JP5712495B2 - Microorganisms deleted or inactivated drug resistance genes - Google Patents

Description

  The present invention relates to a microorganism which has been rendered drug sensitive by deleting or inactivating a drug resistance gene on the genome. Specifically, the present invention relates to a drug-sensitive microorganism (drug-sensitive Rhodococcus bacterium) in which a drug resistance gene on the genome of the genus Rhodococcus is deleted or inactivated.

  Rhodococcus bacteria are known as industrially useful microbial catalysts because of their physical strength, organic solvent resistance, redox ability, ability to accumulate large amounts of enzymes, etc. in cells. For example, Rhodococcus bacteria are used for the production of amides or acids by enzymatic hydration or hydrolysis of nitriles (Patent Documents 1 and 2). In addition, it is also known as a high-resolution microbial species for persistent compounds (Patent Documents 3 to 6). By utilizing its ability, application studies for various useful substance production and environmental purification have been promoted. Yes. For example, production of useful substances from petroleum by desulfurization or bioremediation when oil spills into the environment can be mentioned.

  In addition, attempts have been made to modify Rhodococcus bacteria to more useful ones by genetic recombination methods (Patent Documents 7 to 9). For example, in order to efficiently promote genetic manipulation of Rhodococcus bacteria, development of host-vector systems is underway, search for novel plasmids (Patent Documents 10 to 12), and development of vectors (Patent Documents 13 to 16) 17-19, Non-Patent Document 1) and the like.

JP-A-2-470 JP-A-3-251192 European Patent No. 188316 European Patent No. 204555 European Patent No. 348901 European Patent Application No. 307926 Japanese Unexamined Patent Publication No. 4-21379 JP-A-6-25296 JP-A-6-303791 Japanese Patent Laid-Open No. 4-148685 JP-A-4-330287 Japanese Unexamined Patent Publication No. 7-255484 Japanese Patent Laid-Open No. 5-64589 JP-A-8-56669 U.S. Pat.No. 4,920,054 JP-A-8-173169 Japanese Patent Laid-Open No. 10-248578 JP 2006-180843 A JP 2006-50967 Gazette

Journal of Bacteriology 170, 638-645 (1988)

  In general, when transforming a microorganism, a transformant is selected using a selection marker for the introduced plasmid (for example, a resistance gene for a certain drug). However, since some hosts have resistance to some drugs, the host itself may have the function of a selection marker possessed by a vector system suitable for the microbial species. For example, when a Rhodococcus bacterium is transformed, a shuttle vector having a kanamycin resistance gene as a selection marker is often used, but many strains of the genus Rhodococcus are resistant to kanamycin. When transforming these kanamycin-resistant Rhodococcus bacteria using the shuttle vector, it is necessary to select a transformant with a high concentration of kanamycin, which is very inefficient.

  In the above case, in order to enable efficient transformation with a selection marker derived from a plasmid, the drug resistance gene on the host microbial genome is deleted or inactivated, and is sensitive to the drug. What is necessary is just to improve a host. Examples of a technique for deleting or inactivating a gene present on the genome include a method using homologous recombination. This can be achieved by inserting another gene between the target genes so that the target gene is not functionally expressed (inactivation), or by replacing the target gene with a sequence that does not include part or all of the target gene. In this method, the gene itself is deleted to stop the expression of the target gene itself. In some microorganisms such as Escherichia coli and yeast, since efficient homologous recombination techniques have been established, the target gene can be deleted or inactivated relatively easily.

  An electroporation method or the like is known as a gene introduction method for homologous recombination in Rhodococcus bacteria. The electroporation method is a typical transformation method in Rhodococcus bacteria, but when applied to homologous recombination, Rhodococcus bacteria and its related bacteria have the characteristic that non-homologous recombination is likely to occur. Therefore, there is a problem that the target homologous recombination strain can be obtained only with a very low probability. Other gene introduction methods for homologous recombination include a method using conjugation transfer (conjugate transfer method), but this method is hardly applied to Rhodococcus bacteria.

  Therefore, since a method for efficiently or universally deleting or inactivating a target gene has not been established in Rhodococcus bacteria, Rhodococcus genus in which a drug resistance gene that can be used as a selection marker has been deleted or inactivated. At present, bacteria, that is, drug-sensitive Rhodococcus bacteria are not sufficiently obtained.

  Under such circumstances, it has been desired to obtain a drug-sensitive microorganism in which the drug resistance gene has been deleted or inactivated more efficiently and universally.

  The present invention has been made in consideration of the above situation, and provides a Rhodococcus bacterium exhibiting the following drug sensitivity.

That is, the present invention is as follows.
(1) A microorganism exhibiting sensitivity to a drug due to deletion or inactivation of a target drug resistance gene in Rhodococcus bacteria.

  Examples of the microorganism of the present invention include those in which the deletion or inactivation is performed by a method including the following steps (a) to (d) using conjugative transmission from a donor microorganism to a recipient microorganism. Can be mentioned.

(A) producing a Rhodococcus bacterium with enhanced donor microorganism growth inhibition marker as a recipient microorganism;
(B) as a donor microorganism, (i) a base sequence region in which the resistance gene is deleted or inactivated in the base sequence including the target drug resistance gene in the recipient microorganism and the surrounding base sequence, (ii A gene comprising a conjugation initiation region that functions in the donor microorganism, (iii) a replication initiation region that functions in the donor microorganism, (iv) a recipient microorganism growth inhibition marker, and (v) a conditional lethal gene for the recipient microorganism. Producing a microorganism transformed with the modifying plasmid;
(C) producing a transformant of the recipient microorganism by performing conjugation transfer from the donor microorganism produced in (b) to the recipient microorganism produced in (a); and (d ) A step of culturing the transformant prepared in (c) under a culture condition in which the conditionally lethal gene can function.

  In the microorganism of the present invention, examples of the genus Rhodococcus include Rhodococcus rhodochrous or Rhodococcus erythropolis.

Examples of the microorganism of the present invention include those in which the deleted or inactivated drug resistance gene is a kanamycin resistance gene.
(2) A method for producing a protein, comprising culturing the microorganism according to (1) above as a host and collecting a target protein from the obtained culture.

  According to the present invention, for a Rhodococcus bacterium exhibiting drug resistance, it is possible to provide the drug-sensitive microorganism (the drug-sensitive Rhodococcus bacterium) in which the drug resistance gene on the Rhodococcus genome is deleted or inactivated. it can. For example, if a transformant is prepared using a shuttle vector having a kanamycin resistance gene as a marker, the kanamycin sensitive strain as one embodiment of the drug sensitive microorganism of the present invention can be used to increase the There is no need to select a recombinant strain at a concentration of kanamycin, and a transformant can be obtained more efficiently using a medium containing a low concentration of kanamycin. It is also possible to construct a vector system in which a deleted drug resistance gene is introduced and to use the drug resistance gene as a selection marker. Therefore, the use of the drug-sensitive microorganism of the present invention as a transformation host enables more efficient substance production and the like, so that the present invention is extremely excellent from an industrial viewpoint.

BRIEF DESCRIPTION OF THE DRAWINGS It is the schematic shown about the homologous recombination etc. which occur on the said bacterial genome in each process at the time of deleting the kanamycin resistance gene of Rhodococcus genus bacteria by this invention. It is a figure which shows the gene map of plasmid pKM043 for gene modification. (A) It is a figure which shows the result of having succeeded in isolating kanamycin sensitivity strain | stump | stock Rh (DELTA) Km-01. (B) It is a figure which shows the result of having confirmed that the area | region corresponding to kanamycin resistance gene length about 0.5 kb is deleted from the genome in Rh (DELTA) Km-01 strain | stump | stock. (A) It is a figure which shows the result of having succeeded in isolating kanamycin sensitivity strain | stump | stock Rh (DELTA) Km-10. (B) It is a figure which shows the result of having confirmed that the kanamycin resistance gene has been deleted from the genome of RhΔKm-10.

  Hereinafter, the present invention will be described in detail. The scope of the present invention is not limited to these descriptions, and other than the following examples, the scope of the present invention can be appropriately changed and implemented without departing from the spirit of the present invention.

It should be noted that all publications cited in the present specification, for example, prior art documents, publications, patent publications and other patent documents are incorporated herein by reference.

1. Microorganisms showing sensitivity to drugs Microorganisms showing sensitivity to drugs according to the present invention, that is, Rhodococcus bacteria showing sensitivity to drugs (hereinafter sometimes referred to as "microorganisms of the present invention" or "drug-sensitive strains") Is a mutation in which a gene required to acquire resistance to a drug (hereinafter referred to as “target drug resistance gene”) is deleted or inactivated in a Rhodococcus bacterium having resistance to a drug as described above. Is a stock.

  Here, being sensitive to a drug means that Rhodococcus bacteria cannot grow in the drug-containing medium. In addition, “tolerance to a drug” means that Rhodococcus bacteria can sufficiently grow even in a drug-containing medium.

  As Rhodococcus bacteria, Rhodococcus rhodochrous J1, M8 (SU1731814), M33 (VKM Ac-1515D), ATCC 184, ATCC 999, ATCC 4001, ATCC 4273, ATCC 4276, ATCC 9356, ATCC 12483, ATCC 12674, ATCC 13808, ATCC 14341, ATCC 14347, ATCC 14350, ATCC 15905, ATCC 15998, ATCC 17041, ATCC 17043, ATCC 17895, ATCC 19067, ATCC 19149, ATCC 19150, ATCC 21243, ATCC 21291, ATCC 21785, ATCC 21924, ATCC 21999, ATCC 29670, ATCC 29672, ATCC 29675, ATCC 33258, ATCC 33275, ATCC 39484, IFO 3338, IFO 14894, JCM 3202, NCIMB 11215, NCIMB 11216, Rhodococcus erythropolis PR4 (NBRC 100887), NBRC 12320, NBRC 15567, NBRC 16296, IFM 155, DSM 743, DSM 9675, DSM 43200, JCM 6821, JCM 6822, JCM 6823, JCM 6824, JCM 6827, DSM 11397, DSM 44522, JCM 2895, JCM 2893, JCM 2894 , IAM 1400, IAM 1503, Rhodococcus opacus B4, etc. It is.

  Examples of target drug resistance genes include aminoglycoside antibiotic resistance genes, β-lactam antibiotic resistance genes, chloramphenicol antibiotic resistance genes, tetracycline antibiotic resistance genes, and the like.

  Here, aminoglycoside antibiotic resistance genes include phosphotransferase gene groups such as aminoglycoside 3′-phosphotransferase, which is a kanamycin and neomycin resistance gene, and nucleotides such as aminoglycoside 3′-adenylyltransferase, which is a streptomycin resistance gene. Examples include a gill transferase gene group and an acetyltransferase gene group.

  Examples of β-lactam antibiotic resistance genes include β-lactamase genes.

  Examples of chloramphenicol antibiotic resistance genes include chloramphenicol acetyltransferase genes.

  Examples of tetracycline antibiotic resistance genes include transposon Tn10-derived tetracycline resistance genes.

In addition, some Rhodococcus bacteria having resistance to a certain drug do not have a drug resistance gene responsible for detoxification by the modification of the drug or the like, or the function of discharging to the outside of the cell. Some strains exhibit drug resistance as a result of the resistance of the enzyme itself to the drug (drug resistance). In this case, for example, a drug-sensitive strain can be obtained by replacing the drug-resistant enzyme with a sensitive enzyme (non-resistant enzyme) such as a related species. Also in this case, since it is considered that the drug resistance can no longer be exhibited, that is, the drug resistance is inactivated, it falls within the category of inactivation of the drug resistance gene in the present invention. Examples of the enzyme exhibiting drug resistance include trimethoprim resistant dihydroxyfolate reductase.

2. A method for producing a microorganism exhibiting sensitivity to a drug The method for deleting or inactivating a drug resistance gene as a target is not limited, and any method may be applied. For example, a method of transforming a plasmid having a sequence homologous to the gene or its peripheral sequence can be used. As a transformation method, an electroporation method or a junction transfer method can be used.

  As for the above-mentioned deletion or inactivation method, the following method is particularly preferred in the present invention.

That is, it is preferable that the microorganism of the present invention can be obtained by a method including the following steps (a) to (d) using the conjugate transmission from the donor microorganism to the recipient microorganism. The production method is a method for deleting or inactivating a target drug resistance gene, including the use of a transformation method utilizing conjugative transfer from a donor microorganism to a recipient microorganism. It can be said that the method includes (a) to (d).

(A) producing a Rhodococcus bacterium with enhanced donor microorganism growth inhibition marker as a recipient microorganism;
(B) As a donor microorganism, the following (i) to (v):
(i) a base sequence region in which the resistance gene is deleted or inactivated in the base sequence including the target drug resistance gene in the recipient microorganism and the surrounding base sequence;
(ii) a junction transmission initiation region that functions in the donor microorganism;
(iii) a replication initiation region that functions in the donor microorganism,
(iv) a recipient microbial growth inhibition marker, and
(v) producing a microorganism transformed with a plasmid for genetic modification containing a conditionally lethal gene for the recipient microorganism;
(C) producing a transformant of the recipient microorganism by performing conjugative transfer from the donor microorganism produced in step (b) to the recipient microorganism produced in step (a); and (d ) A step of culturing the transformant prepared in the step (c) under a culture condition in which the conditionally lethal gene can function.

The Rhodococcus bacterium used as a recipient in the above deletion or inactivation method is not limited, and examples thereof include those having the kanamycin resistance described above.

In the case of gene deletion or inactivation using conjugative transfer, the growth of both the recombinant strain of the donor microorganism (donor microorganism) and the non-recombinant strain of the recipient microorganism (recipient microorganism) is inhibited. Therefore, two kinds of selection markers (donor microbial growth inhibition marker and recipient microbial growth inhibition marker) are necessary. The donor microorganism growth inhibition marker must be possessed by the recipient microorganism itself. The recipient microorganism growth inhibition marker needs to be contained in the plasmid for genetic modification. Details of both markers will be described in the following steps.

2.1. Process (a)
In step (a), Rhodococcus bacteria with enhanced donor microorganism growth inhibition markers are prepared.

  For the reasons described above, a Rhodococcus bacterium as a recipient needs a drug resistance marker (donor microorganism growth inhibition marker) for inhibiting the growth of a donor microorganism. Therefore, when a Rhodococcus bacterium that does not have drug resistance other than drug resistance involving the target drug resistance gene or has poor drug resistance is used, the drug can be selected and can function as a donor microbial growth inhibition marker. It is necessary to produce mutants having sufficient drug resistance.

  Here, as a drug for inhibiting the growth of donor microorganisms, it is preferable to select a drug that is sensitive to the donor microorganism in consideration of the drug resistance of the microorganism (donor microorganism) used as the donor during conjugation transmission. As the drug, chloramphenicol, ampicillin, kanamycin, trimethoprim, gentamicin, naldicric acid, carbenicine, thiostrepton, tetracycline, streptomycin, etc. are preferable, and chloramphenicol and ampicillin are more preferable.

  There are no particular limitations on the method for producing a recipient microorganism with enhanced donor microorganism growth inhibition markers. For example, (i) natural mutagenesis, (b) mutagenesis using ultraviolet irradiation or a mutagen. (C) A method of introducing a plasmid for acquiring antibiotic resistance, which is different from the plasmid for genetic modification in advance, is preferred, and the natural mutagenesis method is more preferred.

  The natural mutagenesis method is a method in which a target microorganism is originally subcultured in a medium containing a desired drug to induce spontaneous mutation in a microorganism that is originally impossible or difficult to grow in the medium. This is a method for obtaining a strain that can grow even in the medium containing a drug of a concentration.

The degree to which the drug resistance of Rhodococcus bacteria, which are recipient microorganisms, is to be enhanced depends on the type of Rhodococcus bacteria used, the donor microorganism, and the drug to be selected. It is preferable to reinforce based on a drug concentration at which the growth of microorganisms (Rhodococcus bacteria) is not suppressed and the growth of donor microorganisms is sufficiently inhibited. For example, when using Escherichia coli as a donor microorganism and chloramphenicol as a selective agent for Rhodococcus bacteria as a recipient microorganism, chloramphenicol 30 to 200 mg / L, preferably by natural mutation It is desirable to obtain Rhodococcus bacteria (chloramphenicol resistant strain) that can grow in a medium containing 50 to 200 mg / L.

2.2. Process (b)
In step (b), a microorganism transformed with a predetermined gene modifying plasmid is prepared as a donor microorganism to be used for conjugation transmission. As a plasmid for gene modification, that is, a plasmid for deleting or inactivating a target drug resistance gene in a recipient microorganism, the above-described configurations (i) to (v) (gene / base sequence, etc.) Use what is included.

  In order to transfer the plasmid from the donor microorganism to the recipient microorganism, in addition to oriT, the mob gene and tra gene (s) are minimally required. mob is a gene encoding an oriT-specific nick enzyme, and when this enzyme acts on oriT, transfer from the donor microorganism to the recipient microorganism (of the genetically modified plasmid) is initiated. tra is a general term for a large number of gene groups, and is composed of gene groups involved in sex cilia formation, junction tube formation, and junction control. The mob gene and tra gene (s) do not necessarily have to be on the genetically modified plasmid, but may be integrated on another plasmid (helper plasmid) or on the donor microbial genome (protein nucleic acid enzyme, vol. 38). , p. 60-68 (1993)).

  In the production method of the present invention, the donor microorganism may be any microorganism that can be conjugated and transferred to the recipient microorganism, and is not limited. However, the donor microorganism needs to satisfy the minimum requirements for the conjugated transfer. Therefore, when the oriT, mob gene, and tra gene (s) are provided on the gene modification plasmid to be used, there is no particular limitation as long as each can function, but on the gene modification plasmid to be used. If only oriT is provided in the microorganism, it is necessary to use a microorganism having the mob gene and tra gene (s) corresponding to oriT. As a combination of a microorganism serving as a donor and a plasmid for gene modification, for example, a combination of E. coli S17-1 and pK19mob is preferable. Since the E. coli S17-1 genome has the tra gene (s) derived from plasmid RP4 and pK19mob has the RP4-derived oriT and mob genes, respectively, it can be used as a donor microorganism.

  Here, the sequence (i) is a nucleotide sequence including a drug resistance gene to be targeted in Rhodococcus bacteria (to be modified) and a nucleotide sequence around the gene, or the gene is deleted or This is an inactivated base sequence region.

  Isolation (cloning) of the base sequence including the target drug resistance gene and the base sequence around the gene from the genome of the recipient microorganism can be performed using known techniques such as gene library preparation and PCR. it can.

  Although the base sequence around the target drug resistance gene is not limited, the longer the homologous region (base sequence around the target gene) with the Rhodococcus genome, the more efficiently homologous recombination can occur. Therefore, it is preferable to use a longer sequence within a range that does not hinder cloning.

  For example, the homologous region upstream and downstream of the gene is preferably a sequence containing a base sequence of 100 to 3000 bp, more preferably a sequence containing a base sequence of 500 to 2000 bp. The method for preparing the above (i) using the isolated base sequence is not particularly limited, and can be performed using a known technique such as PCR method or excision or replacement of a target gene portion using a restriction enzyme.

  The deleted genes include those in which part or all of the target drug resistance gene encoded in the genome of Rhodococcus bacteria is deleted, part or all of the promoter sequence is deleted, In the case where there is a gene related to the regulation of gene expression, a part or all of the gene is deleted. These deleted regions may be used alone or in combination.

  As an inactivated gene, a foreign gene such as a drug resistance gene is introduced into the target drug resistance gene encoded in the genome of the genus Rhodococcus or a gene related to regulation of the expression of the gene. Examples thereof include those modified to a gene that does not express the original function, or those in which the drug non-resistant enzyme is expressed by substituting the gene of the drug resistant enzyme with the gene of the drug non-resistant enzyme.

  The non-drug resistant enzyme has the same function as the drug resistant enzyme in the cell, but is not limited as long as it is sensitive to the target drug, but it is derived from Rhodococcus bacteria or related species. Are preferred.

  The junction transmission start region of (ii) is not particularly limited as long as it includes a base sequence serving as a junction transmission start point in the donor microorganism to be used. For example, a sequence containing a junction transfer initiation region derived from F plasmid, oriT derived from plasmid R6K, oriT derived from plasmid RP4 is preferable.

  The replication initiation region (iii) is not particularly limited as long as it contains a base sequence that can function as a self-replication origin of the gene-modifying plasmid in the donor microorganism used. For example, it is preferable to use a region containing the replication origin derived from plasmid pMB1 and broad host range plasmid RK2, and derivatives thereof.

  The recipient microorganism growth inhibition marker (iv) is preferably a resistance gene for a drug to which the recipient microorganism (Rhodococcus genus) used for conjugation transmission is sensitive. If the target drug resistance gene and the growth inhibition marker have the same function, the target recombinant strain (homologous) can be obtained by using a high concentration drug that cannot acquire resistance only with the target drug resistance gene. It is also possible to obtain a recombinant strain. Preferred examples of the resistance gene include a kanamycin resistance gene, an ampicillin resistance gene, a gentamicin resistance gene, a thiostrepton resistance gene, a carbenicin resistance gene, and the like. Among these, the kanamycin resistance gene is more preferable.

  The conditional lethal gene (v) may be a gene that can be introduced into the genome of a recipient microorganism and can have the effect of causing the microorganism to die when exposed to a specific condition. For example, the sacB gene is preferable. The sacB gene encodes an enzyme that produces a harmful substance having a lethal effect on a microorganism using sucrose as a substrate when a microorganism (for example, Rhodococcus genus bacteria) possessing and expressing the gene is cultured in a sucrose-containing medium. It is a gene to do.

The gene-modifying plasmid used for conjugation transfer may be constructed based on any vector, and the kind thereof is not particularly limited. Examples of the vector to be used include pBR322, pSC101, pACYC184, pACYC177, pTrc99A, pUC18, pUC19, pUC118, pUC119, pHSG298, pHSG299, pSP64, pSP65, pGEM-3, pGEM-3Z, pGEM-3Zf (-), pGEM -4p, GEM-4Z, Bluescript M13 +, Bluescript M13-, pK19mob, pK18mob, pK18mobsacB and the like. Among them, it is more preferable to use pK19mob, pK18mob, and pK18mobsacB (Schaefer et al., Gene, vol. 45, p. 69-73 (1994)) that already have RP4-derived oriT and mob inside the plasmid.

The configurations of (i) to (v) in the plasmid for gene modification are not particularly limited with respect to the arrangement, and may be arranged in any order. The construction of the plasmid for gene modification including the structures (i) to (v) can be performed using a known gene recombination technique.

In the step (b), a genetically modified plasmid having each of the above-described structures is introduced into a microorganism used as a donor to produce a transformed microorganism, that is, a donor microorganism used for conjugation transmission. At this time, as a transformation method, a method known as a transformation method for microorganisms, such as an electroporation method or a calcium chloride method, can be used.

2.3. Process (c)
In step (c), conjugation transfer from the donor microorganism obtained in step (b) to the recipient microorganism obtained in step (a) is performed. Usually, the cell suspensions of the donor microorganism and the recipient microorganism are mixed and spread uniformly on an appropriate plate medium (LB medium or the like) to allow the two microorganisms to be joined. In this conjugation, the gene modification plasmid in the donor microorganism moves into the recipient microorganism, homologous recombination occurs in the homologous sequence of the recipient microorganism's genome and the above plasmid, and a part or large portion of the gene modification plasmid is generated. A portion is introduced onto the genome of the recipient microorganism. By this conjugation, a transformant of the recipient microorganism, that is, a homologous recombinant strain is produced.

The desired homologous recombination strain in this step (c) is one in which the gene-modifying plasmid is introduced upstream or downstream of the target gene by single crossover. Confirmation of whether or not the desired homologous recombination strain can be performed by utilizing the drug resistance of the recipient microorganism itself and the drug resistance derived from the gene modification plasmid. Specifically, a desired homologous recombination strain can be selected by culturing the microorganism after conjugation in a medium containing both drugs (for example, a medium containing kanamycin and chloramphenicol).

2.4. Process (d)
In the step (d), the homologous recombination strain (the homologous recombination microorganism) of the recipient microorganism produced in the step (c) is cultured under a culture condition in which the conditional lethal gene derived from the gene modifying plasmid can function. The culture conditions under which the conditional lethal gene can function are not particularly limited as long as the conditional lethal gene functions. For example, when the conditional lethal gene is the sacB gene, culture using a sucrose-containing medium is used.

  In this culture, the homologous recombination microorganism having the conditionally lethal gene is difficult to grow, so the conditionally lethal gene, drug resistance gene, conjugation transfer initiation region, replication by the second homologous recombination from the genome of the microorganism. A Rhodococcus bacterium from which the base sequence region derived from the plasmid for gene modification including the initiation region is removed (dropped out) can be obtained.

  However, among the microorganisms obtained by the culture, the target drug resistance gene in the recipient microorganism has been deleted or inactivated as originally intended, and those that are not (in the case of the above dropout). In which the function of the original drug resistance gene has been restored by homologous recombination). Therefore, the desired transformed microorganism can usually be selected by further culturing under different culture conditions.

  As another culture condition, culture under culture conditions capable of confirming the function of the drug gene is preferred, and more specifically, a strain that is impossible or extremely difficult to grow when cultured in a medium containing the drug, It can be selected as a desired Rhodococcus bacterium, that is, the microorganism of the present invention (the drug-sensitive strain). In addition, a desired microorganism can be selected by extracting a genome from a recipient microorganism and analyzing the sequence of the modified region.

Method comprising the steps (a) to (d) described above As described above, the drug-sensitive microorganism obtained by the present invention (specifically, a drug-sensitive Rhodococcus bacterium) does not leave a trace of a gene-modifying plasmid on its genome. Therefore, it is possible to modify the same strain a plurality of times by repeatedly performing the steps (b) to (d) of the present invention.

3. Protein production method The present invention provides a method for producing a protein, characterized by culturing using the aforementioned drug-sensitive strain of Rhodococcus bacteria as a host and collecting the target protein from the resulting culture. Can do. The sensitive strain used as a host is used as a transformant into which an expression vector capable of expressing a plasmid that highly expresses a certain protein, for example, nitrile hydratase, which is a catalyst for acrylamide production, is separately introduced.

  In the method for producing a protein, the method for culturing a microorganism can be performed according to a usual method.

  As a medium for cultivating microorganisms, any medium can be used as long as it contains a carbon source, nitrogen source, inorganic salts, etc. that can be assimilated by microorganisms and can efficiently cultivate microorganisms. It may be used. Examples of the carbon source include carbohydrates such as glucose, fructose, sucrose and starch, organic acids such as acetic acid and propionic acid, alcohols such as ethanol and propanol, and hydrocarbons such as hexane, decane, dodecane and tetradecane. Examples of the nitrogen source include ammonia, ammonium chloride, ammonium sulfate, ammonium acetate, ammonium salts of organic acids such as ammonium phosphate or other nitrogen-containing compounds, peptone, meat extract, corn steep liquor, and the like. Examples of the inorganic substance include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, ferrous sulfate, manganese sulfate, copper sulfate, and calcium carbonate.

  Although culture conditions are not limited, For example, it can carry out at the temperature of 10 to 45 degreeC, Preferably it is 10 to 40 degreeC for 5 to 120 hours, Preferably it is about 5 to 100 hours. In some cases, a small amount of pre-culture can be performed prior to the main culture.

  For example, when culturing using a transformant of Rhodococcus bacteria as a host, it is preferably carried out at 4 to 40 ° C., preferably 20 to 35 ° C. under aerobic conditions such as shaking culture or aeration and agitation culture. The culture is preferably timely adjusted with an inorganic or organic acid, an alkaline solution or the like.

  Further, in order to prevent the expression vector from falling off from the transformant during culturing, the culturing may be performed in a state where selective pressure is applied by a drug selection marker as necessary. For example, when a transformant transformed with a vector containing a kanamycin resistance gene is cultured, kanamycin may be added to the medium as needed during the culture.

  As described above, when cultured under an appropriate culture condition that matches the properties of the host microorganism, the heterologous protein (target protein) can be obtained in a high yield in the culture, that is, the culture supernatant, the cultured cells, or the bacteria. It can accumulate in at least one of the crushed material. These solutions containing heterologous proteins are referred to as “cultures”.

  When the target protein is produced in the microbial cells after culturing, the target protein can be used as it is, or the target protein can be collected by crushing the microbial cells. In either case, if necessary, the medium can be removed and washed by solid-liquid separation operations such as centrifugation and membrane filtration. Centrifugation is not particularly limited as long as it can supply centrifugal force for sedimentation of bacterial cells, and a cylindrical shape, a separation plate shape, or the like can be used. As a centrifugal force, it can carry out at about 500G-20,000G, for example. The membrane filtration may be either a microfiltration (MF) membrane or an ultrafiltration (UF) membrane as long as the desired solid-liquid separation can be achieved, but it is usually preferable to use a microfiltration (MF) membrane.

  The target protein can also be collected by disrupting the cells. Cell disruption methods include ultrasonic treatment, high-pressure treatment using a French press or homogenizer, grinding treatment using a bead mill, collision treatment using an impact crushing device, enzyme treatment using lysozyme, cellulase, pectinase, etc., freeze-thawing treatment, hypotonic treatment Examples include liquid treatment, lysis induction treatment with phage, and the like, and any of these methods can be used alone or in combination as necessary.

On the other hand, when the target protein is produced outside the cells, the culture solution is used as it is, or the cells are removed by centrifugation, filtration or the like as described above. Thereafter, if necessary, the target protein is collected from the culture by extraction with ammonium sulfate precipitation, and further, if necessary, dialysis, various chromatography (gel filtration, ion exchange chromatography, affinity chromatography, etc.) alone or It can also be purified by using a suitable combination.

Hereinafter, the present invention will be described more specifically by way of examples. However, the technical scope of the present invention is not limited to these examples.

Construction of plasmid pKM043 for kanamycin resistance gene deletion (production of plasmid for gene modification)
The sacB gene in pDNR-1r (manufactured by Clontech Laboratories) was amplified by PCR using primers SAC-01 (SEQ ID NO: 1) and SAC-02 (SEQ ID NO: 2) to which an NspV cleavage site was added, and about 1.9 kb A sacB gene fragment was obtained. Amplification conditions are as follows.

Primer:
SAC-01: 5'-GGTTCGAATACCTGCCGTTCACTATTATTTAGTG-3 '(SEQ ID NO: 1)
SAC-02: 5'- GGTTCGAATCGGCATTTTCTTTTGCGTTTTTATTTG -3 '(SEQ ID NO: 2)

Reaction solution composition:
Sterile water 22 μl
2 x PrimeSTAR (Takara Bio) 25 μl
SAC-01 (SEQ ID NO: 1) 1 μl
SAC-02 (SEQ ID NO: 2) 1 μl
pDNR-1r (manufactured by clontech) (100-fold dilution) 1 μl
Total volume 50 μl

Temperature cycle:
30 cycles of reaction at 98 ° C for 10 seconds, 55 ° C for 15 seconds and 72 ° C for 150 seconds

After digesting the sacB gene fragment with the restriction enzyme NspV (Takara Bio), it is connected to the NspV site of pK19mob (available from the National BioResource Project (National BioResource Project E. coli strain Cloning Vector Collection)), and the sacB gene is resistant to kanamycin A plasmid pK19mobsacB1 introduced downstream of the gene and in the same direction was constructed.

Rhodococcus rhodochrous KM-02 (National Institute of Advanced Industrial Science and Technology Patent Biological Deposit Center; Accession Number: FERM P-14457) in 100 ml of MY medium (0.5% polypeptone, 0.3% bact yeast extract, 0.3% malt extract ) And shake-cultured at 30 ° C., the genome was isolated by the method of Saito and Miura (Biochim. Biophys. Acta 72, 619 (1963)). A plasmid library was prepared by inserting the KM-02 genome incompletely digested with the restriction enzyme EcoRI into the pTrc99 multicloning site. E. coli JM109 was transformed with the plasmid library, and LB plate (1% Bact tryptone, 0.5% bact yeast extract, 1%) containing kanamycin sulfate (40 μg / ml) and IPTG (isopropyl-β-thiogalactoside) (1 mM) A transformant showing kanamycin resistance was selected using NaCl, 1.5% agar). A plasmid was extracted from this transformant and named pKM031.

pKM031 was cleaved with the restriction enzyme HindIII (manufactured by Takara Bio Inc.) to construct a plasmid pKM041 in which a fragment of about 3.3 kb containing the kanamycin resistance gene derived from the KM-02 strain and its peripheral sequence was inserted into the HindIII site of pUC18.

The entire length (about 0.5 kb) of the kanamycin resistance gene in pKM041 was deleted to obtain plasmid pKM042. Deletion was performed by PCR using primers KMD-01 (SEQ ID NO: 3) and KMD-02 (SEQ ID NO: 4) designed to anneal 10 bases on both sides of the region to be deleted. PCR amplification conditions are as follows.

Primer:
KMD-01: 5'-GACCATTGTTCCAGGTCGACTGGGACGAGT-3 '(SEQ ID NO: 3)
KMD-02: 5'-ACTCGTCCCAGTCGACCTGGAACAATGGTC-3 '(SEQ ID NO: 4)

Reaction solution composition:
Sterile water 38.5 μl
10 × PfuTurbo buffer 5 μl
dNTP (25 mM each) 3 μl
KMD-01 (SEQ ID NO: 3) 1 μl
KMD-02 (SEQ ID NO: 4) 1 μl
pKM041 1.5 μl
PfuTurbo (STRATAGENE) 1 μl
Total volume 50 μl

Temperature cycle:
95 ° C 60 seconds reaction 1 cycle, 95 ° C 50 seconds, 60 ° C 50 seconds and 72 ° C 16 minutes reaction 30 cycles, 72 ° C 7 minutes reaction 1 cycle

pKM042 was cleaved with the restriction enzyme HindIII, and the sequence around the kanamycin resistance gene was about 2.8 kb (
Plasmid pKM043 was constructed in which the kanamycin resistance gene deleted) was inserted into the HindIII site of pK19mobsacB1 (see FIG. 2).

In the above plasmid pKM043 production procedure, GFX PCR DNA band and Gel Band Purification kit (manufactured by GE Healthcare) is used for purification of DNA fragments and PCR products cleaved by restriction enzymes, and DNA Ligation Kit <Mighty Mix for DNA-to-DNA connection. > (Manufactured by Takara Bio Inc.), and QIAprep miniprep kit (manufactured by QIAGEN) was used for plasmid extraction.

Drug resistance-enhanced mutant with natural mutagenesis: Production of RhCm ^SR- 01 strain (production of recipient microorganism)
Rhodococcus rhodochrous ATCC 12674 strain is subcultured in a medium containing a higher concentration of chloramphenicol to induce spontaneous mutation and tolerant to 200 mg / L chloramphenicol Strain RhCm ^SR- 01 strain was isolated. Details of the subculture are as follows.

ATCC 12674 strain MYK plate containing 10 mg / L chloramphenicol (0.5% polypeptone, 0.3% bact yeast extract, 0.3% malt extract, 0.2% KH ₂ PO ₄ , 0.2% K ₂ HPO ₄ , 1.5% agar) And inoculated at 30 ° C. for 3 days. The grown colonies were inoculated into MYK medium (0.5% polypeptone, 0.3% bact yeast extract, 0.3% malt extract, 0.2% KH ₂ PO ₄ , 0.2% K ₂ HPO ₄ ) containing 10 mg / L chloramphenicol. And cultured for 2 days at 30 ° C. and 200 rpm. Next, 0.1% of the culture solution was inoculated into MYK medium containing 40 mg / L chloramphenicol and cultured at 30 ° C. and 200 rpm for 2 days.

The subculture was repeated while gradually increasing the chloramphenicol concentration, and finally the culture solution was inoculated on a MYK plate containing 200 mg / L chloramphenicol. If the growth rate was slow during subculture, the number of days of culture was extended by 2-3 days. The number of subcultures is 4 (chloramphenicol content: subculture in the order of 10, 40, 100, 200 (mg / ml)). The appearing colony was further inoculated twice on a MYK plate containing 200 mg / L chloramphenicol to form a single colony, thereby isolating the RhCm ^SR- 01 strain.

ATCC 12674 Kanamycin-sensitive strain: Production of RhΔKm-01 strain Escherichia coli S17-1λpir was transformed with pKM043 and grown overnight at 37 ° C. on a 50 mg / L kanamycin sulfate-containing LB plate. S17-1λpir / pKM043 was suspended in LB medium, centrifuged (room temperature, 4500 ppm, 2 min), and the cells were collected, washed once with LB, and resuspended in LB.

RhCm ^SR- 01 was plated on a MYK plate and cultured at 30 ° C. for 3 days. About tens of colonies on the MYK plate are scraped off and suspended in 0.9% NaCl, centrifuged (room temperature, 15000 ppm, 2 min), and the cells are collected, washed once with 0.9% NaCl, and reconstituted in LB. Suspended.

The two suspensions were gently mixed at a ratio of 1: 1, inoculated on an LB plate, and cultured overnight at 30 ° C. (conjugate transfer of pKM043). Since one of the target gene and the selectable marker is a kanamycin resistance gene, selection was performed at a kanamycin concentration at which a wild strain cannot normally grow. For actual selection, a MYK plate (0.5% polypeptone, 0.3% bact yeast extract, 0.3% malt extract, 0.2% KH ₂ PO ₄ , 0.2%) containing kanamycin sulfate 200 mg / L and chloramphenicol 50 mg / L K ₂ HPO ₄ , 1.5% agar) was used.

  After confirming by plasmid PCR that plasmid pKM043 has been introduced into the genome by homologous recombination, use sacB counter-selection system (WO 01/31050) by culturing on MYK plate containing 10% sucrose ), The pK19mobsacB1-derived sequence was removed from the ATCC 12674 genome. By replica plating on a kanamycin-containing LB plate, a kanamycin sensitive strain RhΔKm-01 that could not grow under conditions containing 10 mg / L kanamycin sulfate was successfully isolated (see FIG. 3A). As a result of genome analysis of the wild strain and the RhΔKm-01 strain by PCR, it was confirmed that the region corresponding to the kanamycin resistance gene length of about 0.5 kb was deleted from the genome in the RhΔKm-01 strain (FIG. 3B). reference).

Application to other kanamycin-resistant Rhodococcus bacteria
Rhodococcus erythropolis PR4 (Biological Resource Division, National Institute of Technology and Evaluation; Accession Number: NBRC 100887), whose entire genome sequence is published on DB, also has a homolog of the kanamycin resistance gene possessed by ATCC 12674. As a result of the homology search, the kanamycin resistance genes of both strains showed high homology of 96.1% match (base sequence), so gene deletion using pKM043 was performed. LB or an LB plate was used as a base medium for culturing at each stage.

Since PR4 was also confirmed to have weak chloramphenicol resistance like other ATCC 12674, a mutant strain showing resistance to 120 mg / L Cm in the same manner as in Example 2. RhCm ^SR- 09 was prepared and isolated. The number of subcultures is 7 (chloramphenicol content: passage in the order of 10, 20, 30, 60, 80, 100, 120 (mg / ml)).

  A kanamycin sensitive strain RhΔKm-10 was isolated by the same method as in Example 3 (see FIG. 4A). It was confirmed that the kanamycin resistance gene was deleted from the genome of RhΔKm-10 (see FIG. 4B).

SEQ ID NO: 1 synthetic DNA
Sequence number 2: Synthetic DNA
Sequence number 3: Synthetic DNA
Sequence number 4: Synthetic DNA

Claims (8)

A method for producing a microorganism exhibiting sensitivity to a drug by deleting or inactivating a target drug resistance gene in Rhodococcus bacteria, comprising the following steps (a) to (d): The method that is performed by the method:
  (A) producing a Rhodococcus bacterium with enhanced donor microorganism growth inhibition marker as a recipient microorganism;
  (B) as a donor microorganism, (i) a base sequence region in which the resistance gene is deleted or inactivated in the base sequence including the target drug resistance gene in the recipient microorganism and the surrounding base sequence, (ii A gene comprising a conjugative transfer initiation region that functions in the donor microorganism, (iii) a replication initiation region that functions in the donor microorganism, (iv) a recipient microorganism growth inhibition marker, and (v) a conditional lethal gene for the recipient microorganism. Producing a microorganism transformed with the modifying plasmid;
  (C) producing a transformant of the recipient microorganism by performing conjugation transfer from the donor microorganism produced in (b) to the recipient microorganism produced in (a); and
  (D) A step of culturing the transformant prepared in (c) under a culture condition in which the conditionally lethal gene can function. The method according to claim 1, wherein the genus Rhodococcus is Rhodococcus rhodochrous or Rhodococcus erythropolis. The method according to claim 1 or 2, wherein the deleted or inactivated drug resistance gene is a kanamycin resistance gene. A protein production comprising producing a microorganism by the method according to any one of claims 1 to 3, culturing the microorganism as a host, and collecting a target protein from the obtained culture. Method. In a Rhodococcus bacterium, a microorganism exhibiting sensitivity to the drug by deleting or inactivating the target drug resistance gene ,
The microorganism in which the deletion or inactivation is carried out by a method including the following steps (a) to (d) using conjugative transfer from a donor microorganism to a recipient microorganism:
(A) producing a Rhodococcus bacterium with enhanced donor microorganism growth inhibition marker as a recipient microorganism;
(B) as a donor microorganism, (i) a base sequence region in which the resistance gene is deleted or inactivated in the base sequence including the target drug resistance gene in the recipient microorganism and the surrounding base sequence, (ii A gene comprising a conjugative transfer initiation region that functions in the donor microorganism, (iii) a replication initiation region that functions in the donor microorganism, (iv) a recipient microorganism growth inhibition marker, and (v) a conditional lethal gene for the recipient microorganism. Producing a microorganism transformed with the modifying plasmid;
(C) producing a transformant of the recipient microorganism by performing conjugation transfer from the donor microorganism produced in (b) to the recipient microorganism produced in (a); and
(D) A step of culturing the transformant prepared in (c) under a culture condition in which the conditionally lethal gene can function. The microorganism according to claim 5 , wherein the Rhodococcus bacterium is Rhodococcus rhodochrous or Rhodococcus erythropolis. The microorganism according to any one of claims 5 and 6 , wherein the deleted or inactivated drug resistance gene is a kanamycin resistance gene . A method for producing a protein, comprising culturing the microorganism according to any one of claims 5 to 7 as a host and collecting a target protein from the obtained culture.