having a donor microorganism growth inhibition marker introduced or enhanced is produced. For the reasons described above, a Rhodococcus bacterium as a recipient needs a drug resistance marker (donor microorganism growth inhibition marker) for inhibiting the growth of a donor microorganism. Therefore, when using Rhodococcus bacteria that do not have drug resistance or poor drug resistance, it is necessary to produce mutants having drug resistance to the extent that a drug can be selected that can function as a donor microbial growth inhibition marker. .
Rhodococcus bacteria are known to be resistant to several drugs, but their resistance may be weak, and their properties are not sufficient for use as markers for conjugation transmission.
Therefore, when utilizing the drug resistance inherent in Rhodococcus bacteria, a mutant strain of Rhodococcus bacteria with enhanced resistance so as to exhibit sufficient resistance against a high concentration of the drug is produced, and the mutant strain By using as a recipient, homogenous recombination with excellent versatility and high efficiency becomes possible.
Here, as a drug for inhibiting the growth of donor microorganisms, it is preferable to select a drug that is sensitive to the donor microorganism in consideration of the drug resistance of the microorganism (donor microorganism) used as the donor during conjugation transmission. As the drug, chloramphenicol, ampicillin, kanamycin, trimethoprim, gentamicin, naldicric acid, carbenicin, thiostrepton, tetracycline, streptomycin, etc. are preferable, and chloramphenicol and ampicillin are more preferable.
There are no particular limitations on the method for producing a recipient microorganism with enhanced donor microorganism growth inhibition markers. For example, (i) natural mutagenesis, (b) mutagenesis using ultraviolet irradiation or a mutagen. (C) A method of introducing a plasmid for acquiring antibiotic resistance separately from a plasmid for loss of function of a non-homologous recombination gene is preferable, and a natural mutagenesis method is more preferable.
The natural mutagenesis method involves subculturing a target microorganism in a medium containing a desired drug at a constant concentration, thereby inducing spontaneous mutation in a microorganism that originally cannot or cannot grow in the medium. This is a method for obtaining a strain that can grow even in the medium containing a higher concentration of the drug.
The degree to which the drug resistance of Rhodococcus bacteria that are recipient microorganisms is enhanced depends on the type of Rhodococcus bacteria used, the donor microorganism, and the drug to be selected, and may be adjusted as necessary. It is preferable to enhance drug resistance based on a drug concentration at which the growth of microorganisms is not suppressed and the growth of donor microorganisms is sufficiently inhibited. For example, when Rhodococcus bacterium is used as the recipient microorganism, Escherichia coli is used as the donor microorganism, and chloramphenicol is used as the selective agent, chloramphenicol is 10 to 200 mg / L, preferably 20 by spontaneous mutation. It is desirable to obtain a Rhodococcus bacterium (chloramphenicol resistance-enhanced strain) that can grow in a medium containing ˜200 mg / L, more preferably 50 to 200 mg / L.

2-2. Process (b)
In step (b), a microorganism transformed with a predetermined heterologous recombination gene function loss plasmid is prepared as a donor microorganism to be used for conjugation transfer. Non-homologous recombination gene loss-of-function plasmids, that is, plasmids for deleting or inactivating a target drug resistance gene in a recipient microorganism, include the above-described configurations (i) to (v) (gene / Including the base sequence).
The non-homologous recombinant gene loss-of-function plasmid used for conjugation transfer may be constructed based on any vector, and the kind thereof is not particularly limited. Examples of the vector to be used include pBR322, pSC101, pACYC184, pACYC177, pTrc99A, pUC18, pUC19, pUC118, pUC119, pHSG298, pHSG299, pSP64, pSP65, pGEM-3, pGEM-3Z, pGEM-3Zf (-), pGEM -4p, pGEM-4Z, pBluescript M13 +, pBluescript M13-, pK19mob, pK18mob, pK18mobsacB and the like. Among them, it is more preferable to use pK19mob, pK18mob, and pK18mobsacB (Schaefer et al., Gene, vol. 45, p. 69-73 (1994)) that already have oriT and mob derived from plasmid RP4 inside the plasmid.
In order to transfer the plasmid from the donor microorganism to the recipient microorganism, in addition to oriT, the mob gene and tra gene (s) are minimally required. mob is a gene encoding an oriT-specific nick enzyme, and when this enzyme acts on oriT, transfer from a donor microorganism to a recipient microorganism (a plasmid for loss of function of a heterologous recombination gene) is initiated. tra is a general term for a large number of gene groups, and is composed of gene groups involved in sex cilia formation, junction tube formation, and junction control. The mob gene and tra gene (s) are not necessarily on the plasmid for loss of function of the non-homologous recombination gene, but may be integrated in another plasmid (helper plasmid) or in the donor microbial genome (protein Nucleic acid enzyme, vol. 38, p. 60-68 (1993)).
In the production method of the present invention, the donor microorganism may be any microorganism that can be conjugated and transferred to the recipient microorganism, and is not limited. However, the donor microorganism needs to satisfy the minimum requirements for the conjugated transfer. For example, when the oriT, mob gene, and tra gene (s) are provided on the non-homologous recombinant gene loss-of-function plasmid to be used, it is not particularly limited as long as each can function, but it is used. When only the oriT is provided on the plasmid for loss of function of the heterologous recombination gene, it is necessary to use a microorganism having the mob gene and tra gene (s) corresponding to oriT. As a combination of a microorganism serving as a donor and a plasmid for loss of function of a heterologous recombination gene, for example, a combination of E. coli S17-1 and any one of pK19mob, pK18mob, and pK18mobsacB is preferable. The tra gene (group) derived from plasmid RP4 is provided on the genome of E. coli S17-1, and pK19mob, pK18mob, and pK18mobsacB are provided with oriT and mob genes derived from plasmid RP4 (as described above). E. coli S17-1 transformed with any of the species plasmids can be used as a donor microorganism.
Here, the sequence (i) is a base sequence including a heterologous recombination gene targeted in a Rhodococcus bacterium (to be modified) and a base sequence around the gene, and the gene is missing. This is a base sequence region that has been lost or inactivated. Deletion of the gene includes (1) deletion of a part or all of the non-homologous recombination gene encoded in the genome of the recipient microorganism, and (2) deletion of a part or all of the promoter sequence. (3) those in which a part or all of the genes related to the regulation of expression of heterologous recombination genes are deleted, etc., and these deleted regions may be single or A combination of two or more may be used. The inactivated gene includes (1) a heterologous recombination gene encoded in the genome of the recipient microorganism or a gene related to expression regulation of the gene, (2) a non-homologous recombination gene Alternatively, a gene that does not express its original function (heterologous foreign DNA introduction ability), for example, by introducing a foreign base sequence such as a drug resistance gene into a gene related to the regulation of the expression of the gene. Modified ones are listed. When performing inactivation by inserting a foreign base sequence at this time, the foreign sequence to be used is not limited as long as the gene can be brought into a state in which it is not normally expressed. Accordingly, it is not always necessary to encode any gene, but a recipient microorganism that does not significantly inhibit the growth of the microorganism is preferable.
Isolation (cloning) of the target non-homologous recombination gene and the base sequence around the gene from the genome of the recipient microorganism can be performed using known techniques such as gene library preparation and PCR.
Although the base sequence around the target non-homologous recombination gene is not limited, the longer the homologous region (base sequence around the target gene) with the Rhodococcus genome, the more efficiently homologous recombination occurs. Therefore, it is preferable to use a longer sequence as long as it does not interfere with cloning.
For example, the homologous region upstream and downstream of the gene is preferably a sequence containing a base sequence of 100 to 3000 bp, more preferably a sequence containing a base sequence of 500 to 2000 bp. The method for preparing the above (i) using the isolated base sequence is not particularly limited, and can be performed using a known technique such as PCR method or excision or replacement of a target gene portion using a restriction enzyme.
The deleted genes include those in which part or all of the target non-homologous recombination gene encoded in the genome of Rhodococcus bacteria has been deleted, or part or all of the promoter sequence has been deleted. In the case where a gene related to the regulation of the expression of the gene is present, a part or all of the gene may be deleted. These deleted regions may be used alone or in combination. Good.
Examples of inactivated genes include non-homologous recombination genes that are encoded in the genome of Rhodococcus bacteria or genes that are related to the regulation of expression of the gene, such as foreign DNA, such as drug resistance genes. Examples include those that have been introduced and modified into genes that do not express their original functions.
The junction transmission start region of (ii) is not particularly limited as long as it includes a base sequence serving as a junction transmission start point in the donor microorganism to be used. For example, a sequence containing a junction transfer initiation region derived from F plasmid, oriT derived from plasmid R6K, oriT derived from plasmid RP4 is preferable.
The replication initiation region (iii) is not particularly limited as long as it contains a base sequence that can function as a self-replication origin of the plasmid for loss of function of the heterologous recombination gene in the donor microorganism used. For example, it is preferable to use a region containing the replication origin derived from plasmid pMB1 and broad host range plasmid RK2, and derivatives thereof.
The recipient microbial growth inhibition marker (iv) is not particularly limited as long as it enables the acquisition of Rhodococcus bacteria into which a plasmid for loss of function of the heterologous recombination gene has been inserted after transformation. Examples of the recipient microorganism growth inhibition marker include drug resistance genes used for positive selection.
Examples of drug resistance genes include aminoglycoside antibiotic resistance genes, β-lactam antibiotic resistance genes, chloramphenicol antibiotic resistance genes, tetracycline antibiotic resistance genes, and trimethoprim resistant dihydroxyfolate reductase. .
Here, aminoglycoside antibiotic resistance genes include phosphotransferase gene groups such as aminoglycoside 3′-phosphotransferase, which is a kanamycin and neomycin resistance gene, and nucleotides such as aminoglycoside 3′-adenylyltransferase, which is a streptomycin resistance gene. Examples include a gill transferase gene group and an acetyltransferase gene group. Examples of β-lactam antibiotic resistance genes include β-lactamase genes. Examples of chloramphenicol antibiotic resistance genes include chloramphenicol acetyltransferase genes. Examples of tetracycline antibiotic resistance genes include transposon Tn10-derived tetracycline resistance genes.
When the recipient microorganism originally has the growth inhibition marker, the target recombinant strain (homologous recombinant strain) can be obtained by using a high-concentration drug that cannot acquire resistance only by the drug resistance gene of the recipient microorganism. ) Is also possible.
In addition, strains of the genus Rhodococcus that perform loss of function of heterologous recombination genes exhibit auxotrophy (for example, mutant strains that lack essential metabolic pathways, metabolic systems that assimilate specific carbon sources and / or nitrogen sources). In the case of a non-strain etc.), a gene (group) that complements the deletion of the strain can also be used as a selection marker. Typical nutritional requirements include amino acid requirements (amino acid biosynthesis pathway deficiency), nucleic acid requirements (nucleic acid biosynthesis pathway deficiency), vitamin requirements (vitamin biosynthesis pathway deficiency), and the like.
The conditional lethal gene of (v) is not limited as long as it is a gene that can be introduced into the genome of Rhodococcus bacteria and has the effect of causing the bacteria to die when exposed to certain conditions. For example, the sacB gene is preferable. The sacB gene is an enzyme that produces a harmful substance that has a lethal action on a microorganism when sucrose is cultured in a sucrose-containing medium (for example, Rhodococcus bacteria) that possesses and expresses the gene. A gene encoding sucrase. For some Gram-positive bacteria and Gram-negative bacteria, it is possible to efficiently select the target genetically modified cell line by eliminating the cell line introduced with the sacB gene in the presence of sucrose (negative selection). (Jagar W et al., Journal of bacteriology 1992; 5462-5465, Pelicic V et al., Journal of bacteriology 1996; 1197-1199). The reason why SacB gene expression imparts lethality to cells in the presence of sucrose has not been clarified.
Examples of genes encoding levansucrase other than the sacB gene include fefA gene (accession number: AJ508391, levansucrase derived from Lactobacillus sanfranciscensis), lev gene (accession number: Q8GGV4, levansucrase derived from Lactobacillus reuteri), mlft gene (accession number: AAT81165, Leuconostoc mesenteroides-derived levansucrase), lsc gene (accession number: O68609, Pseudomonas syringae-derived levansucrase), lsxA gene (accession number: BAA93720, Gluconacetobacter xylinus-derived levansucrase), etc. Even a gene encoding levansucrase can be used without being limited thereto.
The configurations of (i) to (v) in the heterologous recombination gene loss-of-function plasmid are not particularly limited with respect to the arrangement, and may be arranged in any order. The construction of the plasmid for loss of function of the non-homologous recombination gene including the structures (i) to (v) can be performed using a known gene recombination technique.
In the step (b), a non-homologous recombination gene loss-of-function plasmid having each of the above-described structures is introduced into a microorganism that is used as a donor to produce a transformed microorganism, that is, a donor microorganism that is used for conjugation transmission. At this time, as a transformation method, a method known as a transformation method for microorganisms, such as an electroporation method or a calcium chloride method, can be used.

2-3. Process (c)
In step (c), conjugation transfer from the donor microorganism obtained in step (b) to the recipient microorganism obtained in step (a) is performed. Usually, the cell suspensions of the donor microorganism and the recipient microorganism are mixed and spread uniformly on an appropriate plate medium (LB medium or the like) to allow the two microorganisms to be joined. In this conjugation, the plasmid for loss of function of the non-homologous recombination gene in the donor microorganism moves into the recipient microorganism, and homologous recombination occurs in the homologous sequence between the genome of the recipient microorganism and the above plasmid. Part or most of the plasmid for loss of gene function is introduced onto the genome of the recipient microorganism. By this conjugation, a transformant of the recipient microorganism, that is, a homologous recombinant strain is produced.
The desired homologous recombination strain in this step (c) is one in which the plasmid for loss of function of the non-homologous recombination gene is introduced upstream or downstream of the target gene by single crossover. Whether or not the desired homologous recombination strain is desired can be confirmed using the drug resistance of the recipient microorganism itself and the drug resistance derived from the plasmid for loss of function of the non-homologous recombination gene. Specifically, a desired homologous recombination strain can be selected by culturing the microorganism after conjugation in a medium containing both drugs (for example, a medium containing kanamycin and chloramphenicol).

2-4. Process (d)
In the step (d), the homologous recombination strain (homologous recombination microorganism) of the recipient microorganism prepared in the step (c) is cultured so that the conditionally lethal gene derived from the non-homologous recombination gene loss-of-function plasmid can function. Incubate under conditions. The culture conditions under which the conditional lethal gene can function are not particularly limited as long as the conditional lethal gene functions. For example, when the conditional lethal gene is the sacB gene, culture using a sucrose-containing medium is used.
In this culture, the homologous recombination microorganism having the conditionally lethal gene is difficult to grow, so the conditionally lethal gene, drug resistance gene, conjugation transfer initiation region, replication by the second homologous recombination from the genome of the microorganism. A Rhodococcus bacterium in which the base sequence region derived from the plasmid for loss of function of the heterologous recombination gene including the initiation region is removed (dropped out) can be obtained.
However, among the microorganisms obtained by the culture, the target non-homologous recombination gene in the recipient microorganism is deleted or inactivated as originally intended, and the target non-homologous recombinant gene is not In which the function of the original non-homologous recombination gene is restored). Therefore, usually, the genome is extracted from the obtained microorganism and the sequence around the heterologous recombination gene is analyzed to confirm the deletion or inactivation of the target heterologous recombination gene.

3. Further genetic modification of Rhodococcus bacteria in which the heterologous recombination gene has been deleted or inactivated Rhodococcus bacteria in which the heterologous recombination gene of the present invention has been deleted or inactivated are heterologous foreign DNA Rhodococcus genetically modified using homologous recombination that occurs at a high frequency by introducing a gene construct containing a sequence homologous to a part of the genome of the genus Rhodococcus due to loss of insertion ability A genus bacterium can be produced efficiently. The gene construct that can be used for this purpose is not particularly limited as long as it is a gene structure that contains a sequence homologous to a part of the genome of Rhodococcus bacteria and can be used for homologous recombination. For example, a plasmid that cannot autonomously replicate in Rhodococcus bacteria In which a sequence homologous to a part of the genome is incorporated. The gene structure can be prepared by a method well known to those skilled in the art. In particular, even when the gene construct is introduced by electroporation into a Rhodococcus bacterium in which the heterologous recombination gene has been deleted or inactivated, the heterologous recombination is suppressed and the homologous recombination occurs efficiently. Therefore, it is possible to easily and efficiently produce Rhodococcus bacteria in which heterologous recombination genes have been deleted or inactivated and genetically modified.
As used herein, “genetically modified Rhodococcus bacteria” refers to Rhodococcus bacteria that have been subjected to artificial genomic modification. Artificial genomic modifications that can be further performed in addition to deletion or inactivation of non-homologous recombination genes include disruption or deletion of endogenous genes present on the genome of the bacterium, and are not present on the genome Includes insertion or replacement of foreign DNA fragments. When the Rhodococcus bacterium mutant of the present invention is used, since the non-homologous recombination gene is deleted or inactivated, further artificial genome modification can be easily and efficiently performed. It becomes easy to modify the metabolic pathway to a more desirable state.
Examples of the alteration of the metabolic pathway include alteration of the metabolic pathway (improving the reaction rate) which is rate-limiting during the growth of microorganisms or the production of a desired substance. In this case, the enzyme encoding the enzyme that catalyzes the rate-limiting pathway is replaced with a more active enzyme gene to increase the enzyme activity, and the enzyme gene promoter is replaced with a stronger one to increase the amount of the enzyme in the living body. By introducing an enzyme gene that allows bypassing the rate-limiting pathway without passing through the rate-limiting pathway itself, and by designing a new metabolic pathway that does not pass through the rate-limiting pathway, the rate-limiting state of the pathway is changed. It can cancel | release and can accelerate | stimulate production at the time of growth or a desired substance.
Inhibition of the production of by-products generated simultaneously with the production of a desired substance is also an example of metabolic modification. For example, a gene encoding an enzyme that catalyzes a metabolic pathway involved in byproduct production can be deleted to suppress byproduct production.
The desired substance that can be produced using the microorganism of the present invention is not particularly limited, but preferably does not significantly inhibit the growth of the microorganism of the present invention. Examples of such desired substances include polymer compounds such as enzymes and polysaccharides, alcohols such as ethanol, propanol, and butanol, hydrocarbons such as hexane, decane, dodecane, and tetradecane, various amino acids, and their amino acids. Derivatives, nitriles, amides, carboxylic acids and the like are included.
Hereinafter, the present invention will be described more specifically by way of examples. However, the technical scope of the present invention is not limited to these examples. In this specification, “%” means “W / V”.

<Example 1>
Production of recipient PR4KS for junction transfer Rhodococcus erythropolis PR4 (Product Evaluation Technology Organization, Biological Genetic Resources Division; Accession Number: NBRC 100887) was modified by the method described in JP 2011-200133 A, A mutant strain resistant to 120 mg / L chloramphenicol and lacking the kanamycin resistance gene was prepared and named PR4KS strain.
Specifically, in order to strengthen chloramphenicol resistance, in MYK medium (0.5% polypeptone, 0.3% bact yeast extract, 0.3% malt extract, 0.2% KH ₂ PO ₄ , 0.2% K ₂ HPO ₄ ) While gradually increasing the concentration of chloramphenicol from 10 mg / mL to 120 mg / mL, it induces spontaneous mutation by subculturing PR4 strain and is resistant to 120 mg / mL chloramphenicol Mutant RhCm ^SR- 09 was obtained.
Next, the above RhCm ^SR- 09 strain was mixed and cultured at a ratio of 1: 1 with an Escherichia coli strain harboring the plasmid kKM043 for introducing a kanamycin resistance gene deletion mutation described in JP-A-2011-200133. After introducing pKM043 into the RhCm ^SR- 09 strain, MYK plates containing kanamycin sulfate 200 mg / L and chloramphenicol 50 mg / L (0.5% polypeptone, 0.3% bact yeast extract, 0.3% malt extract, 0.2% KH ₂ PO ₄ , 0.2% K ₂ HPO ₄ , 1.5% agar) was obtained to obtain a homologous recombination strain in which pKM043 was inserted into the RhCm ^SR- 09 strain genome. The homologous recombination strain was cultured on a MYK plate containing 10% sucrose to obtain a mutant strain that became a kanamycin sensitive strain from the obtained colonies, that is, a kanamycin resistance gene deletion mutant PR4KS strain.

Production of recipient J1-Cm for junction transfer Rhodococcus rhodochrous J1 strain (Accession number: FERM BP-1478, deposited at the National Institute of Advanced Industrial Science and Technology, Patent Organism Depositary), Chlorampheni A mutant strain of J1 strain having call resistance was obtained by the following method and designated as J1-Cm strain.
The MYK plate containing 2 mg / l chloramphenicol was inoculated with the J1 strain and incubated at 30 ° C. until colonies grew. About 2 weeks later, the chloramphenicol resistant strain that had grown was inoculated again on a MYK plate containing 2 mg / l chloramphenicol and incubated at 30 ° C.
Next, colonies grown from MYK plates containing 2 mg / l chloramphenicol were inoculated into MYK plates containing 5 mg / l chloramphenicol and kept at 30 ° C until chloramphenicol resistant strains appeared. Keep warm. Thereafter, the same operation was repeated with the chloramphenicol concentration increased to 10 mg / l to obtain a chloramphenicol resistant strain (J1-Cm strain) that grew at a chloramphenicol concentration of 10 mg / l.

<Example 2>
Cloning of LigD homolog gene and construction of plasmid for gene deletion
The LigD homologue gene (accession no: YP_002767969) of PR4KS strain was used as a target gene. After amplification of about 5.4 kb DNA containing the peripheral sequence of the LigD gene by PCR, the plasmid described in JP2011-200133 was cloned into the plasmid vector pK19mobsacB1 into which the sacB gene was introduced downstream and in the same direction of the kanamycin resistance gene, pTJ001 was obtained. PCR conditions are as follows.
Primer:
GB-138: 5'-GGCCTGCAGGTACCGATCATCACCATCGGTGTC -3 '(SEQ ID NO: 3)
GB-139: 5'-GGTCTAGACTGAGCAGTGTTCCAATGCG-3 '(SEQ ID NO: 4)

Reaction solution composition:
Sterile water 22 μl
2 x PrimeSTAR (Takara Bio) 25 μl
GB-138 (SEQ ID NO: 3) 1 μl
GB-139 (SEQ ID NO: 4) 1 μl
PR4KS genome (50 ng / μl) 1 μl
Total volume 50 μl
Temperature cycle:
35 cycles of reaction at 98 ° C for 10 seconds, 55 ° C for 10 seconds and 72 ° C for 120 seconds
A LigD homolog gene deletion plasmid pTJ002 in which the entire length of LigD homolog gene (about 2.3 kb) in pTJ001 was deleted and only the upstream and downstream sequences of the LigD homolog gene remained was prepared (see FIG. 1). pTJ002 contains both the sequence near the start codon and the sequence near the stop codon of the target LigD homolog gene, primer GB-140 designed to extend upstream from the start codon or downstream from the stop codon, respectively. It was obtained by transforming Escherichia coli JM109 strain with a PCR product containing no LigD homolog gene obtained by amplifying the sequence inside pTJ001 with GB-141, and making it circular DNA.
PCR conditions are as follows.
Primer:
GB-140: 5'-GAGGAAATGGTCACAGGGCGAGAATAGGTTG-3 '(SEQ ID NO: 5)
GB-141: 5'-GCCCTGTGACCATTTCCTCATTGTGCTGG-3 '(SEQ ID NO: 6)
Reaction solution composition:
Sterile water 22 μl
2 x PrimeSTAR (Takara Bio) 25 μl
GB-140 (SEQ ID NO: 5) 1 μl
GB-141 (SEQ ID NO: 6) 1 μl
pTJ001 (1 ng / μl) 1 μl
Total volume 50 μl
Temperature cycle:
30 cycles of reaction at 98 ° C for 10 seconds, 50 ° C for 10 seconds, and 72 ° C for 180 seconds In the above procedure for producing plasmid pTJ002, the Wizard Genomic DNA Purification Kit (Promega) was cleaved with restriction enzymes for genome extraction from PR4 strain. Gel / PCR Purification Kit (manufactured by FAVORGEN) is used to purify DNA fragments and PCR products, DNA Ligation Kit <Mighty Mix> (manufactured by Takara Bio) is used to connect DNA, and QIAprep miniprep is used to extract plasmids. kit (manufactured by QIAGEN) was used.

<Example 3>
Preparation of PR4KS LigD homolog gene deletion strain Japanese Patent Application Laid-Open No. 2011-200133 using Escherichia coli S17-1λpir transformed with pTJ002 as a donor and PR4KS obtained by the method of Example 1 as a recipient Conjugation transfer was performed in the same manner as described in the publication, and 13 ligD gene-deficient strains produced by homologous recombination were obtained. One strain was selected from the deletion strains and named PR4KSΔLigD strain.

<Example 4>
Improvement of homologous recombination frequency in PR4KSΔLigD strain In order to demonstrate that gene modification by homologous recombination can be easily carried out by using the Rhodococcus bacterium mutant of the present invention, the following experiment was conducted.
Isocitrate lyase (ICL) (accession no: YP_002765021) was selected as the target gene to be destroyed. Based on the PR4 genome sequence information, the ICL gene partial sequence was amplified by PCR using the genome extracted from the PR4KS strain as a template, and the amplified gene was cloned into pK19mobsacB1.
Primers GB-208 (SEQ ID NO: 7) and GB-211 (SEQ ID NO: 10) or GB-209 (SEQ ID NO: 8) and GB-210 (with a HindIII site added, using a genome extracted from the PR4KS strain as a template An ICL gene partial sequence of about 0.8 kb or about 0.4 kb was amplified by PCR using SEQ ID NO: 9). Amplification conditions are as follows.
Primer:
GB-208: 5'-GG AAGCTT ACCGGCAACATGGCTGTG -3 '(SEQ ID NO: 7)
GB-209: 5'-GG AAGCTT CGGTGGCGCTCTCAACGC -3 '(SEQ ID NO: 8)
GB-210: 5'-GG AAGCTT CTTTGCAACCTCGAGATC -3 '(SEQ ID NO: 9)
GB-211: 5'-GG AAGCTT CTGGAACTTCGCGATGGTC-3 '(SEQ ID NO: 10)
Reaction solution composition:
Sterile water 22 μl
2 x PrimeSTAR (Takara Bio) 25 μl
GB-208 (SEQ ID NO: 7) or GB-209 (SEQ ID NO: 8) 1 μl
GB-210 (SEQ ID NO: 9) or GB-211 (SEQ ID NO: 10) 1 μl
PR4KS genome (50 ng / μl) 1 μl
Total volume 50 μl
Temperature cycle:
35 cycles of reaction at 98 ° C for 10 seconds, 55 ° C for 10 seconds and 72 ° C for 120 seconds
After digesting two ICL gene partial sequences with restriction enzyme HindIII (manufactured by TAKARA BIO INC.), Connecting to pK19mob digested with the same enzyme, plasmid pTJ007 (from 470 bp to 888 bp of ICL gene), pTJ008 (ICL PTJ009 (including 214 to 1002 bp of ICL gene) was constructed (Fig. 2). pTJ007 and pJT008 have the same ICL gene fragment inserted, but are inserted in different directions. In each plasmid production procedure, the kits described in Example 2 were used.
Cells in the logarithmic growth phase of PR4KS strain and PR4KSΔligD strain were collected by a centrifugal separator, washed three times with ice-cooled sterilized water, and suspended in sterilized water to prepare competent cells. 20 μl of competent cells of both strains and 1 μl of plasmids pTJ007, pTJ008, and pTJ009 (all 1 ng / μl) were mixed and ice-cooled. Each mixed solution was put in a cuvette for a gene introduction device Gene Pulser (BIO RAD), and electric pulse treatment was performed at 20 KV / cm, 200 OHMS using a Gene Pulser. After electric pulse treatment, add 500 μl of LB medium (1% bact tryptone, 0.5% bact yeast extract, 1% NaCl) to the cuvette and let stand at 30 ° C. for 5 hours, then LB agar containing kanamycin sulfate 50 mg / L It was applied to the medium and cultured at 30 ° C. for 3 days.
Two colonies obtained were selected and the genome was extracted from each transformed strain. PCR was performed using the extracted genome as a template, and it was confirmed whether pTJ007, pTJ008, and pTJ009 were inserted into the target ICL gene. Amplification conditions are as follows.
Primer:
GB-60: 5'-CGTAGGAATCTTCACAGAC-3 '(SEQ ID NO: 11)
GB-216: 5'-GGCCAGCGTGATGAACTGGAACTTG-3 '(SEQ ID NO: 12)
Reaction solution composition:
Sterile water 22 μl
2 x PrimeSTAR (Takara Bio) 25 μl
GB-60 (SEQ ID NO: 11) 1 μl
GB-216 (SEQ ID NO: 12) 1 μl
1 μl of each transformant genome
Total volume 50 μl
Temperature cycle:
30 cycles of reaction at 98 ° C for 10 seconds, 50 ° C for 10 seconds and 72 ° C for 180 seconds
The results of PCR are shown in FIG. When pTJ007, pTJ008, and pTJ009 are inserted into the ICL gene (when homologous recombination occurs), a DNA fragment of approximately 5.4 kb (insert pTJ007 and pTJ008) or approximately 5.8 kb (insert pTJ009) is amplified and inserted. When this does not occur, a DNA fragment of about 1.2 kb is amplified. When the ACE01 and ACE02 genomes were used as templates, a DNA fragment of about 1.2 kb was amplified, which was the same result as when the PR4KS strain was used. That is, when the ICL disruption plasmid pTJ007 was introduced into a host in which LigD was not deleted, plasmid insertion into the ICL gene on the genome did not occur. In contrast, when the ACE03, ACE04, ACE05, and ACE06 genomes were used as templates, an approximately 5.4 kb DNA fragment was amplified, and when the ACE07 and ACE09 genomes were used, an approximately 5.8 kb DNA fragment was amplified. When PR4KSΔLigD was used as a template, a DNA fragment of about 1.2 kb was amplified as in the case of using PR4 strain. That is, when a plasmid containing the ICL gene (non-replicating type) was introduced into a host lacking LigD, plasmid insertion into the ICL gene on the genome occurred. Therefore, it is considered that the homologous recombination of the target gene was facilitated by the deletion of the LigD gene.

<Example 5>
Inhibition of heterologous foreign DNA insertion by deletion of LigD homolog gene
In the PR4KSΔLigD strain, it was confirmed whether transformation with linear DNA (non-replicating DNA) having no homologous sequence with the genome, that is, non-homologous foreign DNA insertion into the genome occurred. As DNA that does not have a homologous sequence with the PR4KSΔLigD strain genome, the DNA fragment MK09 containing the kanamycin resistance gene and the plasmid replication initiation region (functional in E. coli) prepared using pK19B described in JP-A-2011-223925 as a template is used. did. The PR4KS strain was used as a control strain, and pK4 (Japanese Patent Laid-Open No. 05-064589, Rhodococcus ATCC12674 / pK4: Former Industrial Technology Research Institute / Kikenkenjo No. 3731) was used as a plasmid for confirming transformation efficiency. Transformation was carried out by electroporation as in Example 4.
As a result, although both strains had transformation efficiency comparable to that of plasmid pK4, no colonies appeared in the PR4KSΔLigD strain when MK09 was used. Since 282 colonies appeared in the PR4KS strain, it was found that deletion of the LigD homolog gene decreased the heterologous foreign DNA insertion rate to the genome by two orders of magnitude (Table 1).

Table 1: Transformation efficiency of PR4KS strain and PR4KSΔLigD strain by pK4 or MK09 (cfu / μg DNA)

<Example 6>
Cloning of LigD homolog gene and construction of plasmid for gene deletion
1) Preparation of chromosomal DNA of J1-Cm strain Rhodococcus rhodochrous J1-Cm strain (J1-Cm strain) was cultured in 100 ml of MYKG medium with shaking at 30 ° C for 72 hours.
After culturing, the cells were collected, and the collected cells were suspended in 4 ml of Saline-EDTA solution (0.1 M EDTA, 0.15 M NaCl (pH 8.0)). 40 mg of lysozyme was added to the suspension, shaken at 37 ° C. for 1 to 2 hours, and then frozen at −20 ° C.
Next, 10 ml of Tris-SDS solution (1% SDS, 0.1 M NaCl, 0.1 M Tris-HCl (pH 9.0)) was added while gently shaking, and proteinase K (Merck) (10 mg / ml) was added. 10 μl) was added and shaken at 37 ° C. for 1 hour.
Next, an equal amount of TE (10 mM Tris-HCl, 1 mM EDTA (pH 8.0)) saturated phenol was added, stirred and centrifuged. After collecting the upper layer and adding twice the amount of ethanol, the DNA was wound up with a glass rod, and phenol was sequentially removed with 90%, 80%, and 70% ethanol.
Next, DNA was dissolved in 3 ml of TE buffer, ribonuclease A solution (100 ° C., heat-treated for 15 minutes) was added to 10 μg / ml, and shaken at 37 ° C. for 30 minutes. Furthermore, after adding proteinase K and shaking at 37 ° C. for 30 minutes, an equal amount of TE saturated phenol was added and centrifuged to separate the upper layer and the lower layer.
After repeating this operation twice for the upper layer, the same amount of chloroform (containing 4% isoamyl alcohol) was added, and the same extraction operation was repeated. Thereafter, twice the amount of ethanol was added to the upper layer, and the DNA was wound up and collected with a glass rod to obtain a chromosomal DNA preparation.

2) Cloning of a fragment containing the LigD homolog gene
Primers for amplifying LigD gene of J1-Cm strain by PCR were designed by the following method.
FIG. 4 shows the results of amino acid homology analysis of ATP dependent DNA ligase produced by Rhodococcus bacteria. In FIG. 4, two conserved regions were selected and degenerate primers of SEQ ID NO: 23 and SEQ ID NO: 24 were designed. Using the chromosomal DNA prepared in 1) as a template, degenerate PCR was performed under the following conditions. Carried out. As a result, amplification of a band of about 1.4 kb was confirmed.
Reaction solution composition
Template DNA (J1-Cm chromosomal DNA) 1 μl
10 × Ex Buffer (Takara Bio) 10 μl
150 μM primer DG-01 (SEQ ID NO: 23) 1 μl
150 μM primer DG-02 (SEQ ID NO: 24) 1 μl
2.5 mM dNTP 8 μl
DMSO 10 μl
Sterile water 18 μl
ExTaq DNA polymerase (Takara Bio) 1 μl
Total volume 50 μl
Temperature cycle: 94 ° C for 30 seconds, 65 ° C for 30 seconds and 72 ° C for 1 minute for 30 cycles Primer:
DG-01: 5'-ggccarcargcngcnctsgar-3 '(SEQ ID NO: 23)
DG-02: 5'- ggyttscgsagsaggctsacgcc-3 '(SEQ ID NO: 24)
In the primers, r represents a purine base (puRine), s represents a guanine or cytosine (Strong interactions), and y represents a pyrimidine base (pYrimidine).
Next, direct sequencing of the amplified sequence was performed using primers (DG-01 and DG-02) used in PCR. As a result, the sequence shown in SEQ ID NO: 25 was obtained, and as a result of homology search, homology with the aforementioned ATP dependent DNA ligase was confirmed.

3) Genomic Southern hybridization
Southern hybridization using a probe prepared by the following method to J1-Cm chromosomal DNA digested with ApaI, ApaLI, BamHI, ClaI, Eco52I, EcoT14I, KpnI, MluI, NcoI, NotI, PvuI, SacI, XbaI. As a result, a single signal of about 6.4 kb was obtained from the fragment digested with ApaI.
The probe was prepared as follows.
The PCR product prepared in 2) was purified using the GFX PCR DNA band and Gel Band Purification kit (GE Healthcare Bioscience). The purified PCR product was labeled using the AlkPhos Direct Labeling kit (GE Healthcare Bioscience) according to the attached manual.

4) Colony hybridization
The J1-Cm chromosomal DNA was digested with the restriction enzyme ApaI and separated by 0.7% agarose gel electrophoresis, and the gel was purified using the GFX PCR DNA band and Gel Band Purification kit (GE Healthcare Bioscience). Fragments were collected. The obtained fragment was ligated to pBluescriptII SK (+) vector (Stratagene) using DNA ligation kit <Mighty mix> (Takara Bio). The reaction conditions are as follows.
Reaction solution composition:
ligation mighty mix (Takara Bio) 5 μl
J1-Cm chromosomal DNA / ApaI fragment 4 μl
pBluescriptII SK (+) / ApaI cleavage fragment 1 μl
Total volume 10 μl
reaction:
16 ° C., 1 hour The total amount of the ligation product was added to 200 μl of E. coli JM109 strain competent cell, and left at 0 ° C. for 30 minutes. Subsequently, the competent cell was subjected to a heat shock at 42 ° C. for 45 seconds and cooled at 0 ° C. for 2 minutes. Then, 1 ml of SOC medium (20 mM glucose, 2% bactotryptone, 0.5% bacto yeast extract, 10 mM NaCl, 2.5 mM KCl, 1 mM MgSO ₄ , 1 mM MgCl ₂ ) was added, and 1 ml at 37 ° C. Cultured with shaking. 200 μl of the culture solution after the culture was applied to an LB AIX plate (LB agar medium containing 100 μg / l ampicillin, 100 μM IPTG, 50 μg / l X-gal) and left at 37 ° C. overnight. White recombinant colonies grown on the plates were isolated on a new LB AIX plate for 94 plates per plate and 10 plates. Each plate was inoculated with 2 colonies / plate of JM109 strain transformed with pBluescriptII SK (+) containing no insert. The colony-isolated plate was allowed to stand at 37 ° C. overnight, and then the colony was copied onto a Hybond-N ⁺ (GE Healthcare Bioscience) membrane, and colony hybridization was performed using the probe prepared in 3).
A culture solution obtained by culturing the detected colonies was collected, and then the recombinant plasmid was recovered using QIAprep miniprep kit (manufactured by QIAGEN). Using a capillary DNA sequencer CEQ2000 (manufactured by Beckman Coulter), the base sequence of the chromosomal DNA fragment cloned in the plasmid was analyzed according to the attached manual. As a result, the base sequence represented by SEQ ID NO: 26 was obtained. In the nucleotide sequence shown in SEQ ID NO: 26, the 2493 bp open reading frame (ORF1) shown in SEQ ID NO: 22 was found. Since the amino acid sequence encoded by ORF1 has 62% to 95% homology to the ATP dependent DNA ligase derived from Rhodococcus bacteria shown in FIG. 4, ORF1 encodes ATP dependent DNA ligase. Therefore, the ATP dependent DNA ligase encoded by ORF1 was named J1 ATP dependent DNA ligase. Further, the obtained plasmid containing ORF1 was named pBJ1LigD.

5) Preparation of plasmid for deletion of J1 ATP dependent DNA ligase (LigD) gene
About 4.2 kb of DNA containing the sequence around the LigD gene of J1 bacteria was amplified by PCR and then cloned into the plasmid vector pK19mobsacB1 described in JP-A 2011-200133 in which the sacB gene was introduced downstream and in the same direction as the kanamycin resistance gene Plasmid pK19ligD was obtained. PCR conditions are as follows.
Primer:
GB-224: 5'-GGTCCTGCAGGCCGTTGAGATACGCCTCG-3 '(SEQ ID NO: 27)
GB-225: 5'- GGTTCTAGAGATATCCGATCGCGACGAATC -3 '(SEQ ID NO: 28)
Reaction solution composition:
Sterile water 22 μl
2 x PrimeSTAR (Takara Bio) 25 μl
GB-224 (SEQ ID NO: 27) 1 μl
GB-225 (SEQ ID NO: 28) 1 μl
J1-Cm chromosomal DNA 1 μl
Total volume 50 μl
Temperature cycle:
35 cycles of reaction at 98 ° C for 10 seconds, 55 ° C for 10 seconds and 72 ° C for 120 seconds
A LigD homolog gene deletion plasmid pK19ΔligD was prepared by deleting the entire length of the LigD homolog gene (about 2.5 kb) inside pK19ligD and leaving only the upstream and downstream sequences of the LigD homolog gene. pK19ΔligD contains both a sequence near the start codon and a sequence near the stop codon of the target LigD homolog gene, and primer GB-226 designed to extend upstream from the start codon or downstream from the stop codon, respectively. It was obtained by transforming Escherichia coli JM109 strain with a PCR product not containing the LigD homolog gene obtained by amplifying the sequence inside pK19ligD with GB-227 and making it circular DNA.
PCR conditions are as follows.
Primer:
GB-226: 5'- GTCGGACCCTCTGCTAACGTTCGTCCGAAG -3 '(SEQ ID NO: 29)
GB-227: 5'-ACGTTAGCAGAGGGTCCGACTCCCGACGCG-3 '(SEQ ID NO: 30)
Reaction solution composition:
Sterile water 22 μl
2 x PrimeSTAR (Takara Bio) 25 μl
GB-226 (SEQ ID NO: 29) 1 μl
GB-227 (SEQ ID NO: 30) 1 μl
pK19ligD (1 ng / μl) 1 μl
Total volume 50 μl
Temperature cycle:
30 cycles of reaction at 98 ° C for 10 seconds, 50 ° C for 10 seconds and 72 ° C for 180 seconds Gel / PCR Purification Kit (manufactured by FAVORGEN) for purification of DNA fragments and PCR products cleaved with restriction enzymes in the above plasmid pK19ΔligD production procedure The DNA Ligation Kit <Mighty Mix> (manufactured by Takara Bio Inc.) was used for connecting DNAs, and the QIAprep miniprep kit (manufactured by QIAGEN) was used for plasmid extraction.

<Example 7>
Preparation of a J1-Cm LigD homolog gene deletion strain and its derivative strain J1-Cm obtained by the method of Example 1 was used as a donor using Escherichia coli S17-1λpir transformed with pK19ΔligD. As a result, conjugation transfer was performed in the same manner as described in JP 2011-200133 A, and two ligD gene deletion strains resulting from homologous recombination were obtained. One strain was selected from the deletion strains and named J1-CmΔLigD strain.
Next, E. coli S17-1λpir was transformed with the plasmid pK19ΔR for deletion of the restriction enzyme RrhJ1I gene of J1 prepared by the method described in JP2013-5792A, and the obtained transformant was used as a donor. J1-CmΔLigD strain was used as a recipient for conjugation transfer in the same manner as described above to obtain three RrhJ1I gene deletion strains generated by homologous recombination. One strain was selected from the deletion strains and designated as J1-CmΔLigDΔR strain.

<Example 8>
Homologous recombination by electroporation and gene deletion in the J1-CmΔLigDΔR strain In order to demonstrate that genetic modification by homologous recombination can be easily performed by using the Rhodococcus bacterium mutant of the present invention, the following experiment was conducted. Went.
Nitrile hydratase (NHase) was selected as the target gene to be deleted. In order to obtain a region including the upstream and downstream portions of the NHase gene, the chromosomal DNA extracted from the J1-Cm strain was amplified by PCR using the template, and the amplified gene was cloned into pK19mobsacB1.
Chromosomal DNA extracted from J1-Cm strain is used as a template, primers NH-121 (SEQ ID NO: 31) and NH-122 (SEQ ID NO: 32), or NH-123 (SEQ ID NO: 33) and NH-124 (SEQ ID NO: Each of the sequences around the NHase gene of about 1.8 kb was amplified by PCR using (34). Amplification conditions are as follows.
Primer:
NH-121: 5'-GGCCTGCAGGagctgctgacgatgttcatcc -3 '(SEQ ID NO: 31)
NH-122: 5'-tcttcgctgattcctcattcctttcatcgg -3 '(SEQ ID NO: 32)
NH-123: 5'-gaatgaggaatcagcgaagatgagatccgc-3 '(SEQ ID NO: 33)
NH-124: 5'- CCTCTAGAtggcacgactgatcgatgcc -3 '(SEQ ID NO: 34)
Reaction solution composition:
Sterile water 22 μl
2 x PrimeSTAR (Takara Bio) 25 μl
NH-121 (SEQ ID NO: 31) 1 μl
NH-122 (SEQ ID NO: 32) 1 μl
J1-Cm chromosomal DNA 1 μl
Total volume 50 μl
Or
Sterile water 22 μl
2 x PrimeSTAR (Takara Bio) 25 μl
NH-123 (SEQ ID NO: 33) 1 μl
NH-124 (SEQ ID NO: 34) 1 μl
J1-Cm chromosomal DNA 1 μl
Total volume 50 μl
Temperature cycle:
35 cycles of reaction at 98 ° C for 10 seconds, 55 ° C for 10 seconds and 72 ° C for 120 seconds
After completion of PCR, 2 μl of the reaction solution was subjected to 0.7% agarose gel electrophoresis, and PCR products of about 1.8 kbp were detected for each. After confirming the PCR product, the reaction solution was purified with GFX PCR DNA band and GelBand Purification kit (Amersham Biosciences).
Next, assembly PCR was performed under the following conditions in order to link the two amplified PCR fragments.
Reaction solution composition:
Template DNA1 (NH-121 and NH-122 amplification product) 0.5 μl
Template DNA2 (NH-123 and NH-124 amplification product) 0.5 μl
Primer NH-121 (SEQ ID NO: 31) 1 μl
Primer NH-124 (SEQ ID NO: 34) 1 μl
Sterile water 22 μl
2 x PrimeSTAR Max (Takara Bio Inc.) 25 μl
Total volume 50 μl
Temperature cycle:
30 cycles of reaction at 98 ° C for 10 seconds, 55 ° C for 5 seconds and 72 ° C for 20 seconds
After completion of PCR, an amplification product of about 3.6 kbp was confirmed by 0.7% agarose electrophoresis, and ligated to pUC118 using Mighty Cloning Kit (Blunt End) (manufactured by Takara Bio Inc.). The plasmid thus obtained was named pUC118 / ΔNH.
Subsequently, the plasmid pUC118 / ΔNH and the plasmid vector pK19mobsacB1 were cleaved with restriction enzymes XbaI and Sse8387I.
Reaction solution composition 1:
Plasmid pUC118 / ΔNH 20 μl
XbaI (Takara Bio) 1 μl
Sse8387I (Takara Bio Inc.) 1 μl
10 × M Buffer (attached to the enzyme) 5 μl
10 x BSA (attached to the enzyme) 5 μl
Sterile water 18 μl
Total volume 50 μl

Reaction solution composition 2:
Plasmid pK19mobsacB1 5 μl
XbaI (Takara Bio Inc.) 0.5 μl
Sse8387I (Takara Bio Inc.) 0.5 μl
10 x M Buffer (attached to the enzyme) 2 μl
10 x BSA (attached to the enzyme) 2 μl
Sterile water 10 μl
Total volume 20 μl
reaction:
After completion of the reaction at 37 ° C for 2.5 hours, the plasmid pUC118 / ΔNH was subjected to 0.7% agarose gel electrophoresis to cut out an approximately 3.6 kb fragment. GFX PCR DNA band and GelBand Purification kit (Amersham Biosciences) To obtain ΔNH / XbaI-Sse8387I.
For the plasmid vector pK19mobsacB1, 2 μl of 3 M sodium acetate and 50 μl of 99.5% ethanol were added to the reaction mixture, mixed well, and cooled at −20 ° C. for 1 hour. The cooled solution was centrifuged at 15,000 rpm, 4 ° C. for 10 minutes to remove the supernatant, and the solvent was removed by drying under reduced pressure. Thereafter, 50 μl of sterilized water was added to the dried pellet and dissolved again to obtain a vector solution of pK19mobsacB1 / XbaI-Sse8387I.

Next, the recovered ΔNH fragment was ligated with the vector pK19mobsacB1 / XbaI-Sse8387I.
Reaction solution composition:
Ligation mighty mix (Takara Bio Inc.) 5 μl
ΔNH / XbaI-Sse8387I 4 μl
pK19mobsacB1 / XbaI-Sse8387I 1 μl
Total volume 10 μl
reaction:
After completion of the reaction at 16 ° C. for 1 hour, E. coli strain JM109 was transformed with the reaction product to obtain an NHase gene-deleted plasmid. This plasmid was named pBKNH01. Next, Escherichia coli SCS110 strain (manufactured by Stratagene) was transformed with the plasmid pBKNH01, and a plasmid was prepared from the obtained colonies.
Next, 20 μl of J1-CmΔligDΔR competent cell prepared by the method described below and 1 μl of plasmid pBKNH01 (1 ng / μl) prepared from E. coli SCS110 were mixed and ice-cooled. The mixed solution was placed in a cuvette for a gene transfer device Gene Pulser (BIO RAD), and electroporated using Gene Pulser under application conditions of 1.5 kV, 400Ω, and 25 μF. Then, it was left on ice for 10 minutes, and then left at 37 ° C. for 10 minutes. 0.5 ml of MYK liquid medium was added to the cuvette and mixed well. The whole suspension was transferred to a Φ10 × 105 mm Wasselman test tube and shaken overnight at 30 ° C. and 180 rpm for reincubation. The whole culture solution after reversion culture was applied to MYK agar medium (containing 10 mg / l kanamycin) and cultured at 30 ° C. for 3 days.
One obtained colony was selected and suspended in sterilized water, and the suspension was appropriately diluted and applied to a MYK plate containing 10% sucrose, and allowed to stand at 30 ° C. Colony PCR was performed on 10 grown colonies, and the size of the PCR fragment was examined by electrophoresis.
Reaction solution composition:
Primer NH-121 (SEQ ID NO: 31) 0.2 μl
Primer NH-124 (SEQ ID NO: 34) 0.2 μl
Sterile water 4.1 μl
2 x PrimeSTAR Max (Takara Bio Inc.) 5 μl
Total volume 10 μl
Temperature cycle:
30 cycles of reaction at 98 ° C. for 10 seconds, 55 ° C. for 5 seconds, and 72 ° C. for 35 seconds. As a result, it was confirmed that NHase gene was deleted in 10 colonies. The results of PCR are shown in FIG. In FIG. 5, Lane M is a molecular weight marker, and Lane P and Lane G are amplification patterns using plasmid pBKNH01 and J1-Cm chromosomal DNA as templates (Lane P is about 3.6 kb, Lane G is about 5.7 kb). . When the NHase gene is deleted (homologous recombination occurs by introduction of pBKNH01 by electroporation, and subsequent selection with 10% sucrose results in a homologous group between the NHase peripheral sequence on pBKNH01 and the NHase peripheral sequence on the genome. When the NHase gene and the vector part are lost), a DNA fragment of about 3.6 kb is amplified, and when the NHase gene is not deleted (the introduction of pBKNH01 by electroporation causes homologous recombination. In the subsequent selection with 10% sucrose, homologous recombination occurs between the NHase peripheral sequence on pBKNH01 and the NHase peripheral sequence on the genome, and the NHase peripheral sequence and the vector part are lost)). A kb DNA fragment is amplified. As a result of colony PCR, it was found that a DNA fragment of about 3.6 kb was amplified and the NHase gene was deleted (FIG. 5, Lane 1 to 10). That is, when the NHase deletion plasmid pBKNH01 was introduced into a host lacking LigD by electroporation, it was shown that homologous recombination with the NHase gene peripheral sequence on the genome occurred. Therefore, it is considered that the homologous recombination of the target gene by electroporation has been facilitated by the deletion of the LigD gene.

A competent cell of the J1-CmΔligDΔR strain was prepared by the following method.
Dispense 10 ml of MYKG medium (0.5% polypeptone, 0.3% bactoeast extract, 0.3% malt extract, 0.2% KH ₂ PO ₄ , 0.2% K ₂ HPO ₄ , 1% glucose) into a Φ24 mm x 165 mm test tube. Each test tube was inoculated with a colony of J1-CmΔligDΔR strain. After culturing at 30 ° C and 350 rpm for 1 day, inoculate 3 ml of each of the obtained cultures into MYKG-20% Sucrose medium (100 ml in a 500 ml Erlenmeyer flask), and 30 hours at 30 ° C and 230 rpm. Cultured. The obtained culture solution was transferred to a tube having a total volume of 50 ml, and each bacterial cell was collected by centrifugation (5000 rpm, 10 minutes, 4 ° C.). Each collected bacterial cell is washed twice with 10 ml of Electroporation Buffer (2 mM K ₂ HPO ₄ , 10% sucrose, pH 8.3; hereinafter abbreviated as EB), so that the bacterial concentration becomes the same. Each was suspended in EB and frozen at −80 ° C. to prepare competent cells.

Claims (6)

  A Rhodococcus bacterium mutant in which a gene encoding a protein involved in heterologous foreign DNA insertion into the genome is deleted or inactivated. 2. The Rhodococcus bacterium mutant according to claim 1, wherein the protein involved in heterologous foreign DNA insertion into the genome is any one of proteins (a) to (f):
(A) a protein comprising the amino acid sequence represented by SEQ ID NO: 1 (b) including an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 1, and A protein having a function involved in heterologous foreign DNA insertion into the genome (c) a protein comprising an amino acid sequence having 60% or more homology with the protein comprising the amino acid sequence represented by SEQ ID NO: 1, and Protein (d) having the function involved in heterologous foreign DNA insertion into the genome (d) Protein consisting of the amino acid sequence represented by SEQ ID NO: 21 (e) One or several amino acids in the amino acid sequence represented by SEQ ID NO: 21 Contains a deletion, substitution or addition amino acid sequence and has a function involved in heterologous insertion of foreign DNA into the genome (F) A protein comprising an amino acid sequence having 60% or more homology with the protein comprising the amino acid sequence represented by SEQ ID NO: 21, and having a function involved in heterologous foreign DNA insertion into the genome Protein. The Rhodococcus spp. Mutant according to claim 1 or 2, wherein the gene encoding the protein involved in heterologous foreign DNA insertion into the genome is encoded by the DNA of any one of (a) to (d):
(A) DNA containing the base sequence represented by SEQ ID NO: 2
(B) a protein that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 2 and has a function involved in heterologous insertion of foreign DNA into the genome DNA encoding
(C) DNA containing the base sequence represented by SEQ ID NO: 22
(D) a protein that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 22 and has a function involved in heterologous insertion of foreign DNA into the genome DNA encoding   The Rhodococcus genus Rhodococcus is a Rhodococcus rhodochrous, Rhodococcus erythropolis, Rhodococcus pyridinobolans, Rhodococcus opacus, Rhodococcus josti, Rhodococcus imtekensis, Rhodococcus equi. Bacterial mutant.   A genetically modified Rhodococcus genus comprising introducing a gene construct containing a sequence homologous to at least part of the genome of the mutant strain into the Rhodococcus bacterium mutant according to any one of claims 1 to 4. A method for producing bacteria.   A method for facilitating modification of a target gene of a genus Rhodococcus, comprising deleting or inactivating a gene encoding a protein involved in heterologous foreign DNA insertion into a genome.