KR100953104B1 - A Novel plasmid from Leuconostoc sp. and Shuttle Vector comprising the plasmid - Google Patents

Abstract

The present invention relates to a novel plasmid derived from leuconosstock and a shuttle vector prepared using the same. More specifically, the plasmid pCB42 isolated from leuconosstock known as the dominant species of lactic acid fermented food is capable of mutual replication in Escherichia coli. It relates to producing a shuttle vector.

Shuttle vector, leukono stock, coliform

Description

Novel plasmids derived from leukonostock and shuttle vectors comprising the same {A Novel plasmid from Leuconostoc sp. and Shuttle Vector comprising the plasmid}

The present invention relates to a novel plasmid derived from leuconosstock and a shuttle vector prepared using the same. More specifically, the plasmid pCB42 isolated from leuconosstock known as the dominant species of lactic acid fermented food is capable of mutual replication in Escherichia coli. The preparation of the shuttle vector and also the expression of useful proteins in cells.

In recent years, research to develop lactic acid bacteria having new functions in addition to the original characteristics of lactic acid bacteria by using biotechnology techniques is continuously conducted. The most active field of lactic acid bacteria is Lactococcus Concentrated in lactis , currently comparable to Escherichia coli. In addition, Lactobacillus , a lactobacillus bacillus, is being actively researched, but Leuconostoc research has remained at the level of plasmid separation and shuttle vector production since 1982 (O`Sullivan and Daly).

In general, bacterial plasmids are not absolutely necessary for growth, but 1) hydrolysis of proteins, 2) metabolism of carbohydrates, amino acids and citric acid, 3) production of bacteriocins, extracellular polysaccharides, pigments, and 4) antibiotics. It has been reported that the resistance of heavy metals and phages is related to plasmids. Yet most plasmids isolated from lactic acid bacteria are mysterious and cryptic and their function is not clear.

In order to construct an excellent shuttle vector and expression vector, first, separation of the plasmid is required. Plasmids isolated from Gram-positive bacteria have been reported to mainly follow two replication mechanisms. Sigma replication or rolling-circle replication (RCR) attached by replicating like sigma (δ) in Roman letters is the most common plasmid of bacteria belonging to it, mainly small size, multiplication, and various host. It also features a clone. However, due to the accumulation of ssDNA, there is a big disadvantage that stability is poor when transferring into the host, and it is reported that it is less safe when there is inserted DNA (eg, heterologous protein) (Gruss and Ehrlich, 1989, Microbiol. Rev. 53: 231-241). Another mechanism is the theta replication mechanism, attached by copying like the Roman letter theta (θ). Larger plasmids have been reported to follow this replication mechanism, but recently small plasmids have also been reported. Another feature is that it has a disadvantage of not being introduced into various hosts, but it is reported to show high stability once entered into the host, and also to show high stability even when the inserted DNA is 16.8 kb or more (Kiewiet et. al ., 1993, Mol. Microbiol. 10: 319-327).

Therefore, the present inventors regarded the lactic acid bacteria of leuconosstock as an industrially important strain that would be useful for the system that provides functionality in the food industry, immunoprotein expression, and various disease treatment systems, and isolated plasmid pCB42 from leuconosstock column. A shuttle vector pLeuCM42 was constructed that was able to replicate in both leukonostock and Escherichia coli. It was confirmed that this shuttle vector is stably replicated for more than 100 generations in the leukonostock, and completed the present invention.

Therefore, it is an object of the present invention to provide a shuttle vector that is stably replicated in leukonostock and E. coli.

In order to achieve the above object, the present invention is to establish a shuttle vector capable of mutual replication in leukonostock and E. coli, the origin of replication (ori) and ampicillin and chloramphenicol antibiotic resistance genes in Escherichia coli Shuttle vector pLeuCM42 made using the plasmid pCB42 isolated from 4kb vector pEK104 which is a pUC19 derivative, and leuconosstock citrate 95 is provided.

That is, the present invention is a DNA replication origin of E. coli; Origin of DNA replication of leukonostock; An ampicillin resistance gene expressed in E. coli and a selectable marker; And chloramphenicol resistance genes (chloramphenicol acetyl transferase, CAT), which are selective markers acting on leuconosstock, and multiple cloning sites having various restriction enzyme recognition sites, which are mutually replicated in leuconosstock and E. coli. The shuttle vector pLeuCM42 is provided.

The various restriction enzymes are preferably enzymes selected from the group consisting of Hind III, Pst I, Xab I, Bam H I, Sma I, Kpn I, and Eco R I, but are not limited thereto.

In another aspect, the present invention provides a host cell comprising the shuttle vector of the present invention.

The host cell of the present invention is preferably a bacterium, more preferably a variety of lactic acid bacteria or Escherichia coli, but is not limited thereto, wherein the lactic acid bacteria is more preferably Lactobacillus, Lactococcus, Streptococcus, or Leukonostock, Conostock is most preferred but not limited thereto.

The leukonostock cell containing the shuttle vector of the present invention was deposited with the Korea Agricultural Microbiological Resource Center (KACC-95063P) located at Seodun-dong, Seodun-dong, Gwonseon-gu, Suwon, Korea, on August 17, 2007. The shuttle vector described in 4 is preferred.

EMBODIMENT OF THE INVENTION Hereinafter, this invention is demonstrated in detail.

Lactobacillus of the genus Leuconostoc can be separated from kimchi, sauerkraut, cabbage pickle and milk and dairy products, silage, herbage, wine, etc., and it grows vigorously in the early stage of fermentation, affecting abnormal fermentation and storage, It is known to enhance flavor while producing aromatic C4 compounds, diacetyl and acetoin. In addition, the microorganisms secrete dextransucrase (EC 2.4.1.5) in the presence of sugar to release fructose and produce a viscous polysaccharide called dextran to increase the viscosity of fermented foods. In addition to producing dextran from sugar, the addition of other sugars catalyzes the transfer of glucose, the constituent sugar of sugar, to other sugars, producing a new oligosaccharide. The carbohydrate added at this time is called an acceptor, and this reaction mechanism is called an acceptor reaction. The types of receptors are quite broad, including monosaccharides, disaccharides, oligosaccharides, and small textboxes, of which maltose is the most efficient receptor and produces panose (6 ² -α-D-glucopyranosylmaltose) oligosaccharides. . Panos, a major component of isomaltooligosaccharide, is used as a functional food additive because of its low calorie content (≤2 kcal / g) and because it promotes the growth of useful intestinal microorganisms. To give. Various characteristics of other Leuconostoc phenotypes are shown in Table 1 below.

General characteristics G (+), spherical, non-motile, spore-forming Facultative anaerobic, catalase (-) Vancomycin resistant Gas generation from glucose Arginine not hydrolyzed D-lactate production from glucose Additional properties Can grow at low temperature (8 ℃) but not at high temperature (45 ℃) Growth is inhibited below pH 4 Possible to grow at 7% NaCl H ₂ S No acid Generates acid from glucose in all strains arabinose, arbutin, cellulose varies by species and subspecies from cellobiose, fructose, galactose, lactose, maltose, mannitol, mannose, melibiose, raffinose, ribose, salicin, sucrose, trehalose, and xylose What species, subspecies Ln . mesenteroides subsp. cremoris , Ln . lactis , Ln . argentinum does not produce slim (polysaccharide) from sugar Ln . mesenteroides subsp. cremoris does not produce acid from fructose and maltose Ln. fallax does not malate decarboxylation

In particular, these Leuconostoc lactic acid bacteria have traditionally been used as food materials in the past and classified as GRAS (Generally recognized as safe), and can be used in foods. They can grow in both anaerobic and aerobic media and are as fast as E. coli. In addition, since the dextransucrase enzyme protein is discharged to the outside of the cytoplasm, it can be produced by releasing the signal peptide and the desired protein to the outside when it is fused, and the produced protein can be stably separated because it does not secrete protease. Can be developed into a new protein expression system.

As described above, the leuconostalk shuttle vector obtained in the present invention will be used as an efficient and convenient expression system capable of stably expressing a protein used for food materials or medicaments. Unlike the existing vector, it showed high stability after transformation regardless of the size of the inserted DNA. Also, various enzymes and useful proteins for food grade can be added directly to food, which can be used as a food additive. have. In addition, the development of such expression vectors, including the shuttle vector is expected to be applicable not only to the starter industry using the leukonostock, but also in various fields.

Hereinafter, the present invention will be described in more detail through non-limiting examples.

Experimental material

E. coli MC1061 was used to construct shuttle vector and clone heterologous protein into shuttle vector, Leuconostoc The citreum 95 strain is a host strain having pCB42, the plasmid of the present invention, isolated from the wild at the beginning of kimchi fermentation. In preliminary experiments, it was used as a superior receptor strain that accepts external vectors better than other Leuconostoc strains. The pLeuCM shuttle vector, used as a control plasmid, is a vector capable of mutual replication in Escherichia coli and Leuconostoc , and has the ampicillin and chloramphenicol resistance genes. A list of bacterial strains and plasmids used in the present invention is listed in Table 2.

Strain or plasmid Genotype / Related Characteristics Strains E. coli MC1061 (New England Biolab) F ^- frr (wild-type (Wt)) araD139 ( ara-leu ) 7679 ( lacIPOZYA ) X74 galU galK hsdR2 mcrB1 rpsL (Sm ^r ) Ln . citreum 95 Wild Strains Isolated from Kimchi Plasmids pUC19 (New England Biolab) E. coli vector, 2.7 kb, Amp ^R , lacZ pCB42 Ln . 4.2kb crypto plasmid from citreum 95 pLeuC42 pCB42, 6.7 kb Kpn I have a cron Turning to the seat of the Kpn I pUC19 pEK104 PUC19 with 1.3kb CAT ^R pLeuCM pCB18 with Sac I cloned into Sac I site of pEK104, 5.8 kb pLeuCM42 pCB42 with Kpn I place the Crohn's turning into a Kpn I pEK104, 8.2kb

Example 1 pCB42 Separation from Leuconostoc citreum 95

Ln. citreum 95 was incubated at 28 ° C. for one day using MRS liquid medium. Cells were collected by centrifugation at 13,000 rpm for 2 minutes and washed twice in 500 uL TES buffer (30 mM Tris-HCl, 50 mM NaCl, 5 mM EDTA, pH8.0). The supernatant was discarded by centrifugation at 13,000 rpm for 2 minutes and suspended in a sucrose solution (25% sucrose, 50 mM Tris-HCl, 1 mM EDTA pH8) containing 200 uL of lysozyme (20 mg / mL). After fully reacting at 37 ° C. for 1 hour, 400 uL of a solution containing 3% SDS and 0.2% NaOH was added thereto and left at room temperature for 10 minutes. 300 μL of cold 3M sodium acetate (pH4.8) was added slowly, followed by centrifugation at 4 ° C. and 15,000 rpm for 15 minutes. The supernatant was transferred to a new tube and centrifuged at 4 ° C., 15,000 rpm for 15 minutes with the addition of 650 uL isopropanol. The supernatant is removed, washed with 200 uL of 70% ethanol and dried at 37 ° C until ethanol is gone. After 10uL RNase (10mg / mL) and 310uL distilled water was added and reacted at 37 ° C for 30 minutes, the same amount of phenol was added thereto, followed by intense voltexing, followed by centrifugation at 4 ° C, 15,000 rpm and 15 minutes. After centrifugation, three layers are formed in the tube. The lower layer has a white layer containing phenol, the middle layer contains protein, and the top layer is carefully transferred to a new tube, followed by 2 times ethanol and 1/10 times 3M sodium acetate ( pH4.8) and again centrifuged at 4 ° C. and 15,000 rpm for 15 minutes, washed with 200 uL of 70% ethanol, and dried at 37 ° C. until ethanol disappears. After concentrating as such, the suspension was finally added by adding 20 uL TE buffer.

1) Analysis of pCB42

Example 1 a plasmid pCB42 the process a number of restriction enzymes results in the separation, was cleaved by Kpn I, Pst I, Sal I and Hind III. In addition, in order to determine the base sequence of pCB42, the plasmid was inserted into the Kpn I site of pUC19, an E. coli vector, and the base sequence was determined using an auto-read sequencing kit (Pharmacia), and a plasmid map could be drawn (FIG. 1, FIG. 1). 2). The base sequence was analyzed by DNASIS (HITACHI software Engineering Co. Japan) program, and the total base sequence of pCB42 was 4,235bp and G + C content was 34.8%. The plasmid has two open reading frames (ORFs), and the first ORF (304 amino acids, p I 10.45, 35649.98 dalton) has high homology (70%) to transpoise proteins found in most lactic acid bacteria. Above) (Table 3). The GCAG sequence is expected to be a ribosome binding site at 4 to 7 bp in front of the start codon of the ORF. The promoter -35 sequence is at 222-227 bp and -10 at 242-247 bp. Sequence (TATAAT) was present. However, the second ORF (194 amino acids, p I 9.22, 22141.33 dalton) with high homology, but Lb. sakei origin DNA-binding protein (data not shown). Also, no ribosome binding sites or promoters could be found. The out homology with other genes in the GenBank nucleotide sequence of the pCB42 BLASTN results, the plasmid sequences and Ln. pTXL1 (Franck Biet et al., Appl. Environ. Microbiol., 68: 6451-6456, 2002) isolated from mesenteroides and Ln . pFMBL1 from mesenteroides (Jeong et al., Plasmid, 57 (3): 314-23, 2007) and some similar sequences (approximately 1 kb) were found, but the two plasmids did not carry transpoise genes and no longer had plasmids detected. This plasmid is the first reported plasmid. In addition, since the above plasmids of pTXL1 and pFMBL1 are reported to be replicated by the Theta mechanism, the plasmid pCB42 of the present invention may be replicated in Leuconostoc cells by the same mechanism.

Homologous protein Consistency (%) Similarity (%) reference ORF1 of pCB42 from Ln. citreum 95 100 100 Invention Transposase and inactivated derivatives, IS30 family from Ln. mesenteroides subsp. mesenteroides ATCC 8293 77 90 ABJ 62229 (Makarova et al ., PNAS 103 (42) 15611-15616.2006) Transposase from Lb. brevis 76 88 BAD 81050 (Fujii et al ., J. Appl. Microbiol. 98 (5): 1209-1220. 2005) Putative transposase from Pediococcus damnosus 77 88 BAD 34520 (Suzuki et al ., Lett. Appl.Microbiol. 39 (3) 240-245. 2004) Putative transposase from Lb. brevis 77 88 BAD 24808 (Iijima et al ., J. Appl, Mircobiol, 100 (6) 1282-1288. 2006) Putative transposase from Lb. paracollinoides 76 88 BAD 34521 (Suzuki et al ., Lett. Appl.Microbiol. 39 (3) 240-245. 2004) Putative transposase from Leuc. lactis 75 89 CAA 58055 (Vaughan & de Vos, Gene 155 (1): 95-100. 1995)

Example 2: Preparation of shuttle vector pLeuCM42

To prepare the shuttle vector, pEK104, which has the origin of replication (ori) and ampicillin resistance in Escherichia coli and the chloramphenicol acetyl transferase (CAT) gene derived from Staphylococcus , which acts on leukonostock, After cutting with Kpn I, the shuttle vector pLeuCM42 was prepared by connecting with pCB42 isolated in Example 1 cut with the same restriction enzyme (FIG. 4).

Example 3: Transformation of Shuttle Vector into Leuconostoc citreum 95

In order to investigate whether the shuttle vector prepared in Example 2 was replicated, Ln . The shuttle vector was transformed into citreum 95. Leuconostoc The strain was incubated in 50mL of MRS until the OD ₆₀₀ became 0.5 and then centrifuged at 4 ° C and 6,000 rmp for 10 minutes, and washed twice with 25mL ice-cold distilled water. At this time, the recovery rate of the cells rapidly decreases, so it must be processed quickly. The recovered cells were washed once with 5 mL ice-cold EPS (EPS: 1 mM K ₂ HPO ₄ KH ₂ PO ₄ , pH7.4, contaning 1 mM MgCl ₂ and 0.5 M sucrose) and suspended in 1 mL ice-cold EPS. Leukonostock competent cells were prepared for electroporation and stored in a -80 ° C deep freezer. 40 uL of leukonostock competent cells and shuttle vector (1ug / uL) DNA were transferred to a cuvette and left on ice for 5 minutes. After pulsed at 25uF, 8kV / cm, 400ohms condition, immediately added 1mL MRS liquid medium and incubated for 1 hour at 30 ℃. After staining with MRS medium containing 10ug / ml chloramphenicol and incubated at 30 ℃ for 48 hours. Some of the colonies grown two days later were separated from the plasmid by the method of Example 2-1 and electrophoresed to confirm the invisible band in the original strain, and the isolated plasmid was transformed back into E. coli DH5α for reconfirmation. As a result of the separation of the kit, as confirmed by the shuttle vector, it was found that the shuttle vector transformed to leukonostock was stably replicated.

Example 4 Stability Test of Shuttle Vector

The stability test of the vector is first incubated in MRS medium containing chloramphenicol for one day and then in MRS medium without antibiotics for 100 generations. After 20 generations (24 hours), the culture solution is diluted by the decimal method, spreaded on the MRS medium and the medium containing chloramphenicol and cultured for one day. In the same way, the colonies grown after 100 generations are counted and applied to the following equation.

At this time, pLeuCM shuttle vector used as a control is a commercial vector for E. coli pUC19 and Ln. Shuttle vector constructed by fusing to the Sac I site of citreum- derived pNS75. The vector is 5.8kb in size, has ampicillin and chloramphenicol resistance genes, and E. coli and Leuconostoc have been stably transformed and registered as patents. As shown in Figure 3, the control pLeuCM showed a high stability of more than 80% for 100 generations, pLeuCM42 also showed a high stability of more than 60 ~ 70% over 100 generations. It can be expected that various candidate proteins can be stably expressed for a long time in the future.

Example 5: host range experiment of pLeuCM42

The shuttle vector prepared in Example 2 was transformed into various host (host) cells. In general, plasmids that follow a sigma form of replication according to the replication form of the plasmid have a wide range of hosts but have low stability, and plasmids that replicate in theta form have a narrow range of hosts but have high stability. The competent cell for electroporation was used in the method of Example 3 and the host cell used was Leuconostoc. lactis , Ln . mesenteroides B-512F, Lactobacillus . plantarum, Lb. reuteri , Lactococcus . lactis , Streptococcus thermophilus , and Bacillus subtilis And so on. The efficiency of transformation was determined by 1) the time of recovery of the cells, 2) the components of the buffer used for washing and electroporation, 3) the conditions of voltage strength and the impact time of the electric shock, and 4) foreign Although it varies greatly depending on the properties of the plasmid DNA, 5) the specificity of the parental cell, etc., there are no reports that clearly establish the optimal conditions. Therefore, in this patent, all the conditions used for Leuconostoc are applied to various host cells. , But the efficiency of the shuttle vector was well introduced into the host cell (Fig. 5). In conclusion, the vector replicates stably in host cells and can replicate in various hosts.

Example 6: Lactobacillus in pLeuCM42 plantarum Cloning of Derived Better-galactosidase Genes

The heterologous protein was cloned into the shuttle vector prepared in Example 2. Although there may be proteins for various purposes, alpha amylase or beta galactosidase enzyme proteins are the most widely used genes since they can be expressed as well as whether or not the cloning is successful as the phenotype of the transformant. In this experiment, the same enzyme derived from Lactobacillus was cloned into the control vector pLeuCM.

1) Chromosome DNA Preparation

Lb. The chromosomal DNA of plantarum was used as part of Bioneer's AccuPrep Genomic DNA Extraction Kit. Lb. Plantarum bacteria were inoculated in MRS medium, cultured for one day, and then cells were collected by centrifugation at 13,000 rpm for 2 minutes. The collected cells were washed with TES (30 mM Tris-HCl, 50 mM NaCl, 5 mM EDTA, pH 8.0) solution, and then suspended by adding 100 µl of 6.7% sucrose (50 mM Tris, 1 mM EDTA, pH 8.0) solution. Incubated for 30 minutes at 37 ℃. 100 µl of a solution of lysozyme (10 mg / ml lysozyme, 25 mM Tris, pH 8.0) was added thereto, followed by further incubation at 37 ° C for 30 minutes. Next, experiments were carried out as described in the protocol, and a final 50 μl of purified product was obtained.

2) Cloning of Beta-Galactosides

Lb. PCR was performed to clone the beta-galactosidase gene from plantarum into the vector. The chromosomal DNA prepared in Example 5-1 was used as a template, and the primers used were as follows.

Forward primer:

(Gal-For; SEQ ID NO: 2): 5'-AAATT GGATCC GTAGTTGTTGTCATTTAGT -3 '

Reverse primer:

(Gal-Re; SEQ ID NO: 3): 5'-AATT GGATCC TTTAGAAATGAATGTTAAAGC -3 '

BamHI restriction site was present in the above two primers, PCR reaction was carried out PCR using the chromosomal DNA as a template, the reaction mixture (50 μl) was 0.5 μl Taq DNA polymerase, 10X buffer, 250 uM dNTPs, stomach It consisted of the primer of. PCR conditions were denaturation 94 ℃, 5 minutes, standard PCR 30 cycles (94 ℃, 30 seconds, 55 ℃, 30 seconds, 72 ℃, 3 minutes) and the final reaction (72 ℃, 5 minutes). After PCR, the product was purified using Bionis' PCR purification kit, and treated with Bam H I. In addition, pLeuCM and pLeuCM42 were also treated with the same restriction enzyme, and purified using a gel purification kit, followed by dephosphorylation using alkaline phosphatase. 1uL of vector (pLeuCM, pLeuCM42) DNA, 3uL of inserted DNA (beta-galactosidase), 0.5uL of T4 DNA ligase (TaKaRa), and 5.5uL of distilled water were added to 1uL of buffer solution to make a total volume of 10uL. The reaction was carried out for 12 hours at 16 ° C. and the reaction was carried out using E. coli MC1061 (Sambrook et al. ). al ., Molecular Cloning: A Laboratory Manual , 2nd edn, 1989). Plasmids were plated in a plate containing 50 μg / ml ampicillin and 40 μl 40 mg / ml X-gal solution to obtain plasmids from the blue colonies with beta-galactosidase activity by methods known in the art. It was isolated and named pLeuCMgal, pLeuCM42gal. In the same manner as in Example 3, leukonostock competent cells were prepared, and the previously prepared vectors were transformed by electroporation, respectively, and each transformant was 10 ug / ml chloramphenicol and 40 mg / ml X-. After plating on MRS medium containing 40ul gal solution was incubated at 30 ℃ for 48 hours. Two days later, all colonies were found to have a blue color. Thus, the stability of each vector was tested by the method of Example 4. All methods were not different from Example 4 and the results are shown in FIG. 6.

As shown in FIG. 6, the pLeuCM42gal cloned with the beta-galactosidase gene in pLeuCM42 showed about 70% or more stability up to 100 generations, but the pLeuCMgal was stable after cloning a heterologous protein unlike the shuttle vector. As a result, it can be seen that since 20 generations, the stability sharply drops. This is due to the replication mechanism of the plasmid as reported previously. Unlike pCB18, which is replicated by RCR, pCB42, which is expected to replicate by Theta mechanism, has a narrow host range, but is stably replicated once transformed into the host cell. And also stably expressed as a heterologous protein.

1 is a restriction map of plasmid pCB42.

2 is the nucleotide sequence of plasmid pCB42 .

3 is a diagram showing the plasmid stability of pLeuCM42, showing that the plasmid replicates stably in the absence of antibiotic resistance after transforming pLeuCM and pLeuCM42 vector of the present invention as a control in the host cell Leuconostoc citreum 95.

4 is a view for explaining a method of forming a shuttle vector pLeuCM42 with the plasmid pCB42 and the E. coli vector pEK104.

5 is a diagram showing the range (range) of pLeuCM42 host cells, pLeuCM42 to the host cell Lb. plantarum, Ln, lactis and Ln. After inserting each of mesenteroides B-512F, a portion of the CM gene (about 800bp) which does not have the original host but has only pLeuCM42 (approximately 800bp) was amplified by PCR. M, size marker, 1, Lb in the picture . plantarum ; 2, Ln , lactis ; 3, Ln . mesenteroides B-512F.

Figure 6 is a diagram showing the plasmid stability of pLeuCM42gal, pLeuCMgal and pLeuCM42gal vector of the present invention host control Leuconostoc After transfection to citreum 95, the plasmid replicates stably in the absence of antibiotic resistance.

<110> CHUNGBUK NATIONAL UNIVERSITY INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> A Novel plasmid from Leuconostoc sp. and Shuttle Vector          configuring the plasmid <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 4235 <212> DNA <213> Artificial Sequence <220> <223> Shuttle vector pLeuCM42 <400> 1 ggtacctagg ctttttgtat ttgtgaaaac ttagctcatg tgtgatttat gagtggacga 60 actacctaaa agcatttgtg agtgttggga taagccaaga caagaaacca ccgattggaa 120 aaattaccca ccaataatta gctaaaaagg cccaaatgtt gtctatcttt tccgtttcct 180 tttgtttttt ttcaacaagg cccactgttt taggatactt tttatctaac ctttcgactc 240 ctataatacg ataaacggca gattgtaaaa ttaaaccgaa caccttgcat aaaaaaactg 300 cagcttatgt cttctagttt atcagctcac gaacgttctg tcattgaaac aatgatcaaa 360 cttaatcatt caactcgaga aatagcccgt ttcttaaagc gttctcctgc aactattacc 420 tacgagttaa atcgaattaa accatacaat gcacaacagg ctcatcattt agcccagtgt 480 aatcggcaca aacacggtcg ccatccgacc ctaacacctg aaatatcagc ttttttgaac 540 catcacattg gtatcttgaa gtggtcacca gaaacggctg ctcatgtatt gggtattgct 600 ttcaagacca tctacaactg gattcatcat ggtttgctta aaattaagtt atcagattta 660 cctgataaag gtattcgacg taaacgtcaa tctgacggcc gtagacgtgt ttttgctcat 720 ggccgttcaa ttgaaaaacg accaaaagct gtccaattaa gacaagaatt tggtcatttt 780 gaagttgata cgatgcaatc tggtaaaaca cgtggcgacg ttttagtgac catcacagaa 840 cgattgagtc gacaacatat catgagacat gtcagtgggc gcaatagtca ggcagtgaca 900 ccagctatta ttaggttttt caagggtata aaaaatgcta aatcaattac agttgatcac 960 ggtcgagagt ttgcaaaata tgatgaaata gaagaacagc taggcatacc gatgtatttt 1020 gcacacccat attcaccaga agaacgtggt agtaatgaag tgctaaatcg atatgtccgt 1080 cgttttatcc caaaagaacg caaaattgaa accatcagtc acaaagaatt agatcaaatt 1140 aatcattgga ttaatgccag gccaatgaaa acgctcaact ggcaatctcc acgaaaagtc 1200 tttcagaaac atgcggtgtt cggatgattc ttgcaatctg ccaaacatat aaagatcctg 1260 ctattaacaa gaacaaaagt aataaccaaa tgattccgaa tatagcttgc tcattttcag 1320 gttgttgacc aatccagtag ccataaaatg ataacactga tatatctatg gctattagta 1380 taagacttaa aacggctgac tcgttttttc gtcgatatag ttgagaaact tgttgttgtg 1440 agtaatctaa aatttcttgc tctttttctt tttgctctat atcatcaaaa aggccgctta 1500 tagggacaga tagcgcattt gctatggcac ttaaactact taagctgaca tcttcgcctg 1560 cttctaatcg ttggactgtt cgaatagtaa cgtaagattt atctgctagc tcttgttgcg 1620 ttaagccatg ttgttttcta agttgtgata catttgtttt attcataatt tcaatataat 1680 gctttggtga aataaagtat acgacagtct tatgacagtt atctgacagc aagtattttc 1740 taaattgcat gtaaaacttt tttcttgtcg ggatcttttt cgtttaaagc attatccatt 1800 aaaacctgta agttcgtatt ttcagcttcc caaaacaact tttcaaaaat atttttatca 1860 gccataattt aagctcctta ttgcatttaa atgtgtctct agcctaatta tactaataag 1920 caaaataatc cgtcagcgaa acgacataaa atgagtttaa tgcgcactta cactccactt 1980 ctaaaatgga gttgtttgcg ctcaaaaata tgtatcagaa gtcgctgtta tcgacaactt 2040 gaaaaacaac aaaagttctt gttgcgagca tactatgtgt ggtcacacat gaggtaaaaa 2100 tatatctaaa ttgatatgtt tttgtttggg aaattcccaa tccctttttt aattaaaatc 2160 aattttgata agcggacggt tgatgaacga aaaatactaa caaacaaaac ggacgctata 2220 aaagtactat tagaaaacta tttaaataac ctttgccaga atcctttctt tggctgattt 2280 ctttttcttg atctcaatta ggggttattg tctctgtatc tttttcttta atttgtgatt 2340 ttaaataatt aattaaatca tctttttcag ctagttgttg cgctgtaaaa gtgtcaacat 2400 agttacttga agttgacttt ttgggtttac gtttgtttga cactaaaagt tgccattctt 2460 tatcggtgaa tgacttttta gataaatcta tattaaggcg tttagccttt ctatttaagg 2520 cttgacgaga tatttctagt tcgtctgcta tcgcgataat ggtatcaaat tcgtgtgtca 2580 tcagtctctc caaacgtaaa cttaagcgat gtaaagttta cgttttaagt ttactatatt 2640 gttgacgttt taagtttact atattgttga cgttttaagt tggtcgttta attattaaaa 2700 cataagatta tttgtttgtt tattgtcatg tatagttctt aatgctatac tcatatcaac 2760 atttaaatac aaataaaaag acctcaaccc ctgcaagggt taggacttgg tgacctagat 2820 attacaacta tcagggtttt gccattacag aattagacct ctgcaatggc ttagaatact 2880 tactattata caaacttata gactcagagt aaacagcttt actcaaaaaa gaactataaa 2940 cgactatgaa agcgtatcct ccagcctaac taagcacgag gatacgcttt ttacgtctgt 3000 tcaatcgttg tcggacgtta tcctaacaac taatacggaa caggcgtgta tccgtcaaga 3060 gggctgaaag gtcgtctaaa ccacgtccaa agcaatcaaa gcgagattgt ggggaatgaa 3120 caattcgatt atgggtaggc tcgcccgcaa gtaattggca aagaagtggc atatagaatt 3180 agcactctat atggtttaaa tcgcatataa agcgatttaa gcggtgtctg acgtgttcta 3240 accttattga cttataaaag taagggtttc tattgggcag acgatagaag agaaattaga 3300 gcgatatacg tggttgatac aagcgatatg attctgaatt ataccttgaa caatcttaaa 3360 agtcctaaat acttagggct ttctctgctc aaatcaaact gattgccctt gttatcattg 3420 ctaaatgaac aatgcaagaa atatttgcta gaaataaatt tgttgtcaaa gtaatataat 3480 ggcgtaggaa gggaacaaat atggaactat ctactatttt agttgaacaa cgaaagaaaa 3540 aagatgaaac acagcaaaaa gttgcagata atctctttat cactaggcaa tctttgtcaa 3600 attgggaaaa tggaaaaaat tttccagata ttcccatgct tatagaatta agcaactatt 3660 ataacttttc tttggatatc atcaaaggag atacagaatt gatgaataaa gtacaaaagg 3720 attatgaatt gattaacacg aaaaaggcta ataagaagta ttctgtctta ttgattgtat 3780 tgactgtgct tattgtactt atggcagtag taattatacc tttagtaact agcaataaaa 3840 gcttaacaaa gtttgttaca gtatttattt taatgctgtc tatcatttta attcatgtta 3900 ctgtcaaatt cgataaggtt gtttatcaaa attatgaagg aatgccaaat cctccactat 3960 gggtgccgaa agcttttggc tatggtataa gtgttaaccc ttacaacaaa gtaggtaaaa 4020 taataattat cgcactagat ctctttttta ttggtacagg tatagcaata ttatatttta 4080 gctaacaaat catagtagtc atatatgaac ttaacataat ccatcttatg acaagtgaaa 4140 agcgccaaac cttattcgaa taggttttgg cgctttttat gggattgggg tttgtgaatt 4200 tagctcaaat aaattggtct agctctcaca atcgc 4235 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Gal forward primer <400> 2 aaattggatc cgtagttgtt gtcatttagt 30 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Gal reverse primer <400> 3 aattggatcc tttagaaatg aatgttaaag c 31  

Claims (9)

A shuttle vector pLeuCM42 having a cleavage map shown in FIG. 4 capable of mutual replication in Escherichia coli and leuconostock, prepared by linking a plasmid pCB42 isolated from leuconostock citrum 95 with an E. coli-derived transformation vector. delete delete A host cell comprising the shuttle vector of claim 1. The host cell according to claim 4, wherein the host cell is Escherichia coli. The host cell according to claim 4, wherein the host cell is a lactic acid bacterium. The host cell according to claim 6, wherein the lactic acid bacterium is leukonostock. 8. The host cell according to claim 7, wherein the leukonostock is leuconostock KACC-95063P. The host cell according to claim 6, wherein the lactic acid bacteria is selected from the group consisting of Lactobacillus, Lactococcus and Streptococcus.

Images