CN109722455B

CN109722455B - Method for producing glutacoside by microbial fermentation, engineering bacteria and application

Info

Publication number: CN109722455B
Application number: CN201711051707.5A
Authority: CN
Inventors: 冯进辉; 陈曦; 姚培圆; 刘娜; 张瑞; 李雪梅; 吴洽庆; 朱敦明; 马延和; 张峥斌
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Zhejiang Xianju Junye Pharmaceutical Co ltd; Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2017-10-31
Filing date: 2017-10-31
Publication date: 2022-03-11
Anticipated expiration: 2037-10-31
Also published as: CN109722455A

Abstract

The invention provides a method for producing valerolactone by microbial fermentation, a valerolactone production engineering bacterium and application. The method for producing a sitosteroid by microbial fermentation includes producing a sitosterol by fermentation of a sterol using a sitosterol-producing bacterium, characterized in that the sitosterol-producing bacterium has at least one fatty acid coenzyme A/carboxylate reductase capable of catalyzing the reaction I of the following compounds I to II, and the method includes inhibiting the activity and/or expression level of at least one of the fatty acid coenzyme A/carboxylate reductases in the sitosterol-producing bacterium:

Description

Method for producing glutacoside by microbial fermentation, engineering bacteria and application

Technical Field

The invention belongs to the field of microbial fermentation, and particularly relates to a method for producing valerolactone by microbial fermentation, engineering bacteria and application.

Background

Steroids (also known as sterols) are a class of compounds having a cyclopentane polyhydrophenanthrene ring structure, typically having methyl groups at the C-10 and C-13 positions and an alkyl side chain at the C-17 position, and are represented by the following formula III. Steroids, as a component of cell membranes, have important roles in organisms. Some steroids also have hormonal and signaling molecule roles. Since the discovery of steroid drugs in the 50's last century, over 300 steroid drugs have been identified so far. The steroid medicine has strong pharmacological actions of resisting infection, anaphylaxis, virus and shock. In recent years, steroid drugs have been widely used in the medical field for the treatment of rheumatism, cardiovascular diseases, collagenous diseases, lympholeukemia, organ transplantation, tumor, bacterial encephalitis, skin diseases, endocrine disorders, senile diseases, etc., and steroid hormone drugs have become the second largest class of drugs to antibiotics.

According to the steroid chemistry progress (Zhouweishan, Manzhiping, eds., published by scientific Press 2002, ISBN 7-03-009607-X), many microorganisms including Nocardia (Nocardia), Mycobacterium (Mycobacterium), Arthrobacter (Arthrobocter), and Pseudomonas (Pseudomonas) can oxidize all the steroid mother nucleus cyclopentane phenanthrene and side chains into carbon dioxide and water. The metabolic pathways of steroids are illustrated by Sih and its co-workers (ref. "Sih CJ, Tai HH, Tson YY, Lee SS, Coombe RG. mechanisms of steroid oxidation by microorganisms. XIV. pathway of cholesterol side-chain degradation. biochemistry.1968; 7: 808-18.", "Sih CJ, Tai HH, Tson YY. the mechanism of microbial conversion of cholesterol inter 17-ketone, J Am Chem. 1967; 89: 1957-8." and "Sih CJ, Wang KC, Tai HH. mechanisms of steroid oxidation by microorganisms. 1967. Cnid. 227. the linkage of cholesterol side-chain degradation. Cnid. 798. Biochemical of the biochemical degradation of FIG. 796. 7. This process shows that important intermediates such as 4AD (compound 15), ADD (compound 16), 9-OH-AD and valerolactone (compound 24) can be obtained by controlling the activities of different enzymes during the microbial degradation process. According to Bergey's Manual of systematic bacteriology, widely used in the study of microorganisms, Rhodococcus has many of the same characteristics as Mycobacterium and Nocardia, and has been classified as Mycobacterium. In 2012, a sterol degradation gene cluster similar to that of mycobacteria was found in Rhodococcus (see the literature "Mohn WW, Wilbrink MH, Casabon I, Stewart GR, Liu J, van der Geize R, et al, Gene Cluster encoding cholesterol in Rhodococcus spp. J Bacteriol. 2012; 194: 6712-9"), and thus it was considered that Rhodococcus has a sterol metabolic pathway consistent with that described in FIG. 1.

The method is characterized in that the valerolactone ((4aR,6aS,9aS,9bS) -6 a-methyl octahydrocyclopenta [ f ] chromene-3, 7(2H,8H) -diketone) is an important intermediate of steroid metabolic pathways, and a valerolactone production strain is obtained by traditional mutation breeding in the prior art, so that the valerolactone can be produced by fermentation. For example, Nakamatsu et al prepared the valerolactone using Nocardia corallina (Nocardia coralline) IFO 3338 mutant strain, but the molar yield was only 25% (refer to "Nakamatsu R, Beppu T, Arima K. Microbiological degradation of sterods to hexahydroindene derivatives. agric Biol chem.1980,44: 1469-74"); ferreira et al prepared valerolactone using Rhodococcus australis CSIR-236.457 mutant with a molar yield of 60% and approximately 63% at substrate concentrations of 6-12g/L (ref. "Ferreira NP, Robson PM, Bull JR, van der Walt EW. the microbial production of 3a α -H-4 α - (3' -propionic acid) -5 α -hydroxy-7a β -methylhexahydro-inden-L-one- δ -olefin from cholesterol. Biotech letters.1984,6: 517-22."). However, the molar yield achieved by these existing fermentative production strains of valerolactone is still low and there are many by-products, resulting in difficulty in separation and purification and high production cost, which results in high price of related steroid drugs.

Disclosure of Invention

In order to solve the problems in the prior art, the invention provides a method for producing the valerolactone by microbial fermentation, engineering bacteria and application.

Specifically, the present invention provides:

(1) a method for producing a sitolactone by microbial fermentation, comprising producing the sitolactone from sterol by fermentation using a sitolactone-producing microorganism, wherein the sitolactone-producing microorganism has at least one fatty acid coa/carboxylate reductase capable of catalyzing reaction I of the following compounds I to II, and the method comprises inhibiting activity and/or expression amount of at least one of the fatty acid coa/carboxylate reductases in the sitolactone-producing microorganism, the reaction being:

wherein, "-X" is hydroxy or carbonyl; "-Y" is hydroxyl or "-SCoA".

(2) The method according to (1), wherein the lactonolactone-producing bacteria include actinomycetes (actinomycetes) and Pseudomonas (Pseudomonas); preferably, the actinomycetes include Rhodococcus (Rhodococcus), Nocardia (Nocardia), Mycobacterium (Mycobacterium), Streptomyces (Streptomyces) and Arthrobacter (Arthrobacter).

(3) The method of (1), wherein the amino acid sequence of the fatty acid coenzyme A/carboxylate reductase is shown as

SEQ ID NO

2, 4, 13 or 14.

(4) The method of (1), wherein the inhibition is effected by gene knockout or gene mutation.

(5) The process according to (1), wherein the fermentative production is carried out at 25 to 45 ℃ at a pH of 7 to 8 for 3 to 12 days.

(6) An engineered bacterium for producing a glutamate-coa/carboxylate reductase which inhibits the activity and/or expression level of at least one fatty acid-coa/carboxylate reductase, wherein the fatty acid-coa/carboxylate reductase is capable of catalyzing the reactions I:

wherein, "-X" is hydroxy or carbonyl; "-Y" is hydroxyl or "-SCoA".

(7) The engineered bacterium for producing a glutamic acid lactone according to (6), wherein the glutamic acid lactone-producing bacterium comprises actinomycetes (actinomycetes) and Pseudomonas (Pseudomonas); preferably, the actinomycetes include Rhodococcus (Rhodococcus), Nocardia (Nocardia), Mycobacterium (Mycobacterium), Streptomyces (Streptomyces) and Arthrobacter (Arthrobacter).

(8) The engineered bacterium for producing valerolactone according to (6), wherein the amino acid sequence of fatty acid coenzyme A/carboxylate reductase is shown in

SEQ ID NO

2, 4, 13 or 14.

(9) The engineered bacterium for producing valerolactone according to (8), wherein the inhibition is achieved by gene knock-out or gene mutation.

(10) Use of the engineered bacterium for producing valerolactone according to any one of (6) to (9) in the fermentation production of valerolactone.

(11) The use according to (10), wherein the fermentative production is carried out at 25 to 45 ℃ and at a pH of 7 to 8 for 3 to 12 days.

(12) Use of a fatty acid coenzyme a/carboxylic acid reductase for catalyzing the reaction I of the following compounds I to II:

wherein, "-X" is hydroxy or carbonyl; "-Y" is hydroxyl or "-SCoA".

(13) The use according to (12), wherein the amino acid sequence of the fatty acid coenzyme A/carboxylate reductase is as shown in

SEQ ID NO

2, 4, 13 or 14.

(14) The use according to (12), wherein the catalysis is carried out at pH 7-10, 25-45 ℃.

Compared with the prior art, the invention has the following advantages and positive effects:

the invention discloses an enzyme catalyzing the side reaction of the synthesis of the valactone in the steroid metabolic pathway by analyzing the metabolic pathway of the valactone producing bacteria, which is named as fatty acid coenzyme A/carboxylic acid reductase according to the substrate of the valactone, the enzyme has important influence on the production of the valactone, inhibits the activity and/or expression quantity of the enzyme, can improve the substrate conversion rate during the fermentation production of the valactone, reduces or blocks the generation of byproducts, ensures that the products are easy to separate and purify, and reduces the production cost.

Drawings

FIG. 1 shows the metabolic pathways of sterols in microorganisms.

FIG. 2 shows the up/down PCR results for the car1 gene; wherein

lanes

1 and 2 are upstream fragments; 3 and 4 are downstream fragments; m is a molecular weight marker.

FIG. 3 shows the up/down PCR results for the car2 gene; wherein

lanes

FIG. 4 shows the results of single restriction validation of the car1 and car2 knock-out plasmids PacI; wherein

lanes

1 and 2 are car1 knock-out plasmids; 3 and 4 are car2 knock-out plasmids; m is a molecular weight marker.

FIG. 5 shows the results of the car2 knockout PCR validation; wherein lanes 1-7 are the verification strains, and

lanes

5 and 6 are the successful knockout strains; m is a molecular weight marker.

FIG. 6 shows the results of the car1 knockout PCR validation; wherein lanes 1-6 are the verification strains, and

lanes

3 and 4 are the successful gene knockout strains; m is a molecular weight marker.

Figure 7 shows a gas chromatogram of a glutamate standard.

FIG. 8 shows a gas chromatogram of a fermentation extract of wild-type Mycobacterium.

FIG. 9 shows a gas chromatogram of fermentation extracts of car1 and car2 double knockout mycobacteria.

FIG. 10 shows an overlay of FIGS. 7 and 8; the solid line is the glutamic lactone standard and the dotted line is the fermentation extract of wild type mycobacteria.

FIG. 11 shows an overlay of FIGS. 7 and 9; the solid line shows the glutamic acid lactone standard and the dotted line shows the extracts from the fermentation of the two-gene knockout mycobacteria car1 and car 2.

The abscissa of fig. 7 to 11 is retention time, and the ordinate is response signal value mAu.

Detailed Description

The present invention is further described in the following description of the embodiments with reference to the drawings, which are not intended to limit the invention, and those skilled in the art may make various modifications or improvements based on the basic idea of the invention, but within the scope of the invention, unless departing from the basic idea of the invention.

According to the invention, the metabolic pathway of the gluconolactone-producing strain is analyzed through a large amount of research and analysis, so that an enzyme catalyzing the side reaction of the gluconolactone synthesis in the steroid metabolic pathway is discovered. As shown in FIG. 1, in the steroid metabolic pathway of the gluconolactone-producing bacteria, the upstream products of the gluconolactone (compound 24) are compound 21(HIP (1, 5-dioxo-7 a β -methyl-3 a α -hexahydroindan-4 α -propionic acid)) and 23 (5-OH-HIP). The invention discloses an enzyme which takes

compounds

21 and 23 and a coenzyme A form (namely a compound I) thereof as substrates to catalyze a side reaction of the synthesis of the valerolactone, and obtains the nucleotide and amino acid sequences of the enzyme. From the NCBI database, such enzymes are generally annotated as oxidoreductases, or as fatty acyl-CoA dehydrogenases. However, the present inventors have for the first time found that such enzymes are capable of catalyzing the reduction of

compounds

21, 23, see formulae i-v, and have therefore found a new use for such enzymes. The present invention designates fatty acid coenzyme A/carboxylic acid reductase according to the reaction substrate and type of the enzyme. In addition, the present inventors have found that a glutamic acid lactone-producing bacterium has one or more (for example, 2, 3 or 4) fatty acid CoA/carboxylate reductases capable of catalyzing the above reaction, and the homology of the amino acid sequences of these enzymes is 45% to 100%. Therefore, the invention provides that the reaction catalyzed by the enzyme has important influence on the production of the valerolactone, the activity and/or expression quantity of the enzyme is inhibited, the substrate conversion rate during the fermentation production of the valerolactone can be improved, the generation of byproducts is reduced or blocked, the products are easy to separate and purify, and the production cost is reduced.

On the basis of the above findings, the present invention provides a method for producing a sitosteroid by microbial fermentation, comprising producing a sitosterol from a sterol by fermentation using a sitosterol-producing bacterium, characterized in that the sitosterol-producing bacterium has at least one fatty acid-coa/carboxylate reductase capable of catalyzing reaction I of the following compounds I to II, and the method comprises inhibiting the activity and/or expression amount of at least one of the fatty acid-coa/carboxylate reductases in the sitosterol-producing bacterium:

wherein, "-X" is hydroxy or carbonyl; "-Y" is hydroxyl or "-SCoA".

The term "inhibit" as used herein in reference to an activity and/or expression level of an enzyme means to reduce the activity and/or expression level of the enzyme as compared to the native state, or to inactivate and/or not express the enzyme completely.

It will be appreciated by those skilled in the art that in the presence of more than one fatty acid-CoA/carboxylate reductase which catalyses the reaction, inhibition of one or all of the fatty acid-CoA/carboxylate reductases may be effective in reducing the overall activity and/or expression of the fatty acid-CoA/carboxylate reductase enzyme by the said glutamate producing strain. It is preferable to inhibit the activity and/or expression level of each of the fatty acid-CoA/carboxylic acid reductases in a glutamate producing fungus.

It was found that the metabolic pathways of the steroid-derived glutaminolide of Rhodococcus (Rhodococcus), Nocardia (Nocardia), Mycobacterium (Mycobacterium), Streptomyces (Streptomyces) and Arthrobacter (Arthrobacter), and Pseudomonas (Pseudomonas) all involve the above-mentioned reactions 1 to 4 of fatty acid coenzyme A/carboxylic acid reductase. Thus, the said lactonolactone-producing bacteria include actinomycetes (actinomycetes) and Pseudomonas (Pseudomonas). Preferably, the actinomycetes include Rhodococcus (Rhodococcus), Nocardia (Nocardia), Mycobacterium (Mycobacterium), Streptomyces (Streptomyces) and Arthrobacter (Arthrobacter).

In the methods of the invention, the inhibition may be achieved by any method known in the art. For example, by knocking out or mutating a gene encoding the enzyme. The manner of gene mutation includes, for example, insertion mutation, deletion mutation, frameshift mutation, substitution mutation and point mutation. These methods can be performed using procedures and operations conventional in the art.

Preferably, the amino acid sequence of the fatty acid coenzyme A/carboxylate reductase is shown as

SEQ ID NO

2, 4, 13 or 14.

In a specific embodiment, the fatty acid coenzyme A/carboxylate reductase catalyzes the following reactions ii-v:

in a specific embodiment, the fatty acid-CoA/carboxylate reductase comprises fatty acid-CoA/

carboxylate reductase

1 and 2, wherein the amino acid sequence of fatty acid-CoA/carboxylate reductase 1 is set forth in SEQ ID NO. 2, and the amino acid sequence of fatty acid-CoA/carboxylate reductase 2 is set forth in SEQ ID NO. 4. .

In another specific embodiment, the fatty acid-CoA/carboxylate reductase comprises fatty acid-CoA/

carboxylate reductase

3 and 4, the amino acid sequence of fatty acid-CoA/carboxylate reductase 3 is set forth in SEQ ID NO 13, and the amino acid sequence of fatty acid-CoA/carboxylate reductase 4 is set forth in SEQ ID NO 14.

In the process of the invention, the fermentation may be carried out under any suitable conditions. The fermentation is preferably carried out at 25-45 deg.C, more preferably at 25-37 deg.C. The pH during fermentation is preferably 7 to 8. The fermentation is preferably carried out for 3 to 12 days, for example for 3 to 10 days, more preferably for 4 to 10 days. The fermentation inoculum size of the said glutamic lactone producing strain can be adjusted at will according to the specific application and conditions, and can be, for example: OD of seed liquid of glutamic lactone producing strain_600nm(OD at 600 nm) of 1 to 20 (for example, 10) and a volume of 1 to 20% of the fermentation broth. One skilled in the art can, for example, inoculate a larger volume of seed solution when the OD value is low; when the OD value is high, a smaller volume of seed liquid can be inoculated.

The invention also provides a glutamate producing engineering bacterium, which is characterized in that the activity and/or expression level of at least one fatty acid coenzyme A/carboxylic acid reductase in the glutamate producing engineering bacterium is inhibited, wherein the fatty acid coenzyme A/carboxylic acid reductase can catalyze the reactions I of the following compounds I to II:

wherein, "-X" is hydroxy or carbonyl; "-Y" is hydroxyl or "-SCoA".

preferably, the said glutamate producing bacteria comprise actinomycetes (actinomycetes) and Pseudomonas (Pseudomonas). More preferably, the actinomycetes include Rhodococcus (Rhodococcus), Nocardia (Nocardia), Mycobacterium (Mycobacterium), Streptomyces (Streptomyces) and Arthrobacter (Arthrobacter).

carboxylate reductase

1 and 2, wherein the amino acid sequence of fatty acid-CoA/carboxylate reductase 1 is set forth in SEQ ID NO. 2, and the amino acid sequence of fatty acid-CoA/carboxylate reductase 2 is set forth in SEQ ID NO. 4.

carboxylate reductase

As noted above, the inhibition can be achieved by any method known in the art. For example, by knocking out or mutating a gene encoding the enzyme. The manner of gene mutation includes, for example, insertion mutation, deletion mutation, frameshift mutation, substitution mutation and point mutation. These methods can be performed using procedures and operations conventional in the art.

The invention also provides application of the engineering bacteria for producing the valerolactone in fermentation production of the valerolactone.

The fermentation takes sterol as a fermentation raw material. The fermentation is preferably carried out at 25-45 deg.C, more preferably at 25-37 deg.C. The pH during fermentation is preferably 7 to 8. The fermentation is preferably carried out for 3 to 12 days, for example for 3 to 10 days, more preferably for 4 to 10 days. The fermentation inoculum size of the said glutamic lactone producing strain can be adjusted at will according to the specific application and conditions, and can be, for example: OD of seed liquid of glutamic lactone producing strain_600nm(OD at 600 nm) of 1 to 20 (for example, 10) and a volume of 1 to 20% of the fermentation broth. One skilled in the art can, for example, inoculate a larger volume of seed solution when the OD value is low; when the OD value is high, a smaller volume of seed liquid can be inoculated.

The invention also provides fatty acid coenzyme a/carboxylate reductases for catalyzing the reactions I:

wherein, "-X" is hydroxy or carbonyl; "-Y" is hydroxyl or "-SCoA".

SEQ ID NO

2, 4, 3 or 14.

carboxylate reductase

Preferably, the catalysis is carried out at pH 7-10, 25-45 ℃. The pH of the catalytic reaction is more preferably 9-9.5 and the temperature is more preferably 25 ℃.

The reaction time can be determined according to the actual application, the substrate concentration and the enzyme amount. For example, when the substrate concentration is 10mM and the enzyme amount is 0.5mg/ml, the reaction time may be 4 to 48 hours.

The present invention will be further explained or illustrated below by way of examples, which should not be construed as limiting the scope of the invention.

Examples of the present invention

Unless otherwise indicated, the experimental procedures used in the following examples were performed using conventional experimental protocols, procedures, materials and conditions known in the art.

Example 1: construction of Gene knockout plasmid

The nucleotide sequence of fatty acid coenzyme A/carboxylic acid reductase 1(car1) is shown in SEQ ID NO. 1, and the nucleotide sequence of fatty acid coenzyme A/carboxylic acid reductase 2(car2) is shown in SEQ ID NO. 3. The car1 knockout plasmid and the car2 knockout plasmid were constructed respectively as follows.

PCR amplification was performed using car1 and car2 as templates, respectively. The PCT system and primers are as follows.

And (3) PCR system:

PCR procedure: 3 minutes at 98 ℃; denaturation at 98 ℃ for 10 seconds, annealing at 58 ℃ for 20 seconds, extension at 72 ℃ for 30 seconds, and 30 cycles; 10 minutes at 72 ℃. Wherein the primer sequence is as follows:

for car 1:

an upstream fragment primer:

Up-F：5'TGTTGCCATTGCTGCAGGCATCTCGCACCATCAGC 3'(SEQ ID NO:5)

Up-R：5'AGGTCACTTGGTCGAGCCAGCGCCGCCTGATTCTC 3'(SEQ ID NO:6)

downstream fragment primers:

Down-F：5'CAGCGCCGCCTGATTCTCGCTCGACCAAGTGACCTG 3'(SEQ ID NO:7)

Down-R：5'CGCGGCCGCTTAATTAACGATCGGCTTGCTCTAGG 3'(SEQ ID NO:8)

for car 2:

an upstream fragment primer:

Up-F：5'TGTTGCCATTGCTGCAGGATCAGACTCACAGCACATTG 3'(SEQ ID NO:9)

Up-R：5'GATCTTCGTGGTGAGCGCGGCGAGCGAGGCATACAG 3'(SEQ ID NO:10)

downstream fragment primers:

Down-F：5'CTGTATGCCTCGCTCGCCGCGCTCACCACGAAGATC 3'(SEQ ID NO:11)

Down-R：5'CGCGGCCGCTTAATTAAGGTTCCCCTGAGCAAATC 3'(SEQ ID NO:12)

the amplification results are shown in FIGS. 2 and 3. The amplified upstream and downstream fragments were ligated to the fragment in pGOAL19 (selection of the fragment and ligation to the fragment was performed as described in "Parish T, Stoker NG. use of a flexible cassette method to generate a double unmarked Mycobacterium tuberculosis flap A plc microorganism by gene replacement.Microbiology.2000,146: 1969-75") and p2NIL vector. The ligation products were transformed into DH 5. alpha. competent cells and plated on Kan, Hyg double resistant LB plates (tryptone: 10g/L, yeast extract: 5g/L, sodium chloride: 10g/L, Kan: 50. mu.g/ml, Hyg: 50. mu.g/ml, agar: 1.6%) with IPTG and X-Gal added and cultured overnight at 37 ℃. After selecting blue single colony for culture, the quality-improved grains are subjected to PacI single enzyme digestion verification (figure 4), and sequencing proves that the plasmid is successfully constructed.

Example 2: screening for knockout strains

The constructed knock-out plasmid was electroporated into competent cells of Mycobacterium (ATCC) (from American Type Culture Collection (ATCC), Strain No. ATCC6841), coated with Kan-resistant LB plates (tryptone: 10g/L, yeast extract: 5g/L, sodium chloride: 10g/L, Kan: 50. mu.g/ml, agar: 1.6%) and subjected to the first screening with IPTG and X-gal. From these, blue single colonies were picked up on a sucrose plate (tryptone: 10g/L, yeast extract: 5g/L, sucrose: 10g/L, agar: 1.6%) (IPTG and X-gal were added) and subjected to secondary screening. White colonies were picked Up on a sucrose plate to a liquid LB medium, cultured at 30 ℃ for about 36 hours, and then the genome was extracted and verified by PCR using Up-F, Down-R of the target gene as a primer. If the gene knockout was successful, the PCR product should be a single fragment of about 2 kbp. FIG. 5 shows a Mycobacterium strain in which the car2 gene knockout was successfully obtained, and FIG. 6 shows a Mycobacterium strain in which the car1 gene knockout was successfully obtained. The single-gene knock-out strain was subjected to the above transfection and strain screening procedures to obtain a double-gene-knock-out strain of car1 and car 2.

Example 3: fermentation production of glutacon

Seed culture medium:

glucose: 6 g/L; yeast powder: 15 g/L; NaNO₃: 5.4 g/L; glycerol: 2 g/L; NH (NH)₄H₂PO₄: 0.6 g/L; the pH value is 7.5; sterilizing at 115 deg.C for 30 min.

Fermentation medium:

NaNO₃：6.37g/L；KH₂PO₄：1.05g/L；Na₂HPO₄：2.14g/L；MgSO₄：0.82g/L；KCl：0.21g/L；CaCl₂: 0.1 g/L; dry corn steep liquor powder: 14.23 g/L; phytosterol: 20 g/L; soybean oil: 12 percent; the pH value is 7.8; sterilizing at 121 deg.C for 30 min.

Fermentation culture:

the double gene knock-out strain obtained in example 2 and the wild type Mycobacterium strain (ATCC 6841) were activated respectively by culturing on LB plate (tryptone: 10g/L, yeast extract: 5g/L, sodium chloride: 10g/L, agar: 1.6%) at 30 ℃ for 72 hours to activate the strain;

inoculating the strain from the activated plate to a seed culture medium, and culturing at 30 ℃ for 3 days at 180rpm to obtain a seed solution;

sampling the seed liquid under the aseptic condition, and performing sampling microscopic examination, wherein the microscopic examination is aseptic and can be used for inoculation;

inoculating into 3L fermentation medium with 10% (v/v) inoculation amount;

fermenting and culturing at 500rpm and 30 ℃ with the aeration ratio of 0.5vvm, the pH value of the whole fermentation process between 7 and 8, without control, and fermenting and culturing for 120 hours;

in the early stage of fermentation, because an oil system exists, the substrate phytosterol can be agglomerated, so that sampling is not carried out in the early stage, and sampling is carried out at regular time for detection after the system becomes uniform. Specifically, sampling 50ml every 8 hours, heating at 80 ℃ for 5 minutes, adding sodium hydroxide to adjust the pH to be higher than 12, cooling, removing an organic phase, adding hydrochloric acid into a water phase to adjust the pH to be lower than 2, adding 5 times volume of ethyl acetate, uniformly stirring for 30 minutes, and separating to obtain an ethyl acetate crude extract of the glutacoside. Measuring the content of the glutacolide and the residual amount of the phytosterol in the crude extract by adopting a Gas Chromatography (GC) method. The GC analysis conditions were: the chromatographic column is Agilent DB-5, the carrier gas is helium, the split ratio is 20:1, the flow rate is 2 ml/min, the temperature is kept for 5 min at 150 ℃, and then the temperature is increased to 250 ℃ at the speed of 5 ℃/min; then raising the temperature to 295 ℃ at the speed of 40 ℃/min and keeping the temperature for 10 min; the detector is a flame ion detector. When the conversion rate of the reaction for biotransformation of phytosterol to sitolactone (i.e., (added phytosterol-residual phytosterol)/added phytosterol ≥ 95%) reaches 95%, the fermentation is terminated.

Adjusting the pH of the whole fermented system to 10 with NaOH, after oil and water are separated, adjusting the pH of the water phase to 2 with HCl, and extracting with ethyl acetate for 3-5 times until the extraction is complete. The whole extract phase volume was recorded and quantified by making a Gas Chromatography (GC) Valactone standard curve to obtain the whole fermentation yield. Specifically, the fermentation broth was heated at 80 ℃ for 5 minutes and adjusted to pH above 10 by the addition of sodium hydroxide. And after cooling, removing the organic phase, adding hydrochloric acid into the water phase to adjust the pH to be less than 2, adding 5 times volume of ethyl acetate, uniformly stirring for 30 minutes, and separating to obtain the ethyl acetate crude extract of the valerolactone. Measuring the content of the glutamic lactone in the crude extract by adopting a Gas Chromatography (GC) method. The GC analysis conditions were: the chromatographic column is Agilent DB-5, the carrier gas is helium, the split ratio is 20:1, the flow rate is 2 ml/min, the temperature is kept for 5 min at 150 ℃, and then the temperature is increased to 250 ℃ at the speed of 5 ℃/min; then the temperature was raised to 295 ℃ at a rate of 40 ℃/min and held for 10 minutes. The detector is a flame ion detector. The content of the valerolactone in the crude extract was calculated by peak area using an external standard method, and then the molar yield of the valerolactone was calculated by calculating the total mass of the valerolactone in the reaction solution (see table 1). The gas chromatography results are shown in FIGS. 7 to 11.

Table 1: fermentation tank validation results

And (3) separating and purifying the glutamic lactone product in the fermentation liquor of the gene knockout mycobacterium, and respectively carrying out product separation H spectrum, C spectrum and mass spectrum identification. The identification conditions are as follows: the H spectrum and the C spectrum are identified by using Bruker AVANCE III 600MHz, and the mass spectrum is identified by using Bruker microOTOF-Q II direct injection.

As a result:

and (3) spectrum H of fermentation liquor separation product:

¹H NMR(CD₃Cl,400MHz)δ(ppm)4.53(q,,J＝2.8,5.2Hz,1H),2.45-2.60(m,3H),2.05-2.17(m,4H),1.90-2.01(m,1H),3.62(t,J＝6.0Hz,1H),1.71-1.87(m,3H),1.52-1.69(m,3H),0.91(s,3H)。

c spectrum of fermentation liquor separation product:

¹³C NMR(CD₃Cl,100MHz)δ(ppm)218.9,172.2,77.9,47.5,41.8,35.3,32.6,26.7,26.5,26.4,21.5,21.1,12.8。

mass spectrum of fermentation liquor separation product:

theoretical value of HR-MS (ES +) C₁₃H₁₉O₃(M + H): 223.1334; 223.1355 is detected.

The result proves that the product obtained by fermenting the phytosterol by the modified strain is the valerolactone.

Example 4: fermentation production of glutelin by using single gene knockout strain

The single knockout strain constructed in example 2 was activated and cultured according to the method described in example 3, and fermentation culture and detection analysis were performed according to the method described in example 3. The results are shown below:

table 2: single knockout strain fermentation tank verification results

Example 5:

according to the method described in example 2, strains with single and double knockout of car1 and car2, respectively, were constructed in Mycobacterium (Mycobacterium neoaurum) (NRRL B-3683) in which the amino acid sequences of car1 and car2 are shown in SEQ ID NOS: 13 and 14, respectively. Primers for gene knock-out were as follows:

for car 1:

an upstream fragment primer:

Up-F：5'ACGTTGTTGCCATTGCTGCAGAGCAGTGAGGCCTGCCGTTG 3'(SEQ ID NO:15)

Up-R：5'GACACAGCTCAACTTCGTCCCAGTACTGGGAACTGGCAGACAAACACCTG 3'(SEQ ID NO:16)

downstream fragment primers:

Down-F：5'GGTGTTTGTCTGCCAGTTCCCAGTACTGGGACGAAGTTGAGCTGTGTCGG 3'(SEQ ID NO:17)

Down-R：5'CTTAATTAAGCGGCCGCGGTACCCGCCGAAAATCTTGATGACCAGC 3'(SEQ ID NO:18)

for car 2:

an upstream fragment primer:

Up-F：5'ACGTTGTTGCCATTGCTGCAGTGCGATGTGACGGTCACGGTATC 3'(SEQ ID NO:19)

Up-R：5'TAGCGCGCGAAGTGCTGTGTAGTACTCAGCATCTCGGCAAGTCGCATTC 3'(SEQ ID NO:20)

downstream fragment primers:

Down-F：5'TGCGACTTGCCGAGATGCTGAGTACTACACAGCACTTCGCGCGCTACCC 3'(SEQ ID NO:21)

Down-R：5'CTTAATTAAGCGGCCGCGGTACCTCGCCGAGCTGCTGGATGAGATG 3'(SEQ ID NO:22)

fermentation cultures and assay assays were performed separately as described in example 3. The results are shown below:

table 3: verification result of NRRL B-3683 knockout strain fermentation tank

Strain NRRL B-3683 was originally used to produce compound 16 shown in FIG. 1, and NRRL B-3683 was used to catalyze the 9-position hydroxylase from compound 16 to 17 with lower activity, and thus lower molar conversion of the valerolactone. However, from the fermentation results shown in table 3, it was found that the molar conversion rate of the bacterium to produce sitosterol from phytosterol was significantly improved after the fatty acid coa/carboxylate reductases car1 and/or car2 were knocked out.

SEQUENCE LISTING

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> method for producing glutacolide through microbial fermentation, engineering bacteria and application

<130> FI-174043-59:52/C

<160> 22

<170> PatentIn version 3.5

<210> 1

<211> 3471

<212> DNA

<213> Mycobacterium fortuitum

<400> 1

atgaccaccg aaacgcgtga agaccggttg caacgccgga tcgcacacct gtatgaagcc 60

gactcacagt tcgccgcggc ccgtcccagc gaggctgtca acaccgccgt cgccgagccc 120

gagctgcggt tgccggctgt cgtcaaaggc gtgttcgccg gctacgccga ccgtcccgcg 180

ctgggacagc gcgccgtcga gtacgtcacc gacgccgacg gccgcacgtc ggcccagctg 240

ctcccccggt tcgacaccat cacgtaccgc cagttgggcg accgcgtcca agcggtgacc 300

aacgcctggc acaaccaccc ggtgaagccc ggcgaccgcg tcgccatcct ggggttcacc 360

agcgtcgact acaccactgt cgacaccgcg ctgatcgaac tcggtgccgt atcggtgccg 420

ctgcagacca gtgcgccggt aaccaccctg cgccccatcg tcgccgagac ggaaccgacc 480

gtgatcgcgg cgagcatcga cttcctcgac gacgcggtcg aactggtgaa gtccggccct 540

gcaccccggc gcctggtggt gttcgactac cgcccgcggg tcgacgctca gcgtgaagcc 600

ttcgaagccg ccaaggccgc actggccggc accgatgtcg tcgtcgaacc gctggccgac 660

gtcctcgacc gcggccgctc actggccgac gcaccgctgt acacccccgg tcagcccgac 720

ccgctgacca tgctgatcta cacctccggc agcaccggca cccccaaggg cgcgatgtac 780

ccggagagca aggtcgccaa catgtggcag ctggccacca aggccacctg ggacgagaat 840

caggcggcgc tgccggcgat caccctcaac ttcatgccga tgagccacgt catgggccgc 900

ggcatcttga tcggcacgct gagctccggt ggcaccgcgt atttcgctgc gcgcagcgac 960

ctttcgacct tcctggagga cctagccctg gtccggccca cgcagctgag cttcgtgccc 1020

cggatctggg acatgctgtt tcaggagtac cagagccggt tggatcgcag cggagcaccg 1080

gaagacgaag tcctcgccga ggttcgccag gacctgctgg gcgggcggtt cgtctccgcg 1140

atgaccggtt ccgcgccgat ctcggcggag atgaagaact gggtggagcg cctgctcgac 1200

atgcacctgc tggagggcta cggctccacc gaggcaggtt cggtcttcgt cgacggccac 1260

atccagcgcc cgccggtgat cgactacaag ttggtcgacg tgccggacct gggctacttc 1320

cttaccgacc ggccccaccc gcgtggtgag ctgctggtga agtccgagca gatgttcccc 1380

gggtactaca agcgcccgga gatcaccgcc gagatgttcg acgaggacgg ctactaccgc 1440

accggtgaca tcgtcgccga actcggacca gaccaggtcg aatacctcga ccggcgcaac 1500

aacgtgctga agctctcgca gggcgaattc gtcaccgtct ccaagctgga ggccgtcttc 1560

ggagacagcc cgctggtacg gcagatcttc gtctacggca acagcgcccg ctcgtatctg 1620

ctggccgtcg tggtgccgac cgatccgtcc ctgtcgaagc aggcgatcgg cgattcactg 1680

caggacgccg cgcgggccgc gggtctgcag tcctacgaga tcccacgcga tttcatcgtc 1740

gagacaacgc ccttcagcct ggagaacggc ctgctgaccg gcatccgcaa gctggctcgg 1800

ccgaatctga aggcctacta cggcgatcgg ttggagcagc tttacacgga gctggccgag 1860

ggtcaggcca atgaactgag cgagctgcgg cgcaacggcg cccaggcccc ggtgctcgac 1920

acggtgagcc gggccgcagg tgccctgctg ggtgccgcgg catccgacct cgcccccgag 1980

gcccacttca ccgatctggg tggagattcg ttgtcggcct tgaccttcgg aaacctcctg 2040

caggagatct tcgacgtcga ggtgccggtg tcggcgatcg tcagcccggc ctcggatctt 2100

cggaccatcg ccgagtacat cgaggctcaa cgctcgggcg ccgatgtgcg gccgaccttc 2160

acgtcggtgc acggccgcaa cgcgaccgaa gtccacgcat ccgatctgac gctggacaaa 2220

ttcatcgacg ccgcgacatt ggccgccgca ccgagcctgc cgggcccggt cagtgagatc 2280

cgtaccgtac tgctcaccgg cgcaaccgga ttcctgggtc gctacttggc cctggagtgg 2340

ctggaacgga tggacctggt cgacggcaag gtcatctgcc tggtgcgcgc gaagtcggac 2400

gaggaagccc gcgcgcggct cgacaagacc ttcgacagcg gcgaccccaa gctgtgggcg 2460

cactaccaga aactggccgc cgaccatctc gaagtgatcg ccggcgacaa gggcgaggcc 2520

gatctcgggc tcgaccaagt gacctggcag cgtctggccg acaccgtcga tttcatcgtc 2580

gacccggccg cactggtcaa ccacgtgctg ccctacagcg aactgttcgg ccccaacgca 2640

cttggcactg ctgagctcat ccggatcgcg ctcaccacgc gcatcaagcc gttcgcgtac 2700

gtgtcgacga tcggcgtggg cggcggtatc gagccaggaa agttcgtgga ggccggggat 2760

attcgagcca tcagtccggt tcgacgcgtc gacgacggct acgccaacgg ctacggcaac 2820

agcaagtggg ccggcgaggt gctactgcgc gaagcgcacg atctggccgg gctgccggtg 2880

acggtgttcc gctgcgacat gatcctggcg gacaccacct acgccgggca gttgaacctg 2940

ccggacatgt tcacccgcat gatgttcagc ctcgtcgcca ccggtgtcgc accgaagtcc 3000

ttcaaccagc tcgacgccga cggcaaccga cagcgctcgc actacgacgg gctgcccgtc 3060

gagttcatcg ccgaggccat ctcaaccctg ggcgcccacg tccaggacgg cttcgagacg 3120

taccacgtga tgaacccgca cgacgacggc atcggcatgg acgagttcgt cgactggctc 3180

atcgaggccg gctacccgat ccagcgagtg gaggactacc aggagtggtt ggcccgcttc 3240

gagaccacgc tgcgggcact gcccgacaag caacgtcagg cctcgctgct gccgctgctg 3300

cacaactacc agcagcccgg cgtgccggtg aacggcgcga tggcaccgac cgacgtgttc 3360

cgtaccgcag tgcaggacgc gaagatcggg cccgacaagg acatccccca tgtcagccgg 3420

gaggtcatcg tcaagtacat cagcgatctg aaactgctcg gattgctgta a 3471

<210> 2

<211> 1156

<212> PRT

<213> Mycobacterium fortuitum

<400> 2

Met Thr Thr Glu Thr Arg Glu Asp Arg Leu Gln Arg Arg Ile Ala His

1 5 10 15

Leu Tyr Glu Ala Asp Ser Gln Phe Ala Ala Ala Arg Pro Ser Glu Ala

20 25 30

Val Asn Thr Ala Val Ala Glu Pro Glu Leu Arg Leu Pro Ala Val Val

35 40 45

Lys Gly Val Phe Ala Gly Tyr Ala Asp Arg Pro Ala Leu Gly Gln Arg

50 55 60

Ala Val Glu Tyr Val Thr Asp Ala Asp Gly Arg Thr Ser Ala Gln Leu

65 70 75 80

Leu Pro Arg Phe Asp Thr Ile Thr Tyr Arg Gln Leu Gly Asp Arg Val

85 90 95

Gln Ala Val Thr Asn Ala Trp His Asn His Pro Val Lys Pro Gly Asp

100 105 110

Arg Val Ala Ile Leu Gly Phe Thr Ser Val Asp Tyr Thr Thr Val Asp

115 120 125

Thr Ala Leu Ile Glu Leu Gly Ala Val Ser Val Pro Leu Gln Thr Ser

130 135 140

Ala Pro Val Thr Thr Leu Arg Pro Ile Val Ala Glu Thr Glu Pro Thr

145 150 155 160

Val Ile Ala Ala Ser Ile Asp Phe Leu Asp Asp Ala Val Glu Leu Val

165 170 175

Lys Ser Gly Pro Ala Pro Arg Arg Leu Val Val Phe Asp Tyr Arg Pro

180 185 190

Arg Val Asp Ala Gln Arg Glu Ala Phe Glu Ala Ala Lys Ala Ala Leu

195 200 205

Ala Gly Thr Asp Val Val Val Glu Pro Leu Ala Asp Val Leu Asp Arg

210 215 220

Gly Arg Ser Leu Ala Asp Ala Pro Leu Tyr Thr Pro Gly Gln Pro Asp

225 230 235 240

Pro Leu Thr Met Leu Ile Tyr Thr Ser Gly Ser Thr Gly Thr Pro Lys

245 250 255

Gly Ala Met Tyr Pro Glu Ser Lys Val Ala Asn Met Trp Gln Leu Ala

260 265 270

Thr Lys Ala Thr Trp Asp Glu Asn Gln Ala Ala Leu Pro Ala Ile Thr

275 280 285

Leu Asn Phe Met Pro Met Ser His Val Met Gly Arg Gly Ile Leu Ile

290 295 300

Gly Thr Leu Ser Ser Gly Gly Thr Ala Tyr Phe Ala Ala Arg Ser Asp

305 310 315 320

Leu Ser Thr Phe Leu Glu Asp Leu Ala Leu Val Arg Pro Thr Gln Leu

325 330 335

Ser Phe Val Pro Arg Ile Trp Asp Met Leu Phe Gln Glu Tyr Gln Ser

340 345 350

Arg Leu Asp Arg Ser Gly Ala Pro Glu Asp Glu Val Leu Ala Glu Val

355 360 365

Arg Gln Asp Leu Leu Gly Gly Arg Phe Val Ser Ala Met Thr Gly Ser

370 375 380

Ala Pro Ile Ser Ala Glu Met Lys Asn Trp Val Glu Arg Leu Leu Asp

385 390 395 400

Met His Leu Leu Glu Gly Tyr Gly Ser Thr Glu Ala Gly Ser Val Phe

405 410 415

Val Asp Gly His Ile Gln Arg Pro Pro Val Ile Asp Tyr Lys Leu Val

420 425 430

Asp Val Pro Asp Leu Gly Tyr Phe Leu Thr Asp Arg Pro His Pro Arg

435 440 445

Gly Glu Leu Leu Val Lys Ser Glu Gln Met Phe Pro Gly Tyr Tyr Lys

450 455 460

Arg Pro Glu Ile Thr Ala Glu Met Phe Asp Glu Asp Gly Tyr Tyr Arg

465 470 475 480

Thr Gly Asp Ile Val Ala Glu Leu Gly Pro Asp Gln Val Glu Tyr Leu

485 490 495

Asp Arg Arg Asn Asn Val Leu Lys Leu Ser Gln Gly Glu Phe Val Thr

500 505 510

Val Ser Lys Leu Glu Ala Val Phe Gly Asp Ser Pro Leu Val Arg Gln

515 520 525

Ile Phe Val Tyr Gly Asn Ser Ala Arg Ser Tyr Leu Leu Ala Val Val

530 535 540

Val Pro Thr Asp Pro Ser Leu Ser Lys Gln Ala Ile Gly Asp Ser Leu

545 550 555 560

Gln Asp Ala Ala Arg Ala Ala Gly Leu Gln Ser Tyr Glu Ile Pro Arg

565 570 575

Asp Phe Ile Val Glu Thr Thr Pro Phe Ser Leu Glu Asn Gly Leu Leu

580 585 590

Thr Gly Ile Arg Lys Leu Ala Arg Pro Asn Leu Lys Ala Tyr Tyr Gly

595 600 605

Asp Arg Leu Glu Gln Leu Tyr Thr Glu Leu Ala Glu Gly Gln Ala Asn

610 615 620

Glu Leu Ser Glu Leu Arg Arg Asn Gly Ala Gln Ala Pro Val Leu Asp

625 630 635 640

Thr Val Ser Arg Ala Ala Gly Ala Leu Leu Gly Ala Ala Ala Ser Asp

645 650 655

Leu Ala Pro Glu Ala His Phe Thr Asp Leu Gly Gly Asp Ser Leu Ser

660 665 670

Ala Leu Thr Phe Gly Asn Leu Leu Gln Glu Ile Phe Asp Val Glu Val

675 680 685

Pro Val Ser Ala Ile Val Ser Pro Ala Ser Asp Leu Arg Thr Ile Ala

690 695 700

Glu Tyr Ile Glu Ala Gln Arg Ser Gly Ala Asp Val Arg Pro Thr Phe

705 710 715 720

Thr Ser Val His Gly Arg Asn Ala Thr Glu Val His Ala Ser Asp Leu

725 730 735

Thr Leu Asp Lys Phe Ile Asp Ala Ala Thr Leu Ala Ala Ala Pro Ser

740 745 750

Leu Pro Gly Pro Val Ser Glu Ile Arg Thr Val Leu Leu Thr Gly Ala

755 760 765

Thr Gly Phe Leu Gly Arg Tyr Leu Ala Leu Glu Trp Leu Glu Arg Met

770 775 780

Asp Leu Val Asp Gly Lys Val Ile Cys Leu Val Arg Ala Lys Ser Asp

785 790 795 800

Glu Glu Ala Arg Ala Arg Leu Asp Lys Thr Phe Asp Ser Gly Asp Pro

805 810 815

Lys Leu Trp Ala His Tyr Gln Lys Leu Ala Ala Asp His Leu Glu Val

820 825 830

Ile Ala Gly Asp Lys Gly Glu Ala Asp Leu Gly Leu Asp Gln Val Thr

835 840 845

Trp Gln Arg Leu Ala Asp Thr Val Asp Phe Ile Val Asp Pro Ala Ala

850 855 860

Leu Val Asn His Val Leu Pro Tyr Ser Glu Leu Phe Gly Pro Asn Ala

865 870 875 880

Leu Gly Thr Ala Glu Leu Ile Arg Ile Ala Leu Thr Thr Arg Ile Lys

885 890 895

Pro Phe Ala Tyr Val Ser Thr Ile Gly Val Gly Gly Gly Ile Glu Pro

900 905 910

Gly Lys Phe Val Glu Ala Gly Asp Ile Arg Ala Ile Ser Pro Val Arg

915 920 925

Arg Val Asp Asp Gly Tyr Ala Asn Gly Tyr Gly Asn Ser Lys Trp Ala

930 935 940

Gly Glu Val Leu Leu Arg Glu Ala His Asp Leu Ala Gly Leu Pro Val

945 950 955 960

Thr Val Phe Arg Cys Asp Met Ile Leu Ala Asp Thr Thr Tyr Ala Gly

965 970 975

Gln Leu Asn Leu Pro Asp Met Phe Thr Arg Met Met Phe Ser Leu Val

980 985 990

Ala Thr Gly Val Ala Pro Lys Ser Phe Asn Gln Leu Asp Ala Asp Gly

995 1000 1005

Asn Arg Gln Arg Ser His Tyr Asp Gly Leu Pro Val Glu Phe Ile

1010 1015 1020

Ala Glu Ala Ile Ser Thr Leu Gly Ala His Val Gln Asp Gly Phe

1025 1030 1035

Glu Thr Tyr His Val Met Asn Pro His Asp Asp Gly Ile Gly Met

1040 1045 1050

Asp Glu Phe Val Asp Trp Leu Ile Glu Ala Gly Tyr Pro Ile Gln

1055 1060 1065

Arg Val Glu Asp Tyr Gln Glu Trp Leu Ala Arg Phe Glu Thr Thr

1070 1075 1080

Leu Arg Ala Leu Pro Asp Lys Gln Arg Gln Ala Ser Leu Leu Pro

1085 1090 1095

Leu Leu His Asn Tyr Gln Gln Pro Gly Val Pro Val Asn Gly Ala

1100 1105 1110

Met Ala Pro Thr Asp Val Phe Arg Thr Ala Val Gln Asp Ala Lys

1115 1120 1125

Ile Gly Pro Asp Lys Asp Ile Pro His Val Ser Arg Glu Val Ile

1130 1135 1140

Val Lys Tyr Ile Ser Asp Leu Lys Leu Leu Gly Leu Leu

1145 1150 1155

<210> 3

<211> 3492

<212> DNA

<213> Mycobacterium fortuitum

<400> 3

atgtcgtttg atactcgcga tgagcaactg gcgacccgta tcgccgatct gaccgccacc 60

gatccacagt tcgccgccgc gataccgagc gacaccgtca ccgcctccgt agacgtgccc 120

ggcctgcttc tgcccgagat cgtgcagagg gttctggagg gctacgccga acggcccgcg 180

ctcggcgagc gcgcgctcga attcgtggcc gaccctgcca cggggcgcac cactgctcgc 240

ctgctccccc ggttcgacac catcagctac ggccaggtgt gggaccgggt gcgcgccctc 300

gccgcagcgc tgcacgcctc gggcgtcgca gccggcgacc gggtcgcgat cctgggtttc 360

accagtgctg actacaccgt gatcgacacg gcgctcggcc agatcggcgc ggtgtcggtg 420

cccctgcaga ccagctcctc gcccgaggcg ctggcgccga tcgtgaccga gaccgagcct 480

cgggtgatcg cggcgagtgt cgaccacctc gccgatgccg tcgagctcgc gctcaccgct 540

cacgctccgg cccaactcgt cgtcttcgac caccaccccg agatcgatga ccatcgcgag 600

gccgtggcat cggccgccga gaggatcacc gcagcaggcg catccatcgc cgtcgacacg 660

ctggccggac tgctggaccg cggaagcaac ctcccggcac ccgaggcgcc caaggcggac 720

ggctccgacc ccttggcgtt gctgatctac acctccggca gcaccggcgc tcccaagggc 780

gcgatgtacc tgcagagcgc cgtggccaag ttctggcgtc gcaacagcaa ggcctggctc 840

gggccggtca gctcggcgat caacctgagc ttcatgccga tgagccacgt gatgggccgc 900

ggcatcctgt atgcctcgct cgccgccggc ggcacctgct acttcgccgc ccgcagcgac 960

ctgtcgacac tgctggagga cctcgccctg acgcggccca ccgagctgaa tttcgtccca 1020

cgcgtctggg agatgatcca cagcgaatat cagagccggg tcgatcagcg tctggccgag 1080

ggcggccggg accgtgaggc cgtcgaagcg gaggtgttgg ccgaggtccg cgacaaggtg 1140

ctcggcggcc gcttcgtcgc cgccatgacc ggctcggcac ccatctcagc cgagctcaag 1200

acctggaccc aggacatgct cggcatccac ctgctggagg gctacggctc gaccgaagcc 1260

ggcatggcac tgttcgacgg tgtcgtgcag cgtccgccgg tgatcgacta caagttggtc 1320

gacgtcccgg acctcgggta cttcggcacc gaccagcctc acccgcgcgg cgagttgctg 1380

atcaagaccg agaacctgtt ccccggctac tacaagcgtc ccgaggtcac cgcgtcggtg 1440

ttcgacgagg acggcttcta ccgcaccggt gacgtcgtcg cagagatcgg cccggaccag 1500

ctgcgctacg tcgaccggcg caacaacgtg ctcaagctcg cccagggcga gttcgtcacc 1560

ctggccaagc tggaagccgt gttcggcaac agtccactgg tgcaacagat ctacgtctac 1620

ggcaacagcg cccagcccta cctgctggcc gtcgtggtac ccacggatcc gagcgtttcc 1680

aaagaggcga tcgccgagtc cctgcaagag gtggcccggg aggccgacct gcagtcctac 1740

gagatcccgc gcgacttcat cgtggagaca acaccgttca gcctcgagaa cggtctgctg 1800

accggtatcc gcaagctggc gtggccgaag ttgaaggcgc actacggcga gcggctcgag 1860

cagctgtatg ccgagctggc cgagacgcag gccgccgaac ttcgcgagtt gcgttcggcg 1920

agtgccgacg cccccgtggt ggaaaccgtc agccgggctg ccggtgccct gctgggcgcc 1980

gcggcatccg acctggggcc tgacgcccac ttcaccgacc tgggtgggga ttccttgtcg 2040

gcgttgacct tcggcaacct gcttcgggag atcttcgatg tggatgtgcc ggtgggcgtg 2100

atcgtcagcc cggccaccga cctggccggc atcgccgagt acatcgagac ccagcgcagc 2160

ggatccaagc gcccgaccta cgcgtcggtg cacggcaggc acgccgccga agtcagtgcg 2220

gccgacctga ccctggacaa gttcctcgac gccgacaccc tggccgccgc accgaacctg 2280

cccaaggcag gcagcgaggt tcggaccgtg ctgctcaccg gcgccaccgg cttcctcggc 2340

cgctacttgg cgctggaatg gctggagcgc atggacctgg tcgacggcaa ggtcatcgcg 2400

ctggtgcgcg ccaagtccga cgaggaggcc cggacccggc tcgacgccac cttcgacagc 2460

ggtgacgcga aactccttgc gcactaccag aatctggccg ctgaccacct cgaagtggtt 2520

gccggcgaca agggcgagga gaacctcggc ctggatcagc agacctggca gcggctcgcc 2580

gacgaggtcg acctgatcgt cgacccggcc gcactggtca accacgtgct gccctacagc 2640

gaactgttcg gccccaacgc actgggcacc gccgagctga tcaagatcgc gctcaccacg 2700

aagatcaagc cgtacaccta cgtgtcgacc atcggcgtcg gcgatcagat cgagcccggg 2760

aagttcgtcg agaacgtcga cgtccgggag atgagtgcgg tccgcaagat caacgatggg 2820

tacgccaacg gttacggcaa cagcaagtgg gcgggtgagg ttttgctgcg cgaggccaac 2880

gatctgtgcg ggctgccggt cgcggtgttc cgctgcgaca tgatcctggc cgacacctcc 2940

tactcgggcc agctgaactt gccggacatg ttcacccgca tgatgctgag cctcgtcgcc 3000

agcggtatcg cgccgaagtc cttctacgag ctggattccg aaggcaaccg ccagcgctca 3060

cattacgacg gtctgcccgt cgagttcatc gccgagtcga tctcgacgtt gggcgggcaa 3120

tcggtcgaga gcttcgagac ctaccacgtg atgaacccgt acgacgacgg cctcggcatg 3180

gacgagttcg tcgactggct catcgaggcc ggctacccga tcgagcgcat cgaggattac 3240

gggcagtggg tccagcgctt cgagagcacc ttgcgcgccc tgccggacaa gcagcgtcag 3300

gcgtcgctgt tgccgctgct gcacaactac cagaagcccg agcggccgat gctgggcgcc 3360

ctggcgccca cggaccactt ccgtgcggcg gtgcaggaag ccaagatcgg gcccgacaag 3420

gacattcccc atgtcagccc ggcagtgatc gtcaagtaca tcaccgacct gcagcagctc 3480

ggcctgctct ag 3492

<210> 4

<211> 1163

<212> PRT

<213> Mycobacterium fortuitum

<400> 4

Met Ser Phe Asp Thr Arg Asp Glu Gln Leu Ala Thr Arg Ile Ala Asp

1 5 10 15

Leu Thr Ala Thr Asp Pro Gln Phe Ala Ala Ala Ile Pro Ser Asp Thr

20 25 30

Val Thr Ala Ser Val Asp Val Pro Gly Leu Leu Leu Pro Glu Ile Val

35 40 45

Gln Arg Val Leu Glu Gly Tyr Ala Glu Arg Pro Ala Leu Gly Glu Arg

50 55 60

Ala Leu Glu Phe Val Ala Asp Pro Ala Thr Gly Arg Thr Thr Ala Arg

65 70 75 80

Leu Leu Pro Arg Phe Asp Thr Ile Ser Tyr Gly Gln Val Trp Asp Arg

85 90 95

Val Arg Ala Leu Ala Ala Ala Leu His Ala Ser Gly Val Ala Ala Gly

100 105 110

Asp Arg Val Ala Ile Leu Gly Phe Thr Ser Ala Asp Tyr Thr Val Ile

115 120 125

Asp Thr Ala Leu Gly Gln Ile Gly Ala Val Ser Val Pro Leu Gln Thr

130 135 140

Ser Ser Ser Pro Glu Ala Leu Ala Pro Ile Val Thr Glu Thr Glu Pro

145 150 155 160

Arg Val Ile Ala Ala Ser Val Asp His Leu Ala Asp Ala Val Glu Leu

165 170 175

Ala Leu Thr Ala His Ala Pro Ala Gln Leu Val Val Phe Asp His His

180 185 190

Pro Glu Ile Asp Asp His Arg Glu Ala Val Ala Ser Ala Ala Glu Arg

195 200 205

Ile Thr Ala Ala Gly Ala Ser Ile Ala Val Asp Thr Leu Ala Gly Leu

210 215 220

Leu Asp Arg Gly Ser Asn Leu Pro Ala Pro Glu Ala Pro Lys Ala Asp

225 230 235 240

Gly Ser Asp Pro Leu Ala Leu Leu Ile Tyr Thr Ser Gly Ser Thr Gly

245 250 255

Ala Pro Lys Gly Ala Met Tyr Leu Gln Ser Ala Val Ala Lys Phe Trp

260 265 270

Arg Arg Asn Ser Lys Ala Trp Leu Gly Pro Val Ser Ser Ala Ile Asn

275 280 285

Leu Ser Phe Met Pro Met Ser His Val Met Gly Arg Gly Ile Leu Tyr

290 295 300

Ala Ser Leu Ala Ala Gly Gly Thr Cys Tyr Phe Ala Ala Arg Ser Asp

305 310 315 320

Leu Ser Thr Leu Leu Glu Asp Leu Ala Leu Thr Arg Pro Thr Glu Leu

325 330 335

Asn Phe Val Pro Arg Val Trp Glu Met Ile His Ser Glu Tyr Gln Ser

340 345 350

Arg Val Asp Gln Arg Leu Ala Glu Gly Gly Arg Asp Arg Glu Ala Val

355 360 365

Glu Ala Glu Val Leu Ala Glu Val Arg Asp Lys Val Leu Gly Gly Arg

370 375 380

Phe Val Ala Ala Met Thr Gly Ser Ala Pro Ile Ser Ala Glu Leu Lys

385 390 395 400

Thr Trp Thr Gln Asp Met Leu Gly Ile His Leu Leu Glu Gly Tyr Gly

405 410 415

Ser Thr Glu Ala Gly Met Ala Leu Phe Asp Gly Val Val Gln Arg Pro

420 425 430

Pro Val Ile Asp Tyr Lys Leu Val Asp Val Pro Asp Leu Gly Tyr Phe

435 440 445

Gly Thr Asp Gln Pro His Pro Arg Gly Glu Leu Leu Ile Lys Thr Glu

450 455 460

Asn Leu Phe Pro Gly Tyr Tyr Lys Arg Pro Glu Val Thr Ala Ser Val

465 470 475 480

Phe Asp Glu Asp Gly Phe Tyr Arg Thr Gly Asp Val Val Ala Glu Ile

485 490 495

Gly Pro Asp Gln Leu Arg Tyr Val Asp Arg Arg Asn Asn Val Leu Lys

500 505 510

Leu Ala Gln Gly Glu Phe Val Thr Leu Ala Lys Leu Glu Ala Val Phe

515 520 525

Gly Asn Ser Pro Leu Val Gln Gln Ile Tyr Val Tyr Gly Asn Ser Ala

530 535 540

Gln Pro Tyr Leu Leu Ala Val Val Val Pro Thr Asp Pro Ser Val Ser

545 550 555 560

Lys Glu Ala Ile Ala Glu Ser Leu Gln Glu Val Ala Arg Glu Ala Asp

565 570 575

Leu Gln Ser Tyr Glu Ile Pro Arg Asp Phe Ile Val Glu Thr Thr Pro

580 585 590

Phe Ser Leu Glu Asn Gly Leu Leu Thr Gly Ile Arg Lys Leu Ala Trp

595 600 605

Pro Lys Leu Lys Ala His Tyr Gly Glu Arg Leu Glu Gln Leu Tyr Ala

610 615 620

Glu Leu Ala Glu Thr Gln Ala Ala Glu Leu Arg Glu Leu Arg Ser Ala

625 630 635 640

Ser Ala Asp Ala Pro Val Val Glu Thr Val Ser Arg Ala Ala Gly Ala

645 650 655

Leu Leu Gly Ala Ala Ala Ser Asp Leu Gly Pro Asp Ala His Phe Thr

660 665 670

Asp Leu Gly Gly Asp Ser Leu Ser Ala Leu Thr Phe Gly Asn Leu Leu

675 680 685

Arg Glu Ile Phe Asp Val Asp Val Pro Val Gly Val Ile Val Ser Pro

690 695 700

Ala Thr Asp Leu Ala Gly Ile Ala Glu Tyr Ile Glu Thr Gln Arg Ser

705 710 715 720

Gly Ser Lys Arg Pro Thr Tyr Ala Ser Val His Gly Arg His Ala Ala

725 730 735

Glu Val Ser Ala Ala Asp Leu Thr Leu Asp Lys Phe Leu Asp Ala Asp

740 745 750

Thr Leu Ala Ala Ala Pro Asn Leu Pro Lys Ala Gly Ser Glu Val Arg

755 760 765

Thr Val Leu Leu Thr Gly Ala Thr Gly Phe Leu Gly Arg Tyr Leu Ala

770 775 780

Leu Glu Trp Leu Glu Arg Met Asp Leu Val Asp Gly Lys Val Ile Ala

785 790 795 800

Leu Val Arg Ala Lys Ser Asp Glu Glu Ala Arg Thr Arg Leu Asp Ala

805 810 815

Thr Phe Asp Ser Gly Asp Ala Lys Leu Leu Ala His Tyr Gln Asn Leu

820 825 830

Ala Ala Asp His Leu Glu Val Val Ala Gly Asp Lys Gly Glu Glu Asn

835 840 845

Leu Gly Leu Asp Gln Gln Thr Trp Gln Arg Leu Ala Asp Glu Val Asp

850 855 860

Leu Ile Val Asp Pro Ala Ala Leu Val Asn His Val Leu Pro Tyr Ser

865 870 875 880

Glu Leu Phe Gly Pro Asn Ala Leu Gly Thr Ala Glu Leu Ile Lys Ile

885 890 895

Ala Leu Thr Thr Lys Ile Lys Pro Tyr Thr Tyr Val Ser Thr Ile Gly

900 905 910

Val Gly Asp Gln Ile Glu Pro Gly Lys Phe Val Glu Asn Val Asp Val

915 920 925

Arg Glu Met Ser Ala Val Arg Lys Ile Asn Asp Gly Tyr Ala Asn Gly

930 935 940

Tyr Gly Asn Ser Lys Trp Ala Gly Glu Val Leu Leu Arg Glu Ala Asn

945 950 955 960

Asp Leu Cys Gly Leu Pro Val Ala Val Phe Arg Cys Asp Met Ile Leu

965 970 975

Ala Asp Thr Ser Tyr Ser Gly Gln Leu Asn Leu Pro Asp Met Phe Thr

980 985 990

Arg Met Met Leu Ser Leu Val Ala Ser Gly Ile Ala Pro Lys Ser Phe

995 1000 1005

Tyr Glu Leu Asp Ser Glu Gly Asn Arg Gln Arg Ser His Tyr Asp

1010 1015 1020

Gly Leu Pro Val Glu Phe Ile Ala Glu Ser Ile Ser Thr Leu Gly

1025 1030 1035

Gly Gln Ser Val Glu Ser Phe Glu Thr Tyr His Val Met Asn Pro

1040 1045 1050

Tyr Asp Asp Gly Leu Gly Met Asp Glu Phe Val Asp Trp Leu Ile

1055 1060 1065

Glu Ala Gly Tyr Pro Ile Glu Arg Ile Glu Asp Tyr Gly Gln Trp

1070 1075 1080

Val Gln Arg Phe Glu Ser Thr Leu Arg Ala Leu Pro Asp Lys Gln

1085 1090 1095

Arg Gln Ala Ser Leu Leu Pro Leu Leu His Asn Tyr Gln Lys Pro

1100 1105 1110

Glu Arg Pro Met Leu Gly Ala Leu Ala Pro Thr Asp His Phe Arg

1115 1120 1125

Ala Ala Val Gln Glu Ala Lys Ile Gly Pro Asp Lys Asp Ile Pro

1130 1135 1140

His Val Ser Pro Ala Val Ile Val Lys Tyr Ile Thr Asp Leu Gln

1145 1150 1155

Gln Leu Gly Leu Leu

1160

<210> 5

<211> 35

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

tgttgccatt gctgcaggca tctcgcacca tcagc 35

<210> 6

<211> 35

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

aggtcacttg gtcgagccag cgccgcctga ttctc 35

<210> 7

<211> 36

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

cagcgccgcc tgattctcgc tcgaccaagt gacctg 36

<210> 8

<211> 35

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

cgcggccgct taattaacga tcggcttgct ctagg 35

<210> 9

<211> 38

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

tgttgccatt gctgcaggat cagactcaca gcacattg 38

<210> 10

<211> 36

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

gatcttcgtg gtgagcgcgg cgagcgaggc atacag 36

<210> 11

<211> 36

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

ctgtatgcct cgctcgccgc gctcaccacg aagatc 36

<210> 12

<211> 35

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 12

cgcggccgct taattaaggt tcccctgagc aaatc 35

<210> 13

<211> 1149

<212> PRT

<213> Mycobacterium (Mycobacterium neoaurum)

<400> 13

Met Phe Ala Glu Asn Leu Asp Asp Gln Gln Arg Leu Ala Asp Leu Tyr

1 5 10 15

Ala Thr Asp Pro Glu Phe Ala Ala Ala Ala Pro Asp Pro Ala Ile Ala

20 25 30

Asp Ala Val Ala Ala Pro Glu Met Arg Leu Pro Glu Ile Ile Arg Thr

35 40 45

Val Leu Thr Gly Tyr Ala Glu Arg Pro Ala Leu Gly Ser Arg Ala Val

50 55 60

Gln Leu Val Thr Asp Glu Ala Thr Gly Arg Thr Arg Ala Glu Leu Leu

65 70 75 80

Gly His Phe Glu Thr Ile Thr Tyr Gly Gln Leu Trp Asp Arg Val Arg

85 90 95

Ala Val Thr Asn Ala Trp Ser Asp Thr Val Arg Pro Gly Asp Arg Val

100 105 110

Ala Ile Leu Gly Phe Gly Ser Val Asp Phe Thr Val Ile Asp Ile Ala

115 120 125

Leu Thr Gln Leu Gly Ala Val Ser Val Pro Leu Gln Thr Ser Ala Thr

130 135 140

Ala Ala Ala Leu Ala Pro Ile Val Ala Glu Thr Glu Pro Ala Leu Ile

145 150 155 160

Ala Ser Asp Val Asn His Leu Asp Asp Ala Val Thr Leu Ala Leu Glu

165 170 175

Ser Gly Val Ala Thr Val Val Val Phe Asp Gln Asn Pro Ala Val Asp

180 185 190

Asp Asp Arg Glu Ala Ile Ala Ala Ala Thr Ala Arg Leu Asp Gly Gln

195 200 205

Thr Leu Ala Thr Leu Asp Glu Val Ile Ala Ala Gly Ala Glu Arg Pro

210 215 220

Asp Val Ala Ile Pro Ala Gln Glu Gly Asp Pro Leu Ser Leu Leu Ile

225 230 235 240

Tyr Thr Ser Gly Ser Thr Gly Ala Pro Lys Gly Ala Met Tyr Pro Gln

245 250 255

Gly Lys Val Ala Asp Ile Trp Arg Pro Ala Ile Asn Ser His Trp Asp

260 265 270

Ala Arg Gln Gly His Val Pro Ala Ile Val Leu Ser Phe Met Pro Met

275 280 285

Ser His Val Met Gly Arg Gly Ile Leu Tyr Ala Ser Leu Ala Ser Gly

290 295 300

Gly Val Val Asn Phe Ala Ala Arg Ala Asp Leu Ser Thr Leu Leu Glu

305 310 315 320

Asp Leu Ala Leu Thr Arg Pro Thr Gln Leu Asn Phe Val Pro Arg Val

325 330 335

Trp Asp Met Leu Phe Gln Asp Tyr Gln Ser Arg Ala Ala His Gly Gly

340 345 350

Ser Glu Ala Asp Ile Leu Ala Asp Met Arg Thr Asn Leu Leu Gly Gly

355 360 365

Arg Tyr Val Ser Ala Leu Thr Gly Ser Ala Pro Ile Ser Pro Glu Leu

370 375 380

Lys Ala Trp Val Glu Arg Leu Leu Asp Leu His Leu Val Glu Gly Tyr

385 390 395 400

Gly Ser Thr Glu Ala Gly Ala Val Phe Val Asp Gly Gln Ile Ser Arg

405 410 415

Pro Pro Val Leu Glu Tyr Lys Leu Val Asp Val Pro Glu Leu Gly Tyr

420 425 430

His Ser Thr Asp Val Pro His Pro Arg Gly Glu Leu Leu Ile Arg Ser

435 440 445

Glu Gln Leu Phe Pro Gly Tyr Tyr Lys Arg Pro Glu Val Thr Ala Ser

450 455 460

Val Phe Asp Glu Asp Gly Phe Tyr Arg Thr Gly Asp Ile Val Ala Glu

465 470 475 480

Leu Gly Pro Asp Gln Val Ala Tyr Ile Asp Arg Arg Asn Asn Val Leu

485 490 495

Lys Leu Ser Gln Gly Glu Phe Val Thr Val Ser Lys Leu Glu Ala Val

500 505 510

Phe Asn Thr Ala Pro Leu Val His Gln Ile Tyr Ile Tyr Gly Asn Ser

515 520 525

Ala Arg Pro Tyr Leu Leu Ala Val Val Val Pro Thr Asp Pro Ala Ala

530 535 540

Thr Lys Ala Glu Ile Ala Asp Ala Leu Lys Ala Ala Ala Arg Lys Ala

545 550 555 560

Asp Leu Gln Ser Tyr Glu Leu Pro Arg Asp Phe Leu Val Glu Thr Gln

565 570 575

Glu Phe Thr Thr Glu Asn Gly Leu Leu Thr Gly Ile Lys Lys Leu Ala

580 585 590

Trp Pro Lys Leu Lys Glu Arg Tyr Gly Ala Glu Leu Glu Gln Leu Tyr

595 600 605

Thr Asp Leu Ala Asp Gly Gln Ala Gly Glu Leu Gln Ala Leu Arg Ala

610 615 620

Thr Gly Ala Asp Ala Pro Val Leu Glu Thr Val Gly Arg Ala Ala Val

625 630 635 640

Ala Leu Leu Gly Ala Ala Ser Ser Asp Ile Ala Pro Asp Val His Phe

645 650 655

Thr Asp Leu Gly Gly Asp Ser Leu Ser Ala Leu Thr Phe Gly Asn Leu

660 665 670

Leu Ala Asp Ile Phe Asp Val Glu Val Pro Val Ser Val Ile Val Ser

675 680 685

Pro Thr Ala Asp Leu Ala Ser Ile Ala Ala His Ile Glu Thr Gln Arg

690 695 700

Ser Gly Ser Gly Leu Arg Pro Ser Phe Ala Ser Val His Gly Lys Asp

705 710 715 720

Ala Thr Val Ala Arg Ala Ala Asp Leu Thr Leu Asp Lys Phe Ile Asp

725 730 735

Ala Glu Thr Leu Ala Ala Ala Gly Asp Leu Ala Gly Pro Ala Thr Asn

740 745 750

Val Arg Thr Val Leu Leu Thr Gly Ala Thr Gly Phe Leu Gly Arg Tyr

755 760 765

Leu Ala Leu Glu Trp Leu Glu Arg Met Asn Leu Val Asp Gly Lys Val

770 775 780

Ile Ala Leu Val Arg Ala Arg Ser Asp Ala Glu Ala Arg Ala Arg Leu

785 790 795 800

Asp Ala Thr Phe Asp Thr Gly Asp Pro Lys Leu Val Ala His Tyr Arg

805 810 815

Glu Leu Ala Asp Lys His Leu Glu Val Leu Ala Gly Asp Lys Gly Glu

820 825 830

His Asp Leu Gly Leu Asp Arg Gln Thr Trp Gln Arg Leu Ala Asp Thr

835 840 845

Val Asp Leu Ile Val Asp Pro Ala Ala Leu Val Asn His Val Leu Pro

850 855 860

Tyr Asn Glu Leu Phe Gly Pro Asn Ala Leu Gly Thr Ala Glu Leu Ile

865 870 875 880

Arg Val Ala Leu Thr Thr Arg Ile Lys Pro Phe Val Tyr Val Ser Thr

885 890 895

Ile Gly Val Gly Ala Gly Ile Glu Pro Gly Arg Phe Val Glu Asp Ala

900 905 910

Asp Ile Arg Glu Ile Ser Ala Thr Arg Val Leu Asp Asp Ser Tyr Ala

915 920 925

Asn Gly Tyr Gly Ala Ser Lys Trp Ala Gly Glu Val Leu Leu Arg Glu

930 935 940

Ala His Glu Gln Phe Gly Leu Pro Val Ser Val Phe Arg Cys Asp Met

945 950 955 960

Ile Leu Ala Asp Thr Ser Tyr Ala Gly Gln Leu Asn Leu Pro Asp Met

965 970 975

Phe Thr Arg Met Met Leu Ser Leu Val Ala Thr Gly Ile Ala Pro Lys

980 985 990

Ser Phe Asn Gln Leu Asp Ala Gln Gly Asn Arg Gln Arg Ser His Tyr

995 1000 1005

Asp Gly Leu Pro Val Glu Phe Ile Ala Glu Ala Ile Ser Thr Leu

1010 1015 1020

Gly Ala Asp Val Thr Asp Gly Phe Glu Thr Tyr His Val Met Asn

1025 1030 1035

Pro His Asp Asp Gly Leu Gly Leu Asp Glu Phe Val Asp Trp Leu

1040 1045 1050

Val Asp Ala Gly His Pro Ile Arg Arg Ile Asp Asp Tyr Gln Ala

1055 1060 1065

Trp Phe Glu Gln Phe Gly Ala Thr Leu Arg Thr Leu Pro Asp Arg

1070 1075 1080

Gln Arg Gln Ala Ser Leu Leu Pro Leu Leu His Asn Tyr Thr Thr

1085 1090 1095

Pro Gly Gln Pro Val Asn Gly Ala Met Ala Pro Thr Asp Val Phe

1100 1105 1110

Arg Thr Ala Val Gln Glu Ala Lys Ile Gly Pro Asp Lys Asp Ile

1115 1120 1125

Pro His Val Ser Arg Asp Val Ile Val Lys Tyr Val Thr Asp Leu

1130 1135 1140

Gln Leu Leu Gly Leu Leu

1145

<210> 14

<211> 1160

<212> PRT

<213> Mycobacterium (Mycobacterium neoaurum)

<400> 14

Met Thr Glu Asn Asp Thr Arg Lys Val Ala Asp Leu Glu Arg Ile Thr

1 5 10 15

Ala Lys Leu Met Gly Leu Leu Gly Ser Asp Pro Gln Phe Ala Ala Ala

20 25 30

Leu Pro Asp Ala Thr Ile Ala Glu Ala Val Lys Ala Pro Gly Met Arg

35 40 45

Leu Ala Glu Met Leu Ala Val Val Met Glu Gly Tyr Gly Pro Arg Pro

50 55 60

Ala Leu Gly Glu Arg Thr Tyr Arg Leu Thr Thr Asp Ala Ala Gly Arg

65 70 75 80

Thr Ser Arg Glu Phe Leu Ser Asp Phe Ala Thr Ile Thr Tyr Ala Glu

85 90 95

Leu Trp Arg Arg Val Gly Ala Leu Ala Ser Ala Trp Arg His Glu Ser

100 105 110

Thr Asp Val Arg Pro Gly Ser Phe Val Cys Thr Ala Gly Arg Ala Gly

115 120 125

Ile Asp Tyr Thr Val Ala Asp Leu Ala Cys Ile Arg Met Gly Ala Val

130 135 140

Ala Val Pro Leu Pro Ala Thr Ala Thr Glu Ser Glu Phe Thr Ala Met

145 150 155 160

Leu Glu Glu Val Arg Pro Ala Val Val Cys Ser Asp Met Glu Thr Val

165 170 175

Gly Arg Leu Ser Arg Ala Val Leu Ala Cys Ser His Lys Pro Arg Gln

180 185 190

Leu Val Leu Leu Asp Tyr Gln Ala Glu Asn Asp Glu Gln Arg Gln Ala

195 200 205

Phe Glu Ser Thr Val Gly Glu Val Gly Thr Met Phe Asp Val Asp Thr

210 215 220

Leu Gln Ser Leu Thr Glu Arg Gly Gly Gln Tyr Pro Ala Ile Ser Pro

225 230 235 240

Tyr Val Asp Ala Glu Asp Asp Asn Pro Met Ala Ala Leu Leu Tyr Thr

245 250 255

Ser Gly Ser Thr Gly Thr Pro Lys Ala Ala Ile Cys Thr Glu Arg Met

260 265 270

Cys Ala Met Ala Trp Thr Ser Ala Ser Leu Ala Pro Ala Ile Gly Leu

275 280 285

Thr Tyr Met Pro Met Ser His Phe Tyr Gly Arg Gly Phe Leu Tyr Thr

290 295 300

Thr Leu Ser Gly Gly Gly Thr Asn Tyr Phe Val Thr Glu Ser Asp Leu

305 310 315 320

Ser Ser Leu Phe Asp Asp Leu Ala Leu Ile Arg Pro Thr Ala Leu Pro

325 330 335

Leu Val Pro Arg Val Cys Glu Met Ile Ala His Arg Tyr His Gly Glu

340 345 350

Val Val Ala Arg Val Ala Ala Gly Cys Asp Arg Ala Ala Ala Glu Asp

355 360 365

Glu Ala Lys Thr Leu Val Arg Asp Gln Val Leu Gly Gly Arg Tyr Leu

370 375 380

Trp Ala Ser Cys Ala Ser Ala Pro Leu Ser Pro Ala Met His Thr Leu

385 390 395 400

Met Glu Glu Leu Leu Asp Ala Pro Leu Val Ile Ser Tyr Gly Ala Thr

405 410 415

Glu Ile Val Gly Val Thr Ile Asp Gly Val Val Ser Arg Pro Pro Val

420 425 430

Ile Asp Tyr Lys Leu Val Asp Val Pro Ala Leu Gly Tyr Phe Gly Thr

435 440 445

Asp Gln Pro Tyr Pro Arg Gly Glu Leu Leu Val Lys Thr Val Asn Ala

450 455 460

Met Ala Gly Tyr Tyr Lys Arg Pro Glu Leu Thr Ala Glu Ser Phe Asp

465 470 475 480

Ala Asp Gly Tyr Tyr Arg Thr Gly Asp Ile Met Ala Glu Ile Ala Pro

485 490 495

Asp Arg Leu Lys Tyr Val Asp Arg Val Asn Asn Val Leu Lys Leu Ala

500 505 510

Gln Gly Glu Phe Val Ala Val Ser Gln Leu Glu Ala Thr Phe Cys Ser

515 520 525

His Pro Leu Ile Glu Gln Ile Phe Val Tyr Gly Asn Ser Ser Gln Ser

530 535 540

Phe Val Leu Ala Ile Val Val Pro Asp Ala Thr Glu Ala Ala Arg His

545 550 555 560

Pro Ala Asp Ile Ser Ser Gln Ile Arg Asp Ala Leu His Ser Val Gly

565 570 575

Arg Glu Thr Gly Leu Lys Ser Trp Glu Val Pro Arg His Phe Leu Val

580 585 590

Glu His Gln His Phe Thr Ala His Asn Gly Leu Leu Thr Ala Ser Asn

595 600 605

Lys Leu Ala Arg Pro Lys Leu Ile Ala Arg Tyr Gly Ala Arg Leu Glu

610 615 620

Gln Leu Tyr Ala Glu Ile Ala Asp Ala Ala Ala Arg Asn Leu Arg Asp

625 630 635 640

Leu His Ser Gly Lys Thr Glu Arg Pro Val Val Asp Thr Ile Glu Arg

645 650 655

Ala Val Leu Val Ala Leu Asp Leu Pro Asp Thr Gly Gln Leu Arg His

660 665 670

Ala Arg Phe Val Asp Leu Gly Gly Asp Ser Met Ser Ala Leu Ser Leu

675 680 685

Ala Asn Leu Leu Glu Glu Ile Phe Glu Val Asp Val Pro Val Ala Asp

690 695 700

Ile Ile Asp Pro Thr Ile Glu Leu His His Leu Ala Ala Arg Ile Ser

705 710 715 720

Ala Arg Ile Asp Thr Arg Ser Ala Val Pro Asn Ala Lys Ser Val His

725 730 735

Gly Ser Glu His Ala Arg Ile Ser Ala Ala Gln Leu Thr Leu Asp Ala

740 745 750

Phe Ala Ala Gly Pro Gly Gln Ala Pro Gly Ala Gly Glu Val Asp Ala

755 760 765

Val Thr Arg Pro Pro Arg Thr Val Leu Leu Thr Gly Ala Thr Gly Phe

770 775 780

Leu Gly Arg Phe Gln Cys Val Glu Leu Met Thr Met Met Ala Asn Gly

785 790 795 800

Thr Gly Gly Lys Val Val Cys Ile Val Arg Gly Arg Ser His Asp Asp

805 810 815

Ala Arg Asp Arg Leu Leu Arg Ala Val Ala Ala Asp Ser Ala Phe Met

820 825 830

Glu Lys Phe Thr Arg Leu Ala Glu Asn His Leu Glu Val Leu Ala Gly

835 840 845

Asp Leu Gly Leu Pro Arg Phe Gly Met Gln Asn Gly Asp Trp Asp Arg

850 855 860

Leu Cys Asp Thr Val Asp Ala Ile Val His Ala Gly Ala Leu Val Asn

865 870 875 880

His Ala Leu Pro Tyr Arg Ala Leu Phe Ala Pro Asn Val Phe Gly Thr

885 890 895

Ser Glu Val Leu Arg Leu Ala Val Thr Gly Arg Leu Lys Pro Val Ser

900 905 910

Phe Ile Ser Thr Val Ala Ala Ala Val Thr Pro Thr Gly Ser Leu Val

915 920 925

Asp Glu Asn Ser Asp Ile Arg His Ala Ser Pro Tyr Arg Asp Leu Asp

930 935 940

Asn Thr Tyr Ala Asn Gly Tyr Gly Ala Ser Lys Trp Ala Ala Glu Val

945 950 955 960

Leu Cys Arg Asp Ala His Gln Arg Tyr Gly Leu Pro Val Asn Val Phe

965 970 975

Arg Cys Ser Met Leu Leu Pro His Arg Leu Phe Pro Gly His Val Asn

980 985 990

Ser Gln Asp Val Leu Ser Arg Leu Leu Ala Ser Leu Ile Asp Thr Gly

995 1000 1005

Leu Ala Pro Gly Ser Phe Tyr Thr Gly Asp Ser Gln His Ala His

1010 1015 1020

Phe Asp Gly Leu Pro Val Asp Phe Val Ala His Ala Thr Thr His

1025 1030 1035

Ile His Pro Glu Thr Arg Thr Phe Arg Thr Phe Asn Val Val Asn

1040 1045 1050

Pro Asn Pro Asp Asn Val Ser Ile Asp Thr Phe Val Thr Trp Leu

1055 1060 1065

Val Glu Ala Gly Phe Pro Ile Arg Tyr Ile Asp Asp Tyr Asp Glu

1070 1075 1080

Trp Phe Cys Arg Thr His Thr Ala Leu Arg Ala Leu Pro Asp Ser

1085 1090 1095

Val Arg His Gln Thr Leu Phe Asp Leu Pro Ser Val Phe Ala His

1100 1105 1110

Pro Ser Pro Ala Ile Pro Gly Ser Met Phe Pro Ala Asp Met Phe

1115 1120 1125

Cys Ala Thr Val Arg Asp Thr Leu Ala Ala Asp Gly Ala Ile Pro

1130 1135 1140

Thr Val Glu Gly Val His Ile Val Arg Leu Ala Glu Ala Leu Arg

1145 1150 1155

Pro Arg

1160

<210> 15

<211> 41

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 15

acgttgttgc cattgctgca gagcagtgag gcctgccgtt g 41

<210> 16

<211> 50

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 16

gacacagctc aacttcgtcc cagtactggg aactggcaga caaacacctg 50

<210> 17

<211> 50

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 17

ggtgtttgtc tgccagttcc cagtactggg acgaagttga gctgtgtcgg 50

<210> 18

<211> 46

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 18

cttaattaag cggccgcggt acccgccgaa aatcttgatg accagc 46

<210> 19

<211> 49

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 19

tagcgcgcga agtgctgtgt agtactcagc atctcggcaa gtcgcattc 49

<210> 20

<211> 49

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 20

tagcgcgcga agtgctgtgt agtactcagc atctcggcaa gtcgcattc 49

<210> 21

<211> 49

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 21

tgcgacttgc cgagatgctg agtactacac agcacttcgc gcgctaccc 49

<210> 22

<211> 46

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 22

cttaattaag cggccgcggt acctcgccga gctgctggat gagatg 46

Claims

1. A method for producing a sitolactone by microbial fermentation, comprising producing the sitolactone from sterol by fermentation using a sitolactone-producing microorganism, wherein the sitolactone-producing microorganism has at least one fatty acid coa/carboxylate reductase capable of catalyzing reaction I of the following compounds I to II, and the method comprises inhibiting activity and/or expression amount of at least one of the fatty acid coa/carboxylate reductases in the sitolactone-producing microorganism, the reaction being:

wherein, "-X" is hydroxy or carbonyl; "-Y" is hydroxyl or "-SCoA";

wherein the said lactonic acid-producing bacteria include Rhodococcus (Rhodococcus), Nocardia (Nocardia), Mycobacterium (Mycobacterium), Streptomyces (Streptomyces) and Arthrobacter (Arthrobacter) and Pseudomonas (Pseudomonas);

wherein the amino acid sequence of the fatty acid coenzyme A/carboxylic acid reductase is shown as SEQ ID NO 2, 4, 13 or 14.

2. The method of claim 1, wherein said inhibition is achieved by gene knockout or gene mutation.

3. The method of claim 1, wherein the fermentative production is carried out at 25-45 ℃ for 3-12 days at a pH of 7-8.

4. An engineered bacterium for producing a glutamate-coa/carboxylate reductase which inhibits the activity and/or expression level of at least one fatty acid-coa/carboxylate reductase, wherein the fatty acid-coa/carboxylate reductase is capable of catalyzing the reactions I:

wherein, "-X" is hydroxy or carbonyl; "-Y" is hydroxyl or "-SCoA";

5. The engineered bacterium for the production of valerolactone of claim 4, wherein the suppression is by gene knock-out or gene mutation.

6. Use of the engineered bacterium for the production of valerolactone according to claim 4 or 5.

7. Use according to claim 6, wherein the fermentative production is carried out at 25-45 ℃ and at a pH of 7-8 for 3-12 days.

8. Use of a fatty acid coenzyme a/carboxylic acid reductase for catalyzing the reaction I of the following compounds I to II:

wherein, "-X" is hydroxy or carbonyl; "-Y" is hydroxyl or "-SCoA"; wherein the amino acid sequence of the fatty acid coenzyme A/carboxylic acid reductase is shown as SEQ ID NO 2, 4, 13 or 14.

9. Use according to claim 8, wherein the catalysis is carried out at pH 7-10, 25-45 ℃.