CN109722455A

CN109722455A - Method, engineering bacteria and the application of microbial fermentation production paddy lactone

Info

Publication number: CN109722455A
Application number: CN201711051707.5A
Authority: CN
Inventors: 冯进辉; 陈曦; 姚培圆; 刘娜; 张瑞; 李雪梅; 吴洽庆; 朱敦明; 马延和; 张峥斌
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Zhejiang Xianju Junye Pharmaceutical Co ltd; Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2017-10-31
Filing date: 2017-10-31
Publication date: 2019-05-07
Anticipated expiration: 2037-10-31
Also published as: CN109722455B

Abstract

The present invention provides method, paddy lactone production engineering bacterium and applications that paddy lactone is produced by microbial fermentation.The method for producing paddy lactone by microbial fermentation produces bacterium by sterol fermenting and producing paddy lactone including the use of paddy lactone, it is characterized in that, the paddy lactone production bacterium has at least one fatty acid coa A/ carboxylate reductase, the enzyme can be catalyzed the reaction i of following compound I to II, and the method includes inhibiting the activity and/or expression quantity of fatty acid coa A/ carboxylate reductase described at least one of described paddy lactone production bacterium, the reaction are as follows:

Description

Method, engineering bacteria and the application of microbial fermentation production paddy lactone

Technical field

The invention belongs to field of microbial fermentation, in particular to method, the engineering of microbial fermentation production paddy lactone Bacterium and application.

Background technique

Steroidal (also referred to as sterol) is a kind of compound with cyclopentanoperhydrophenanthrene ring structure, usually in C-10 and C-13 There is methyl group in position, has alkyl side chain at C-17, shown in the following formula III of structural formula.A kind of group of the steroidal as cell membrane Point, it is played an important role in organism.Some steroidals also have the function of hormone and signaling molecule.From the fifties in last century It was found that up to the present having identified more than 300 kinds of steroid drugs since steroid drugs.Steroid drugs has very strong anti-sense The pharmacological actions such as dye, antiallergy, antiviral and Hemorrhagic shock.In recent years, steroid drugs constantly expands in the application range of medical field Greatly, it is widely used in treating rheumatism, angiocarpy, Collagen illness, leukemic lymphoblastoid, human organ transplant, antitumor, bacterium Property encephalitis, skin disease, endocrine disorder, geriatric disease etc., steroid hormone drug, which has become, is only second to the second largest of antibiotic Class drug.

According to " steroid chemical progress ", (Zhou Weishan, Zhuan Zhiping chief editor, Science Press publish for 2002, ISBN 7-03- It 009607-X) reports, many microorganisms include Nocard's bacillus (Nocardia), mycobacteria (Mycobacterium), arthrobacterium (Arthrobocter) and Pseudomonas alba (Pseudomonas) etc. all can be complete by steroidal parent nucleus cyclopentanoperhy drophenanthrene and side chain Portion is oxidized to carbon dioxide and water.The metabolic pathway of steroidal is through Sih and its cooperation work person (bibliography " Sih CJ, Tai HH,Tsong YY,Lee SS,Coombe RG.Mechanisms of steroid oxidation by microorganisms.XIV.Pathway of cholesterol side-chain degradation.Biochemistry.1968；7:808-18.","Sih CJ,Tai HH,Tsong YY.The mechanism of microbial conversion of cholesterol into 17-keto steroids.J Am Chem Soc.1967；89:1957-8. " and " Sih CJ, Wang KC, Tai HH.Mechanisms of steroid oxidation by microorganisms.XIII.C22acid intermediates in the degradation of the cholesterol side chain.Biochemistry.1968；7:796-807. ") research illustrate it is as shown in Figure 1. The process shows that such as 4AD (compound 15), ADD can be obtained by the vigor of the different enzymes of control during microbial degradation The important intermediate such as (compound 16), 9-OH-AD and paddy lactone (compound 24).Again according to widely used in microbe research " primary Jie Shi systematic bacteriology handbook " (Bergey ' s manual of systematic bacteriology), Rhodococcus sp (Rhodococcus) there are many identical features with mycobacteria and Nocard's bacillus, is once classified as Mycobacterium.2012 Year, have found the sterol degradation gene cluster similar with mycobacteria (referring to document " Mohn WW, Wilbrink in Rhodococcus sp MH,Casabon I,Stewart GR,Liu J,van der Geize R,et al.Gene cluster encoding cholate catabolism in Rhodococcus spp.J Bacteriol.2012；194:6712-9 "), therefore can be with Think, Rhodococcus sp has the consistent sterol metabolism approach described with Fig. 1.

Paddy lactone ((4aR, 6aS, 9aS, 9bS) -6a- methyl octahydro cyclopenta [f] chromene -3,7 (2H, 8H)-two Ketone) be steroidal metabolic pathway important intermediate, the prior art by traditional mutation breeding obtain paddy lactone produce strain, So as to fermenting and producing paddy lactone.For example, Nakamatsu etc. utilizes coral Nocard's bacillus (Nocardia coralline) 3338 mutant strain of IFO is prepared for paddy lactone, but molar yield there was only 25% (bibliography " Nakamatsu R, Beppu T, Arima K.Microbial degradation of steroids to hexahydroindanone derivatives.Agric Biol Chem.1980,44:1469-74")；Ferreira etc. utilizes Rhodococcus - 236.457 mutant strain of australis CSIR prepares paddy lactone, and molar yield is up to 60%, when concentration of substrate is in 6-12g/L, Molar yield is about 63% (bibliography " Ferreira NP, Robson PM, Bull JR, van der Walt EW.The microbial production of 3aα-H-4α-(3’-propionic acid)-5α-hydroxy-7aβ- methylhexahydro-indan-l-one-δ-lectone from cholesterol.Biotechn Letters.1984, 6:517-22.").However, these existing paddy lactone fermenting and producing strain molar yields achieved are still lower, and secondary Product is more, causes to isolate and purify difficult, high production cost, this causes the price of related steroid drugs high.

Summary of the invention

For solve it is above-mentioned the problems of in the prior art, the present invention provides the sides of microbial fermentation production paddy lactone Method, engineering bacteria and application.

Specifically, the present invention provides:

(1) a kind of method for producing paddy lactone by microbial fermentation is fermented including the use of paddy lactone production bacterium by sterol Produce paddy lactone, which is characterized in that the paddy lactone production bacterium has at least one fatty acid coa A/ carboxylate reductase, the enzyme It can be catalyzed the reaction i of following compound I to II, and the method includes inhibiting at least one in the paddy lactone production bacterium The activity and/or expression quantity of the kind fatty acid coa A/ carboxylate reductase, the reaction are as follows:

Wherein, "-X " is hydroxyl or carbonyl；"-Y " is hydroxyl or "-SCoA ".

(2) method according to (1), wherein paddy lactone production bacterium bag includes actinomyces (Actinomycetales) With pseudomonad (Pseudomonas)；Preferably, the actinomyces include Rhodococcus sp (Rhodococcus), promise cassette bacterium (Nocardia), mycobacteria (Mycobacterium), streptomycete (streptomyces) and arthrobacterium (Arthrobacter)。

(3) method according to (1), wherein the amino acid sequence such as SEQ of the fatty acid coa A/ carboxylate reductase Shown in ID NO:2,4,13 or 14.

(4) method according to (1), wherein the inhibition is realized by gene knockout or gene mutation.

(5) method according to (1), wherein the fermenting and producing carries out 3-12 days at 25-45 DEG C, the pH of 7-8.

(6) a kind of paddy lactone production engineering bacterium, which is characterized in that at least one of described paddy lactone production engineering bacterium rouge Fat acid coacetylase/carboxylate reductase activity and/or expression quantity are suppressed, wherein the fatty acid coa A/ carboxylate reductase energy Enough it is catalyzed the reaction i of following compound I to II:

Wherein, "-X " is hydroxyl or carbonyl；"-Y " is hydroxyl or "-SCoA ".

(7) the paddy lactone production engineering bacterium according to (6), wherein paddy lactone production bacterium bag includes actinomyces (Actinomycetales) and pseudomonad (Pseudomonas)；Preferably, the actinomyces include Rhodococcus sp (Rhodococcus), promise cassette bacterium (Nocardia), mycobacteria (Mycobacterium), streptomycete (streptomyces) With arthrobacterium (Arthrobacter).

(8) the paddy lactone production engineering bacterium according to (6), wherein the amino of the fatty acid coa A/ carboxylate reductase Acid sequence is as shown in SEQ ID NO:2,4,13 or 14.

(9) the paddy lactone production engineering bacterium according to (8), wherein described inhibit to be by gene knockout or gene mutation Come what is realized.

(10) paddy lactone production engineering bacterium the answering in fermenting and producing paddy lactone according to any one of (6)-(9) With.

(11) application according to (10), wherein the fermenting and producing carries out 3-12 days at 25-45 DEG C, the pH of 7-8.

(12) fatty acid coa A/ carboxylate reductase is used to be catalyzed the application of the reaction i of following compound I to II:

Wherein, "-X " is hydroxyl or carbonyl；"-Y " is hydroxyl or "-SCoA ".

(13) application according to (12), wherein the amino acid sequence of the fatty acid coa A/ carboxylate reductase is such as Shown in SEQ ID NO:2,4,13 or 14.

(14) application according to (12), wherein the catalysis carries out at pH 7-10,25-45 DEG C.

Compared with the prior art, the present invention has the following advantages and good effect:

The present invention is parsed by producing the metabolic pathway of bacterium to paddy lactone, it was found that in its steroidal metabolic pathway, catalysis The enzyme of the side reaction of Lipase absobed in paddy, the present invention are named as fatty acid coa A/ carboxylate reductase, the enzyme according to its substrate The production of paddy lactone is had a major impact, the activity and/or expression quantity of the enzyme are inhibited, bottom when paddy lactone fermenting and producing can be improved Object conversion ratio reduces or blocks the generation of by-product, and product is made to be easily isolated purifying, reduces production cost.

Detailed description of the invention

Fig. 1 shows metabolic pathway of the sterol in microorganism.

Fig. 2 shows the up/down PCR results of car1 gene；Wherein swimming lane 1 and 2 is fragment upstream；3 and 4 be downstream piece Section；M is molecular weight marker.

Fig. 3 shows the up/down PCR result of car2 gene；Wherein swimming lane 1 and 2 is fragment upstream；3 and 4 be downstream piece Section；M is molecular weight marker.

Fig. 4 shows car1 and car2 gene knockout plasmid PacI single endonuclease digestion verification result；Wherein swimming lane 1 and 2 is car1 base Because knocking out plasmid；3 and 4 be car2 gene knockout plasmid；M is molecular weight marker.

Fig. 5 shows car2 gene knockout PCR verification result；Wherein swimming lane 1-7 is verifying bacterial strain, and swimming lane 5 and 6 is clpp gene Except success bacterial strain；M is molecular weight marker.

Fig. 6 shows car1 gene knockout PCR verification result；Wherein swimming lane 1-6 is verifying bacterial strain, and swimming lane 3 and 4 is clpp gene Except success bacterial strain；M is molecular weight marker.

Fig. 7 shows the gas chromatogram of paddy lactone standard items.

Fig. 8 shows the gas chromatogram of wild-type mycobacterium fermentation, extraction liquid.

Fig. 9 shows the dual-gene gas chromatogram for knocking out mycobacteria fermentation, extraction liquid of car1 and car2.

Figure 10 shows the stacking chart of Fig. 7 and Fig. 8；Solid line is paddy lactone standard items, and dotted line is wild-type mycobacterium fermentation Extract liquor.

Figure 11 shows the stacking chart of Fig. 7 and Fig. 9；Solid line is paddy lactone standard items, and dotted line, which is that car1 and car2 is dual-gene, to be struck Except mycobacteria fermentation, extraction liquid.

The abscissa of Fig. 7 to Figure 11 is retention time, and ordinate is response signal value mAu.

Specific embodiment

Description below by way of specific embodiment and the invention will be further described referring to attached drawing, but it is pair that this, which is not, Limitation of the invention, those skilled in the art's basic thought according to the present invention, can make various modifications or improvements, but only Basic thought of the invention is not departed from, is all within the scope of the present invention.

The present invention parses the metabolic pathway of paddy lactone production bacterium, by numerous studies and analysis to find In its steroidal metabolic pathway, it is catalyzed the enzyme of the side reaction of Lipase absobed in paddy.As shown in Figure 1, in the steroid of paddy lactone production bacterium In body metabolic pathway, the upstream product of paddy lactone (compound 24) is (HIP (1, the 5- dioxo -7a Beta-methyl -3a of compound 21 α--4 MCPP-propionic acid) of hexahydro indane)) and 23 (5-OH-HIP).Present invention finds in the form of compound 21,23 and its coacetylase (i.e. General formula compound I) it is the enzyme that substrate is catalyzed Lipase absobed side reaction in paddy, and obtain the nucleotide and amino acid sequence of this fermentoid Column.By ncbi database it is found that this fermentoid by broadly annotation is oxidoreducing enzyme, or it is noted as acyl CoA dehydrogenation Enzyme.However, present invention firstly discovers that, this fermentoid is capable of the reduction reaction of catalytic cpd 21,23, see reaction equation i-v, therefore, Present invention finds the new applications of this fermentoid.According to the reaction substrate and type of enzyme, the present invention is named as fatty acid coa A/ carboxylate reductase.In addition, it has also been found that, paddy lactone, which produces, has more than one (such as 2 kinds, 3 kinds or 4 kinds) in bacterium It can be catalyzed the fatty acid coa A/ carboxylate reductase of above-mentioned reaction, the homology of the amino acid sequence of these enzymes is 45%- 100%.The reaction that the present invention proposes that the enzyme is catalyzed as a result, has a major impact the production of paddy lactone, inhibits the activity of the enzyme And/or expression quantity, the substrate transformation rate when paddy lactone fermenting and producing can be improved, reduce or block the generation of by-product, make product It is easily isolated purifying, reduces production cost.

On the basis of above-mentioned discovery, by theoretical research and experimental verification, the present invention provides one kind to pass through microorganism The method of fermenting and producing paddy lactone, including the use of paddy lactone production bacterium by sterol fermenting and producing paddy lactone, which is characterized in that described Paddy lactone, which produces bacterium, has at least one fatty acid coa A/ carboxylate reductase, which can be catalyzed following compound I to II's I is reacted, and the method includes inhibiting fatty acid coa A/ carboxylic acid described at least one of described paddy lactone production bacterium also The activity and/or expression quantity of protoenzyme, the reaction are as follows:

Wherein, "-X " is hydroxyl or carbonyl；"-Y " is hydroxyl or "-SCoA ".

In the activity and/or expression quantity for referring to enzyme, the term as used herein " inhibition " refers to compared with native state, makes The activity and/or expression quantity of enzyme reduce, or make the enzyme complete deactivation and/or do not express.

It will be understood by those skilled in the art that there are the fatty acid coa A/ carboxylic acids of more than one the catalysis reaction In the case where reductase, inhibiting one kind or all fatty acids coacetylase/carboxylate reductase to can reach makes paddy lactone production bacterium The effect that the gross activity and/or expression quantity of fatty acid coa A/ carboxylate reductase reduce.Preferably paddy lactone is inhibited to produce bacterium In the various fatty acid coa A/ carboxylate reductases activity and/or expression quantity.

It is a discovery of the invention that Rhodococcus sp (Rhodococcus), promise cassette bacterium in actinomyces (Actinomycetales) (Nocardia), mycobacteria (Mycobacterium), streptomycete (streptomyces) and arthrobacterium (Arthrobacter) and the metabolic pathway for generating paddy lactone by steroidal of pseudomonad (Pseudomonas) all refers to rouge The above-mentioned reaction 1-4 of fat acid coacetylase/carboxylate reductase.Therefore, the paddy lactone production bacterium bag includes actinomyces (Actinomycetales) and pseudomonad (Pseudomonas).Preferably, the actinomyces include Rhodococcus sp (Rhodococcus), promise cassette bacterium (Nocardia), mycobacteria (Mycobacterium), streptomycete (streptomyces) With arthrobacterium (Arthrobacter).

In the method for the invention, the inhibition can be realized by any of method in this field.For example, passing through The encoding gene knockout of enzyme or the mode of gene mutation are realized.The mode of gene mutation includes such as insertion mutation, missing Mutation, frameshift mutation, replacement mutation and point mutation.The old process of this field can be used in these methods and operation carries out.

Preferably, the amino acid sequence of the fatty acid coa A/ carboxylate reductase such as institute of SEQ ID NO:2,4,13 or 14 Show.

In specific embodiments, the fatty acid coa A/ carboxylate reductase catalysis is following reacts ii-v:

In a specific embodiment, the fatty acid coa A/ carboxylate reductase includes fatty acid coa A/ carboxylic acid Reductase 1 and 2, the amino acid sequence of the fatty acid coa A/ carboxylate reductase 1 is as shown in SEQ ID NO:2, the fat The amino acid sequence of sour coacetylase/carboxylate reductase 2 is as shown in SEQ ID NO:4.

In another specific embodiment, the fatty acid coa A/ carboxylate reductase includes fatty acid coa A/ carboxylic Sour reductase 3 and 4, the amino acid sequence of the fatty acid coa A/ carboxylate reductase 3 is as shown in SEQ ID NO:13, the rouge Fat acid coacetylase/carboxylate reductase 4 amino acid sequence is as shown in SEQ ID NO:14.

In the method for the invention, fermentation can carry out under any suitable conditions of.The fermentation is preferably at 25-45 DEG C Lower progress, more preferably carries out at 25-37 DEG C.PH when fermentation is preferably 7-8.Fermentation is preferred to be carried out 3-12 days, such as is carried out 3-10 days, more preferable 4-10 days.According to specific application and condition, the fermentation that can arbitrarily adjust the paddy lactone production bacterium is connect Kind of amount, such as can be with are as follows: the OD of paddy lactone production bacterium seed liquor_600nm(the OD value under 600nm) is 1-20 (such as 10), volume is The fermentation 1%-20% of culture solution.Those skilled in the art can be inoculated with large volume of kind with for example, when OD value is low Sub- liquid；When OD value is high, the seed liquor of smaller size smaller can be inoculated with.

The present invention also provides a kind of paddy lactone production engineering bacterium, which is characterized in that in the paddy lactone production engineering bacterium At least one fatty acid coa A/ carboxylate reductase activity and/or expression quantity be suppressed, wherein the fatty acid coa A/ Carboxylate reductase can be catalyzed the reaction i of following compound I to II:

Wherein, "-X " is hydroxyl or carbonyl；"-Y " is hydroxyl or "-SCoA ".

Preferably, the paddy lactone production bacterium bag includes actinomyces (Actinomycetales) and pseudomonad (Pseudomonas).It is highly preferred that the actinomyces include Rhodococcus sp (Rhodococcus), promise cassette bacterium (Nocardia), Mycobacteria (Mycobacterium), streptomycete (streptomyces) and arthrobacterium (Arthrobacter).

As described above, the inhibition can be realized by any of method in this field.For example, by by enzyme Encoding gene knocks out or the mode of gene mutation is realized.The mode of gene mutation includes such as insertion mutation, deletion mutation, shifting Code mutation, replacement mutation and point mutation.The old process of this field can be used in these methods and operation carries out.

The present invention also provides application of the paddy lactone production engineering bacterium in fermenting and producing paddy lactone.

The fermentation is using sterol as fermentation raw material.The fermentation preferably carries out at 25-45 DEG C, more preferably at 25-37 DEG C Lower progress.PH when fermentation is preferably 7-8.Fermentation is preferred to be carried out 3-12 days, such as is carried out 3-10 days, more preferable 4-10 days.Root According to specific application and condition, the fermentation inoculum concentration of the paddy lactone production bacterium can be arbitrarily adjusted, such as can be with are as follows: paddy lactone Produce the OD of bacterium seed liquor_600nm(the OD value under 600nm) be 1-20 (such as 10), the 1%- that volume is fermentation culture solution 20%.Those skilled in the art can be inoculated with large volume of seed liquor with for example, when OD value is low；It, can when OD value is high To be inoculated with the seed liquor of smaller size smaller.

The present invention also provides the reaction i that fatty acid coa A/ carboxylate reductase is used to be catalyzed following compound I to II:

Wherein, "-X " is hydroxyl or carbonyl；"-Y " is hydroxyl or "-SCoA ".

Preferably, the amino acid sequence of the fatty acid coa A/ carboxylate reductase such as institute of SEQ ID NO:2,4,3 or 14 Show.

Preferably, the catalysis carries out at pH 7-10,25-45 DEG C.The pH of catalysis reaction is more preferably 9-9.5, temperature More preferably 25 DEG C.

The reaction time can be determined according to practical application, concentration of substrate and enzyme amount.For example, when concentration of substrate be 10mM, When enzyme amount is 0.5mg/ml, the reaction time can be 4-48 hours.

The contents of the present invention are further explained and described below by way of the mode of example, but these examples are understood not to Limitation to protection scope of the present invention.

Example

Below unless stated otherwise, otherwise in following example experimentally use this field routine experiment stream Journey, operation, material and condition carry out.

Embodiment 1: the building of gene knockout plasmid

The nucleotide sequence of fatty acid coa A/ carboxylate reductase 1 (car1) is as shown in SEQ ID NO:1, fatty acid coa The nucleotide sequence of A/ carboxylate reductase 2 (car2) is as shown in SEQ ID NO:3.Building knocks out car1 respectively in accordance with the following methods Plasmid and knock out car2 plasmid.

PCR amplification is carried out by template of car1 and car2 respectively.PCT system and primer are as follows.

PCR system:

PCR program: 98 DEG C 3 minutes；98 DEG C are denaturalized for 10 seconds, and 58 DEG C are annealed for 20 seconds, and 72 DEG C extend for 30 seconds, and 30 are followed Ring；72 DEG C 10 minutes.Wherein the primer sequence are as follows:

For car1:

Fragment upstream primer:

Up-F:5'TGTTGCCATTGCTGCAGGCATCTCGCACCATCAGC 3'(SEQ ID NO:5)

Up-R:5'AGGTCACTTGGTCGAGCCAGCGCCGCCTGATTCTC 3'(SEQ ID NO:6)

Segments downstream primer:

Down-F:5'CAGCGCCGCCTGATTCTCGCTCGACCAAGTGACCTG 3'(SEQ ID NO:7)

Down-R:5'CGCGGCCGCTTAATTAACGATCGGCTTGCTCTAGG 3'(SEQ ID NO:8)

For car2:

Fragment upstream primer:

Up-F:5'TGTTGCCATTGCTGCAGGATCAGACTCACAGCACATTG 3'(SEQ ID NO:9)

Up-R:5'GATCTTCGTGGTGAGCGCGGCGAGCGAGGCATACAG 3'(SEQ ID NO:10)

Segments downstream primer:

Down-F:5'CTGTATGCCTCGCTCGCCGCGCTCACCACGAAGATC 3'(SEQ ID NO:11)

Down-R:5'CGCGGCCGCTTAATTAAGGTTCCCCTGAGCAAATC 3'(SEQ ID NO:12)

Amplification is as shown in Figures 2 and 3.By the segment in the upstream and downstream segment amplified and pGOAL19 (segment Selection and connection reference literature " Parish T, the Stoker NG.Use of a flexible cassette with the segment method to generate a double unmarked Mycobacterium tuberculosis tlyA plcABC Method described in mutant by gene replacement.Microbiology.2000,146:1969-75 " carries out) and P2NIL carrier is connected.Connection product is transformed into DH5 α competent cell, the Double LB plate (tryptose of Kan, Hyg is applied Peptone: 10g/L, yeast extract: 5g/L, sodium chloride: 10g/L, Kan:50 μ g/ml, Hyg:50 μ g/ml, agar: 1.6%), together When add IPTG and X-Gal, 37 DEG C are incubated overnight.Upgrading grain carries out the verifying of PacI single endonuclease digestion (Fig. 4) after choosing blue single colonie culture, Sequencing proves plasmid construction success.

Embodiment 2: the screening of knock-out bacterial strain

The gene knockout plasmid electricity built is transferred to mycobacteria (Mycobacterium fortuitum) and (derives from beauty State's type culture collection warehousing (ATCC), strain number: ATCC6841) competent cell, painting Kan resistance LB plate (tryptone: 10g/L, yeast extract: 5g/L, sodium chloride: 10g/L, Kan:50 μ g/ml, agar: 1.6%) and adding IPTG and X-gal, into Row screens for the first time.Therefrom picking blue single bacterium drop down onto sucrose plate (tryptone: 10g/L, yeast extract: 5g/L, sucrose: 10g/L, agar: 1.6%) (adding IPTG and X-gal), carries out programmed screening.White colony is chosen in sucrose plate to liquid LB Culture medium mentions genome after 30 DEG C are cultivated about 36 hours, carries out PCR verifying by primer of Up-F, Down-R of target gene. If gene knockout success, PCR product should be about the single segment of 2kbp.Fig. 5, which is shown, has successfully been obtained car2 gene knockout Mycobacterium strain, Fig. 6 show the mycobacterium strain that car1 gene knockout has successfully been obtained.To single-gene knock out bacterial strain again Above-mentioned transfection, bacterial strain screening step are carried out, to obtain the bacterial strain of the dual-gene knockout of car1 and car2.

Embodiment 3: fermenting and producing paddy lactone

Seed culture medium:

Glucose: 6g/L；Yeast powder: 15g/L；NaNO₃: 5.4g/L；Glycerol: 2g/L；NH₄H₂PO₄: 0.6g/L；pH: 7.5；115 DEG C sterilize 30 minutes.

Fermentation medium:

NaNO₃: 6.37g/L；KH₂PO₄: 1.05g/L；Na₂HPO₄: 2.14g/L；MgSO₄: 0.82g/L；KCl:0.21g/L； CaCl₂: 0.1g/L；Dried Corn Steep Liquor Powder: 14.23g/L；Phytosterol: 20g/L；Soybean oil: 12%；pH:7.8；121 DEG C of sterilizings 30 minutes.

Fermented and cultured step:

LB plate (tryptone: 10g/L, yeast extract: 5g/L, sodium chloride: 10g/L, agar: 1.6%) at 30 DEG C With activated spawn, dual-gene knockout strain and wild-type mycobacterium strain that embodiment 2 obtains are activated respectively within culture 72 hours (ATCC 6841)；

By strain from activation plating into seed culture medium, 180rpm, 30 DEG C are cultivated 3 days, obtain seed liquor；

Seed liquor is aseptically sampled and is sampled microscopy, microscopy can be inoculated with without microbiological contamination；

It is seeded in 3L fermentation medium by the inoculum concentration of 10% (v/v)；

500rpm, 30 DEG C of fermented and cultureds, ventilation ratio 0.5vvm, entire fermentation process pH do not need to control between 7-8 System, fermented and cultured 120 hours；

Earlier fermentation is because be to have oil systems, and substrate phytosterol has caking phenomenon, therefore early period does not sample, to After system becomes uniformly, timing sampling is detected.Specifically, sampling 50ml for every eight hours, heat 5 minutes, is added at 80 DEG C Sodium hydroxide adjusts pH and is higher than 12, after cooling, removes organic phase, and hydrochloric acid adjustment pH is added in water phase less than 2, adds 5 times of bodies Long-pending ethyl acetate uniform stirring 30 minutes, the ethyl acetate extract of isolated paddy lactone.Using gas-chromatography (GC) method Measure the content of paddy lactone and the residual quantity of phytosterol in crude extract.GC analysis condition are as follows: chromatographic column is Agilent DB-5, is carried Gas is helium, and split ratio 20:1, flow velocity is 2ml/ minutes, and 150 DEG C are kept for 5 minutes, are then heated up with 5 DEG C/min of speed To 250 DEG C；295 DEG C are warming up to again with 40 DEG C/min of speed to be kept for 10 minutes；Detector is flame ionic detector.Work as plant Object sterol bioconversion synthesizes reaction conversion ratio (that is: (the remaining phytosterol of the phytosterol-of addition)/addition of paddy lactone Phytosterol >=95%) when reaching 95%, terminate fermentation.

Whole system after fermentation is adjusted with NaOH to pH10, and after grease layering, water phase is adjusted with HCl to pH2 again, so Extraction 3-5 times is carried out with ethyl acetate again afterwards, extraction is until extraction is complete.The entire extraction phase volume of record, by making gas phase The paddy lactone standard curve of chromatography (GC) is quantified, and entire fermentation yield is obtained.Specifically, fermentation liquid heats 5 at 80 DEG C Minute, sodium hydroxide is added and adjusts pH to being higher than 10.After cooling, remove organic phase, be added in water phase hydrochloric acid adjustment pH to less than 2, add the ethyl acetate uniform stirring of 5 times of volumes 30 minutes, the ethyl acetate extract of isolated paddy lactone.Using gas Phase chromatography (GC) method measures the content of paddy lactone in crude extract.GC analysis condition are as follows: chromatographic column is Agilent DB-5, and carrier gas is helium Gas, split ratio 20:1, flow velocity are 2ml/ minutes, and 150 DEG C are kept for 5 minutes, are then warming up to 250 with 5 DEG C/min of speed ℃；295 DEG C are warming up to again with 40 DEG C/min of speed to be kept for 10 minutes.Detector is flame ionic detector.Using external standard method It with the content of paddy lactone in calculated by peak area crude extract, then calculates the gross mass of paddy lactone in reaction solution, calculates rubbing for paddy lactone That yield (the results are shown in Table 1).Gas chromatograph results are as illustrated in figures 7-11.

Table 1: fermentor verification result

Ester products in paddy are isolated and purified in the fermentation liquid of gene knockout mycobacteria, carry out product separation H spectrum, C spectrum respectively And Mass Spectrometric Identification.Identification condition are as follows: H spectrum, C spectrum identify that mass spectrum uses Bruker using Bruker AVANCE III 600MHz The identification of micrOTOF-Q II direct injected.

As a result:

Separation of fermentative broth product H spectrum:

¹H NMR(CD₃Cl, 400MHz) δ (ppm) 4.53 (q, J=2.8,5.2Hz, 1H), 2.45-2.60 (m, 3H), 2.05-2.17 (m, 4H), 1.90-2.01 (m, 1H), 3.62 (t, J=6.0Hz, 1H), 1.71-1.87 (m, 3H), 1.52-1.69 (m,3H),0.91(s,3H)。

Separation of fermentative broth product C spectrum:

¹³C NMR(CD₃Cl,100MHz)δ(ppm)218.9,172.2,77.9,47.5,41.8,35.3,32.6,26.7, 26.5,26.4,21.5,21.1,12.8。

Separation of fermentative broth product mass spectra:

HR-MS (ES+) theoretical value C₁₃H₁₉O₃(M+H):223.1334；Detected value: 223.1355.

The results show that being paddy lactone by transformation strain fermentation phytosterol products therefrom.

Embodiment 4: strain fermentation is knocked out with single-gene and produces paddy lactone

According to single knock-out bacterial strain constructed in the activation of method described in embodiment 3, culture embodiment 2, and according to implementation Method described in example 3 carries out fermented and cultured and detection and analysis.As a result as follows:

Table 2: single knock-out bacterial strain fermentor verification result

Embodiment 5:

According to method described in implementation 2, in mycobacteria (Mycobacterium neoaurum) (NRRL B-3683) The single bacterial strain and double knock-out bacterial strains for knocking out car1 and car2 of building respectively, in the mycobacteria, the amino acid of car1 and car2 Sequence is respectively as shown in SEQ ID NO:13 and 14.Primer for gene knockout is as follows:

For car1:

Fragment upstream primer:

Up-F:5'ACGTTGTTGCCATTGCTGCAGAGCAGTGAGGCCTGCCGTTG 3'(SEQ ID NO:15)

Up-R:5'GACACAGCTCAACTTCGTCCCAGTACTGGGAACTGGCAGACAAACACCT G 3'(SEQ ID NO:16)

Segments downstream primer:

Down-F:5'GGTGTTTGTCTGCCAGTTCCCAGTACTGGGACGAAGTTGAGCTGTGT CGG 3'(SEQ ID NO:17)

Down-R:5'CTTAATTAAGCGGCCGCGGTACCCGCCGAAAATCTTGATGACCAGC 3'(SEQ ID NO: 18)

For car2:

Fragment upstream primer:

Up-F:5'ACGTTGTTGCCATTGCTGCAGTGCGATGTGACGGTCACGGTATC 3'(SEQ ID NO:19)

Up-R:5'TAGCGCGCGAAGTGCTGTGTAGTACTCAGCATCTCGGCAAGTCGCATTC 3'(SEQ ID NO:20)

Segments downstream primer:

Down-F:5'TGCGACTTGCCGAGATGCTGAGTACTACACAGCACTTCGCGCGCTAC CC 3'(SEQ ID NO:21)

Down-R:5'CTTAATTAAGCGGCCGCGGTACCTCGCCGAGCTGCTGGATGAGATG 3'(SEQ ID NO: 22)

Fermented and cultured and detection and analysis are carried out respectively according to method described in embodiment 3.As a result as follows:

Table 3:NRRL B-3683 knock-out bacterial strain fermentor verification result

Bacterial strain NRRL B-3683 is originally intended to produce compound 16 shown in FIG. 1, in NRRL B-3683 for be catalyzed by The vigor of 9 hydroxylases of compound 16 to 17 is lower, therefore the molar yield of paddy lactone is lower.But hair as shown in Table 3 It is found that after having knocked out fatty acid coa A/ carboxylate reductase car1 and/or car2, which is produced ferment result by phytosterol The molar yield of paddy lactone significantly improves.

SEQUENCE LISTING

<110>Tianjin Institute of Industrial Biotechnology, Chinese Accademy of Sciences

<120>method, engineering bacteria and the application of microbial fermentation production paddy lactone

<130> FI-174043-59:52/C

<160> 22

<170> PatentIn version 3.5

<210> 1

<211> 3471

<212> DNA

<213>mycobacteria (Mycobacterium fortuitum)

<400> 1

atgaccaccg aaacgcgtga agaccggttg caacgccgga tcgcacacct gtatgaagcc 60

gactcacagt tcgccgcggc ccgtcccagc gaggctgtca acaccgccgt cgccgagccc 120

gagctgcggt tgccggctgt cgtcaaaggc gtgttcgccg gctacgccga ccgtcccgcg 180

ctgggacagc gcgccgtcga gtacgtcacc gacgccgacg gccgcacgtc ggcccagctg 240

ctcccccggt tcgacaccat cacgtaccgc cagttgggcg accgcgtcca agcggtgacc 300

aacgcctggc acaaccaccc ggtgaagccc ggcgaccgcg tcgccatcct ggggttcacc 360

agcgtcgact acaccactgt cgacaccgcg ctgatcgaac tcggtgccgt atcggtgccg 420

ctgcagacca gtgcgccggt aaccaccctg cgccccatcg tcgccgagac ggaaccgacc 480

gtgatcgcgg cgagcatcga cttcctcgac gacgcggtcg aactggtgaa gtccggccct 540

gcaccccggc gcctggtggt gttcgactac cgcccgcggg tcgacgctca gcgtgaagcc 600

ttcgaagccg ccaaggccgc actggccggc accgatgtcg tcgtcgaacc gctggccgac 660

gtcctcgacc gcggccgctc actggccgac gcaccgctgt acacccccgg tcagcccgac 720

ccgctgacca tgctgatcta cacctccggc agcaccggca cccccaaggg cgcgatgtac 780

ccggagagca aggtcgccaa catgtggcag ctggccacca aggccacctg ggacgagaat 840

caggcggcgc tgccggcgat caccctcaac ttcatgccga tgagccacgt catgggccgc 900

ggcatcttga tcggcacgct gagctccggt ggcaccgcgt atttcgctgc gcgcagcgac 960

ctttcgacct tcctggagga cctagccctg gtccggccca cgcagctgag cttcgtgccc 1020

cggatctggg acatgctgtt tcaggagtac cagagccggt tggatcgcag cggagcaccg 1080

gaagacgaag tcctcgccga ggttcgccag gacctgctgg gcgggcggtt cgtctccgcg 1140

atgaccggtt ccgcgccgat ctcggcggag atgaagaact gggtggagcg cctgctcgac 1200

atgcacctgc tggagggcta cggctccacc gaggcaggtt cggtcttcgt cgacggccac 1260

atccagcgcc cgccggtgat cgactacaag ttggtcgacg tgccggacct gggctacttc 1320

cttaccgacc ggccccaccc gcgtggtgag ctgctggtga agtccgagca gatgttcccc 1380

gggtactaca agcgcccgga gatcaccgcc gagatgttcg acgaggacgg ctactaccgc 1440

accggtgaca tcgtcgccga actcggacca gaccaggtcg aatacctcga ccggcgcaac 1500

aacgtgctga agctctcgca gggcgaattc gtcaccgtct ccaagctgga ggccgtcttc 1560

ggagacagcc cgctggtacg gcagatcttc gtctacggca acagcgcccg ctcgtatctg 1620

ctggccgtcg tggtgccgac cgatccgtcc ctgtcgaagc aggcgatcgg cgattcactg 1680

caggacgccg cgcgggccgc gggtctgcag tcctacgaga tcccacgcga tttcatcgtc 1740

gagacaacgc ccttcagcct ggagaacggc ctgctgaccg gcatccgcaa gctggctcgg 1800

ccgaatctga aggcctacta cggcgatcgg ttggagcagc tttacacgga gctggccgag 1860

ggtcaggcca atgaactgag cgagctgcgg cgcaacggcg cccaggcccc ggtgctcgac 1920

acggtgagcc gggccgcagg tgccctgctg ggtgccgcgg catccgacct cgcccccgag 1980

gcccacttca ccgatctggg tggagattcg ttgtcggcct tgaccttcgg aaacctcctg 2040

caggagatct tcgacgtcga ggtgccggtg tcggcgatcg tcagcccggc ctcggatctt 2100

cggaccatcg ccgagtacat cgaggctcaa cgctcgggcg ccgatgtgcg gccgaccttc 2160

acgtcggtgc acggccgcaa cgcgaccgaa gtccacgcat ccgatctgac gctggacaaa 2220

ttcatcgacg ccgcgacatt ggccgccgca ccgagcctgc cgggcccggt cagtgagatc 2280

cgtaccgtac tgctcaccgg cgcaaccgga ttcctgggtc gctacttggc cctggagtgg 2340

ctggaacgga tggacctggt cgacggcaag gtcatctgcc tggtgcgcgc gaagtcggac 2400

gaggaagccc gcgcgcggct cgacaagacc ttcgacagcg gcgaccccaa gctgtgggcg 2460

cactaccaga aactggccgc cgaccatctc gaagtgatcg ccggcgacaa gggcgaggcc 2520

gatctcgggc tcgaccaagt gacctggcag cgtctggccg acaccgtcga tttcatcgtc 2580

gacccggccg cactggtcaa ccacgtgctg ccctacagcg aactgttcgg ccccaacgca 2640

cttggcactg ctgagctcat ccggatcgcg ctcaccacgc gcatcaagcc gttcgcgtac 2700

gtgtcgacga tcggcgtggg cggcggtatc gagccaggaa agttcgtgga ggccggggat 2760

attcgagcca tcagtccggt tcgacgcgtc gacgacggct acgccaacgg ctacggcaac 2820

agcaagtggg ccggcgaggt gctactgcgc gaagcgcacg atctggccgg gctgccggtg 2880

acggtgttcc gctgcgacat gatcctggcg gacaccacct acgccgggca gttgaacctg 2940

ccggacatgt tcacccgcat gatgttcagc ctcgtcgcca ccggtgtcgc accgaagtcc 3000

ttcaaccagc tcgacgccga cggcaaccga cagcgctcgc actacgacgg gctgcccgtc 3060

gagttcatcg ccgaggccat ctcaaccctg ggcgcccacg tccaggacgg cttcgagacg 3120

taccacgtga tgaacccgca cgacgacggc atcggcatgg acgagttcgt cgactggctc 3180

atcgaggccg gctacccgat ccagcgagtg gaggactacc aggagtggtt ggcccgcttc 3240

gagaccacgc tgcgggcact gcccgacaag caacgtcagg cctcgctgct gccgctgctg 3300

cacaactacc agcagcccgg cgtgccggtg aacggcgcga tggcaccgac cgacgtgttc 3360

cgtaccgcag tgcaggacgc gaagatcggg cccgacaagg acatccccca tgtcagccgg 3420

gaggtcatcg tcaagtacat cagcgatctg aaactgctcg gattgctgta a 3471

<210> 2

<211> 1156

<212> PRT

<213>mycobacteria (Mycobacterium fortuitum)

<400> 2

Met Thr Thr Glu Thr Arg Glu Asp Arg Leu Gln Arg Arg Ile Ala His

1 5 10 15

Leu Tyr Glu Ala Asp Ser Gln Phe Ala Ala Ala Arg Pro Ser Glu Ala

20 25 30

Val Asn Thr Ala Val Ala Glu Pro Glu Leu Arg Leu Pro Ala Val Val

35 40 45

Lys Gly Val Phe Ala Gly Tyr Ala Asp Arg Pro Ala Leu Gly Gln Arg

50 55 60

Ala Val Glu Tyr Val Thr Asp Ala Asp Gly Arg Thr Ser Ala Gln Leu

65 70 75 80

Leu Pro Arg Phe Asp Thr Ile Thr Tyr Arg Gln Leu Gly Asp Arg Val

85 90 95

Gln Ala Val Thr Asn Ala Trp His Asn His Pro Val Lys Pro Gly Asp

100 105 110

Arg Val Ala Ile Leu Gly Phe Thr Ser Val Asp Tyr Thr Thr Val Asp

115 120 125

Thr Ala Leu Ile Glu Leu Gly Ala Val Ser Val Pro Leu Gln Thr Ser

130 135 140

Ala Pro Val Thr Thr Leu Arg Pro Ile Val Ala Glu Thr Glu Pro Thr

145 150 155 160

Val Ile Ala Ala Ser Ile Asp Phe Leu Asp Asp Ala Val Glu Leu Val

165 170 175

Lys Ser Gly Pro Ala Pro Arg Arg Leu Val Val Phe Asp Tyr Arg Pro

180 185 190

Arg Val Asp Ala Gln Arg Glu Ala Phe Glu Ala Ala Lys Ala Ala Leu

195 200 205

Ala Gly Thr Asp Val Val Val Glu Pro Leu Ala Asp Val Leu Asp Arg

210 215 220

Gly Arg Ser Leu Ala Asp Ala Pro Leu Tyr Thr Pro Gly Gln Pro Asp

225 230 235 240

Pro Leu Thr Met Leu Ile Tyr Thr Ser Gly Ser Thr Gly Thr Pro Lys

245 250 255

Gly Ala Met Tyr Pro Glu Ser Lys Val Ala Asn Met Trp Gln Leu Ala

260 265 270

Thr Lys Ala Thr Trp Asp Glu Asn Gln Ala Ala Leu Pro Ala Ile Thr

275 280 285

Leu Asn Phe Met Pro Met Ser His Val Met Gly Arg Gly Ile Leu Ile

290 295 300

Gly Thr Leu Ser Ser Gly Gly Thr Ala Tyr Phe Ala Ala Arg Ser Asp

305 310 315 320

Leu Ser Thr Phe Leu Glu Asp Leu Ala Leu Val Arg Pro Thr Gln Leu

325 330 335

Ser Phe Val Pro Arg Ile Trp Asp Met Leu Phe Gln Glu Tyr Gln Ser

340 345 350

Arg Leu Asp Arg Ser Gly Ala Pro Glu Asp Glu Val Leu Ala Glu Val

355 360 365

Arg Gln Asp Leu Leu Gly Gly Arg Phe Val Ser Ala Met Thr Gly Ser

370 375 380

Ala Pro Ile Ser Ala Glu Met Lys Asn Trp Val Glu Arg Leu Leu Asp

385 390 395 400

Met His Leu Leu Glu Gly Tyr Gly Ser Thr Glu Ala Gly Ser Val Phe

405 410 415

Val Asp Gly His Ile Gln Arg Pro Pro Val Ile Asp Tyr Lys Leu Val

420 425 430

Asp Val Pro Asp Leu Gly Tyr Phe Leu Thr Asp Arg Pro His Pro Arg

435 440 445

Gly Glu Leu Leu Val Lys Ser Glu Gln Met Phe Pro Gly Tyr Tyr Lys

450 455 460

Arg Pro Glu Ile Thr Ala Glu Met Phe Asp Glu Asp Gly Tyr Tyr Arg

465 470 475 480

Thr Gly Asp Ile Val Ala Glu Leu Gly Pro Asp Gln Val Glu Tyr Leu

485 490 495

Asp Arg Arg Asn Asn Val Leu Lys Leu Ser Gln Gly Glu Phe Val Thr

500 505 510

Val Ser Lys Leu Glu Ala Val Phe Gly Asp Ser Pro Leu Val Arg Gln

515 520 525

Ile Phe Val Tyr Gly Asn Ser Ala Arg Ser Tyr Leu Leu Ala Val Val

530 535 540

Val Pro Thr Asp Pro Ser Leu Ser Lys Gln Ala Ile Gly Asp Ser Leu

545 550 555 560

Gln Asp Ala Ala Arg Ala Ala Gly Leu Gln Ser Tyr Glu Ile Pro Arg

565 570 575

Asp Phe Ile Val Glu Thr Thr Pro Phe Ser Leu Glu Asn Gly Leu Leu

580 585 590

Thr Gly Ile Arg Lys Leu Ala Arg Pro Asn Leu Lys Ala Tyr Tyr Gly

595 600 605

Asp Arg Leu Glu Gln Leu Tyr Thr Glu Leu Ala Glu Gly Gln Ala Asn

610 615 620

Glu Leu Ser Glu Leu Arg Arg Asn Gly Ala Gln Ala Pro Val Leu Asp

625 630 635 640

Thr Val Ser Arg Ala Ala Gly Ala Leu Leu Gly Ala Ala Ala Ser Asp

645 650 655

Leu Ala Pro Glu Ala His Phe Thr Asp Leu Gly Gly Asp Ser Leu Ser

660 665 670

Ala Leu Thr Phe Gly Asn Leu Leu Gln Glu Ile Phe Asp Val Glu Val

675 680 685

Pro Val Ser Ala Ile Val Ser Pro Ala Ser Asp Leu Arg Thr Ile Ala

690 695 700

Glu Tyr Ile Glu Ala Gln Arg Ser Gly Ala Asp Val Arg Pro Thr Phe

705 710 715 720

Thr Ser Val His Gly Arg Asn Ala Thr Glu Val His Ala Ser Asp Leu

725 730 735

Thr Leu Asp Lys Phe Ile Asp Ala Ala Thr Leu Ala Ala Ala Pro Ser

740 745 750

Leu Pro Gly Pro Val Ser Glu Ile Arg Thr Val Leu Leu Thr Gly Ala

755 760 765

Thr Gly Phe Leu Gly Arg Tyr Leu Ala Leu Glu Trp Leu Glu Arg Met

770 775 780

Asp Leu Val Asp Gly Lys Val Ile Cys Leu Val Arg Ala Lys Ser Asp

785 790 795 800

Glu Glu Ala Arg Ala Arg Leu Asp Lys Thr Phe Asp Ser Gly Asp Pro

805 810 815

Lys Leu Trp Ala His Tyr Gln Lys Leu Ala Ala Asp His Leu Glu Val

820 825 830

Ile Ala Gly Asp Lys Gly Glu Ala Asp Leu Gly Leu Asp Gln Val Thr

835 840 845

Trp Gln Arg Leu Ala Asp Thr Val Asp Phe Ile Val Asp Pro Ala Ala

850 855 860

Leu Val Asn His Val Leu Pro Tyr Ser Glu Leu Phe Gly Pro Asn Ala

865 870 875 880

Leu Gly Thr Ala Glu Leu Ile Arg Ile Ala Leu Thr Thr Arg Ile Lys

885 890 895

Pro Phe Ala Tyr Val Ser Thr Ile Gly Val Gly Gly Gly Ile Glu Pro

900 905 910

Gly Lys Phe Val Glu Ala Gly Asp Ile Arg Ala Ile Ser Pro Val Arg

915 920 925

Arg Val Asp Asp Gly Tyr Ala Asn Gly Tyr Gly Asn Ser Lys Trp Ala

930 935 940

Gly Glu Val Leu Leu Arg Glu Ala His Asp Leu Ala Gly Leu Pro Val

945 950 955 960

Thr Val Phe Arg Cys Asp Met Ile Leu Ala Asp Thr Thr Tyr Ala Gly

965 970 975

Gln Leu Asn Leu Pro Asp Met Phe Thr Arg Met Met Phe Ser Leu Val

980 985 990

Ala Thr Gly Val Ala Pro Lys Ser Phe Asn Gln Leu Asp Ala Asp Gly

995 1000 1005

Asn Arg Gln Arg Ser His Tyr Asp Gly Leu Pro Val Glu Phe Ile

1010 1015 1020

Ala Glu Ala Ile Ser Thr Leu Gly Ala His Val Gln Asp Gly Phe

1025 1030 1035

Glu Thr Tyr His Val Met Asn Pro His Asp Asp Gly Ile Gly Met

1040 1045 1050

Asp Glu Phe Val Asp Trp Leu Ile Glu Ala Gly Tyr Pro Ile Gln

1055 1060 1065

Arg Val Glu Asp Tyr Gln Glu Trp Leu Ala Arg Phe Glu Thr Thr

1070 1075 1080

Leu Arg Ala Leu Pro Asp Lys Gln Arg Gln Ala Ser Leu Leu Pro

1085 1090 1095

Leu Leu His Asn Tyr Gln Gln Pro Gly Val Pro Val Asn Gly Ala

1100 1105 1110

Met Ala Pro Thr Asp Val Phe Arg Thr Ala Val Gln Asp Ala Lys

1115 1120 1125

Ile Gly Pro Asp Lys Asp Ile Pro His Val Ser Arg Glu Val Ile

1130 1135 1140

Val Lys Tyr Ile Ser Asp Leu Lys Leu Leu Gly Leu Leu

1145 1150 1155

<210> 3

<211> 3492

<212> DNA

<213>mycobacteria (Mycobacterium fortuitum)

<400> 3

atgtcgtttg atactcgcga tgagcaactg gcgacccgta tcgccgatct gaccgccacc 60

gatccacagt tcgccgccgc gataccgagc gacaccgtca ccgcctccgt agacgtgccc 120

ggcctgcttc tgcccgagat cgtgcagagg gttctggagg gctacgccga acggcccgcg 180

ctcggcgagc gcgcgctcga attcgtggcc gaccctgcca cggggcgcac cactgctcgc 240

ctgctccccc ggttcgacac catcagctac ggccaggtgt gggaccgggt gcgcgccctc 300

gccgcagcgc tgcacgcctc gggcgtcgca gccggcgacc gggtcgcgat cctgggtttc 360

accagtgctg actacaccgt gatcgacacg gcgctcggcc agatcggcgc ggtgtcggtg 420

cccctgcaga ccagctcctc gcccgaggcg ctggcgccga tcgtgaccga gaccgagcct 480

cgggtgatcg cggcgagtgt cgaccacctc gccgatgccg tcgagctcgc gctcaccgct 540

cacgctccgg cccaactcgt cgtcttcgac caccaccccg agatcgatga ccatcgcgag 600

gccgtggcat cggccgccga gaggatcacc gcagcaggcg catccatcgc cgtcgacacg 660

ctggccggac tgctggaccg cggaagcaac ctcccggcac ccgaggcgcc caaggcggac 720

ggctccgacc ccttggcgtt gctgatctac acctccggca gcaccggcgc tcccaagggc 780

gcgatgtacc tgcagagcgc cgtggccaag ttctggcgtc gcaacagcaa ggcctggctc 840

gggccggtca gctcggcgat caacctgagc ttcatgccga tgagccacgt gatgggccgc 900

ggcatcctgt atgcctcgct cgccgccggc ggcacctgct acttcgccgc ccgcagcgac 960

ctgtcgacac tgctggagga cctcgccctg acgcggccca ccgagctgaa tttcgtccca 1020

cgcgtctggg agatgatcca cagcgaatat cagagccggg tcgatcagcg tctggccgag 1080

ggcggccggg accgtgaggc cgtcgaagcg gaggtgttgg ccgaggtccg cgacaaggtg 1140

ctcggcggcc gcttcgtcgc cgccatgacc ggctcggcac ccatctcagc cgagctcaag 1200

acctggaccc aggacatgct cggcatccac ctgctggagg gctacggctc gaccgaagcc 1260

ggcatggcac tgttcgacgg tgtcgtgcag cgtccgccgg tgatcgacta caagttggtc 1320

gacgtcccgg acctcgggta cttcggcacc gaccagcctc acccgcgcgg cgagttgctg 1380

atcaagaccg agaacctgtt ccccggctac tacaagcgtc ccgaggtcac cgcgtcggtg 1440

ttcgacgagg acggcttcta ccgcaccggt gacgtcgtcg cagagatcgg cccggaccag 1500

ctgcgctacg tcgaccggcg caacaacgtg ctcaagctcg cccagggcga gttcgtcacc 1560

ctggccaagc tggaagccgt gttcggcaac agtccactgg tgcaacagat ctacgtctac 1620

ggcaacagcg cccagcccta cctgctggcc gtcgtggtac ccacggatcc gagcgtttcc 1680

aaagaggcga tcgccgagtc cctgcaagag gtggcccggg aggccgacct gcagtcctac 1740

gagatcccgc gcgacttcat cgtggagaca acaccgttca gcctcgagaa cggtctgctg 1800

accggtatcc gcaagctggc gtggccgaag ttgaaggcgc actacggcga gcggctcgag 1860

cagctgtatg ccgagctggc cgagacgcag gccgccgaac ttcgcgagtt gcgttcggcg 1920

agtgccgacg cccccgtggt ggaaaccgtc agccgggctg ccggtgccct gctgggcgcc 1980

gcggcatccg acctggggcc tgacgcccac ttcaccgacc tgggtgggga ttccttgtcg 2040

gcgttgacct tcggcaacct gcttcgggag atcttcgatg tggatgtgcc ggtgggcgtg 2100

atcgtcagcc cggccaccga cctggccggc atcgccgagt acatcgagac ccagcgcagc 2160

ggatccaagc gcccgaccta cgcgtcggtg cacggcaggc acgccgccga agtcagtgcg 2220

gccgacctga ccctggacaa gttcctcgac gccgacaccc tggccgccgc accgaacctg 2280

cccaaggcag gcagcgaggt tcggaccgtg ctgctcaccg gcgccaccgg cttcctcggc 2340

cgctacttgg cgctggaatg gctggagcgc atggacctgg tcgacggcaa ggtcatcgcg 2400

ctggtgcgcg ccaagtccga cgaggaggcc cggacccggc tcgacgccac cttcgacagc 2460

ggtgacgcga aactccttgc gcactaccag aatctggccg ctgaccacct cgaagtggtt 2520

gccggcgaca agggcgagga gaacctcggc ctggatcagc agacctggca gcggctcgcc 2580

gacgaggtcg acctgatcgt cgacccggcc gcactggtca accacgtgct gccctacagc 2640

gaactgttcg gccccaacgc actgggcacc gccgagctga tcaagatcgc gctcaccacg 2700

aagatcaagc cgtacaccta cgtgtcgacc atcggcgtcg gcgatcagat cgagcccggg 2760

aagttcgtcg agaacgtcga cgtccgggag atgagtgcgg tccgcaagat caacgatggg 2820

tacgccaacg gttacggcaa cagcaagtgg gcgggtgagg ttttgctgcg cgaggccaac 2880

gatctgtgcg ggctgccggt cgcggtgttc cgctgcgaca tgatcctggc cgacacctcc 2940

tactcgggcc agctgaactt gccggacatg ttcacccgca tgatgctgag cctcgtcgcc 3000

agcggtatcg cgccgaagtc cttctacgag ctggattccg aaggcaaccg ccagcgctca 3060

cattacgacg gtctgcccgt cgagttcatc gccgagtcga tctcgacgtt gggcgggcaa 3120

tcggtcgaga gcttcgagac ctaccacgtg atgaacccgt acgacgacgg cctcggcatg 3180

gacgagttcg tcgactggct catcgaggcc ggctacccga tcgagcgcat cgaggattac 3240

gggcagtggg tccagcgctt cgagagcacc ttgcgcgccc tgccggacaa gcagcgtcag 3300

gcgtcgctgt tgccgctgct gcacaactac cagaagcccg agcggccgat gctgggcgcc 3360

ctggcgccca cggaccactt ccgtgcggcg gtgcaggaag ccaagatcgg gcccgacaag 3420

gacattcccc atgtcagccc ggcagtgatc gtcaagtaca tcaccgacct gcagcagctc 3480

ggcctgctct ag 3492

<210> 4

<211> 1163

<212> PRT

<213>mycobacteria (Mycobacterium fortuitum)

<400> 4

Met Ser Phe Asp Thr Arg Asp Glu Gln Leu Ala Thr Arg Ile Ala Asp

1 5 10 15

Leu Thr Ala Thr Asp Pro Gln Phe Ala Ala Ala Ile Pro Ser Asp Thr

20 25 30

Val Thr Ala Ser Val Asp Val Pro Gly Leu Leu Leu Pro Glu Ile Val

35 40 45

Gln Arg Val Leu Glu Gly Tyr Ala Glu Arg Pro Ala Leu Gly Glu Arg

50 55 60

Ala Leu Glu Phe Val Ala Asp Pro Ala Thr Gly Arg Thr Thr Ala Arg

65 70 75 80

Leu Leu Pro Arg Phe Asp Thr Ile Ser Tyr Gly Gln Val Trp Asp Arg

85 90 95

Val Arg Ala Leu Ala Ala Ala Leu His Ala Ser Gly Val Ala Ala Gly

100 105 110

Asp Arg Val Ala Ile Leu Gly Phe Thr Ser Ala Asp Tyr Thr Val Ile

115 120 125

Asp Thr Ala Leu Gly Gln Ile Gly Ala Val Ser Val Pro Leu Gln Thr

130 135 140

Ser Ser Ser Pro Glu Ala Leu Ala Pro Ile Val Thr Glu Thr Glu Pro

145 150 155 160

Arg Val Ile Ala Ala Ser Val Asp His Leu Ala Asp Ala Val Glu Leu

165 170 175

Ala Leu Thr Ala His Ala Pro Ala Gln Leu Val Val Phe Asp His His

180 185 190

Pro Glu Ile Asp Asp His Arg Glu Ala Val Ala Ser Ala Ala Glu Arg

195 200 205

Ile Thr Ala Ala Gly Ala Ser Ile Ala Val Asp Thr Leu Ala Gly Leu

210 215 220

Leu Asp Arg Gly Ser Asn Leu Pro Ala Pro Glu Ala Pro Lys Ala Asp

225 230 235 240

Gly Ser Asp Pro Leu Ala Leu Leu Ile Tyr Thr Ser Gly Ser Thr Gly

245 250 255

Ala Pro Lys Gly Ala Met Tyr Leu Gln Ser Ala Val Ala Lys Phe Trp

260 265 270

Arg Arg Asn Ser Lys Ala Trp Leu Gly Pro Val Ser Ser Ala Ile Asn

275 280 285

Leu Ser Phe Met Pro Met Ser His Val Met Gly Arg Gly Ile Leu Tyr

290 295 300

Ala Ser Leu Ala Ala Gly Gly Thr Cys Tyr Phe Ala Ala Arg Ser Asp

305 310 315 320

Leu Ser Thr Leu Leu Glu Asp Leu Ala Leu Thr Arg Pro Thr Glu Leu

325 330 335

Asn Phe Val Pro Arg Val Trp Glu Met Ile His Ser Glu Tyr Gln Ser

340 345 350

Arg Val Asp Gln Arg Leu Ala Glu Gly Gly Arg Asp Arg Glu Ala Val

355 360 365

Glu Ala Glu Val Leu Ala Glu Val Arg Asp Lys Val Leu Gly Gly Arg

370 375 380

Phe Val Ala Ala Met Thr Gly Ser Ala Pro Ile Ser Ala Glu Leu Lys

385 390 395 400

Thr Trp Thr Gln Asp Met Leu Gly Ile His Leu Leu Glu Gly Tyr Gly

405 410 415

Ser Thr Glu Ala Gly Met Ala Leu Phe Asp Gly Val Val Gln Arg Pro

420 425 430

Pro Val Ile Asp Tyr Lys Leu Val Asp Val Pro Asp Leu Gly Tyr Phe

435 440 445

Gly Thr Asp Gln Pro His Pro Arg Gly Glu Leu Leu Ile Lys Thr Glu

450 455 460

Asn Leu Phe Pro Gly Tyr Tyr Lys Arg Pro Glu Val Thr Ala Ser Val

465 470 475 480

Phe Asp Glu Asp Gly Phe Tyr Arg Thr Gly Asp Val Val Ala Glu Ile

485 490 495

Gly Pro Asp Gln Leu Arg Tyr Val Asp Arg Arg Asn Asn Val Leu Lys

500 505 510

Leu Ala Gln Gly Glu Phe Val Thr Leu Ala Lys Leu Glu Ala Val Phe

515 520 525

Gly Asn Ser Pro Leu Val Gln Gln Ile Tyr Val Tyr Gly Asn Ser Ala

530 535 540

Gln Pro Tyr Leu Leu Ala Val Val Val Pro Thr Asp Pro Ser Val Ser

545 550 555 560

Lys Glu Ala Ile Ala Glu Ser Leu Gln Glu Val Ala Arg Glu Ala Asp

565 570 575

Leu Gln Ser Tyr Glu Ile Pro Arg Asp Phe Ile Val Glu Thr Thr Pro

580 585 590

Phe Ser Leu Glu Asn Gly Leu Leu Thr Gly Ile Arg Lys Leu Ala Trp

595 600 605

Pro Lys Leu Lys Ala His Tyr Gly Glu Arg Leu Glu Gln Leu Tyr Ala

610 615 620

Glu Leu Ala Glu Thr Gln Ala Ala Glu Leu Arg Glu Leu Arg Ser Ala

625 630 635 640

Ser Ala Asp Ala Pro Val Val Glu Thr Val Ser Arg Ala Ala Gly Ala

645 650 655

Leu Leu Gly Ala Ala Ala Ser Asp Leu Gly Pro Asp Ala His Phe Thr

660 665 670

Asp Leu Gly Gly Asp Ser Leu Ser Ala Leu Thr Phe Gly Asn Leu Leu

675 680 685

Arg Glu Ile Phe Asp Val Asp Val Pro Val Gly Val Ile Val Ser Pro

690 695 700

Ala Thr Asp Leu Ala Gly Ile Ala Glu Tyr Ile Glu Thr Gln Arg Ser

705 710 715 720

Gly Ser Lys Arg Pro Thr Tyr Ala Ser Val His Gly Arg His Ala Ala

725 730 735

Glu Val Ser Ala Ala Asp Leu Thr Leu Asp Lys Phe Leu Asp Ala Asp

740 745 750

Thr Leu Ala Ala Ala Pro Asn Leu Pro Lys Ala Gly Ser Glu Val Arg

755 760 765

Thr Val Leu Leu Thr Gly Ala Thr Gly Phe Leu Gly Arg Tyr Leu Ala

770 775 780

Leu Glu Trp Leu Glu Arg Met Asp Leu Val Asp Gly Lys Val Ile Ala

785 790 795 800

Leu Val Arg Ala Lys Ser Asp Glu Glu Ala Arg Thr Arg Leu Asp Ala

805 810 815

Thr Phe Asp Ser Gly Asp Ala Lys Leu Leu Ala His Tyr Gln Asn Leu

820 825 830

Ala Ala Asp His Leu Glu Val Val Ala Gly Asp Lys Gly Glu Glu Asn

835 840 845

Leu Gly Leu Asp Gln Gln Thr Trp Gln Arg Leu Ala Asp Glu Val Asp

850 855 860

Leu Ile Val Asp Pro Ala Ala Leu Val Asn His Val Leu Pro Tyr Ser

865 870 875 880

Glu Leu Phe Gly Pro Asn Ala Leu Gly Thr Ala Glu Leu Ile Lys Ile

885 890 895

Ala Leu Thr Thr Lys Ile Lys Pro Tyr Thr Tyr Val Ser Thr Ile Gly

900 905 910

Val Gly Asp Gln Ile Glu Pro Gly Lys Phe Val Glu Asn Val Asp Val

915 920 925

Arg Glu Met Ser Ala Val Arg Lys Ile Asn Asp Gly Tyr Ala Asn Gly

930 935 940

Tyr Gly Asn Ser Lys Trp Ala Gly Glu Val Leu Leu Arg Glu Ala Asn

945 950 955 960

Asp Leu Cys Gly Leu Pro Val Ala Val Phe Arg Cys Asp Met Ile Leu

965 970 975

Ala Asp Thr Ser Tyr Ser Gly Gln Leu Asn Leu Pro Asp Met Phe Thr

980 985 990

Arg Met Met Leu Ser Leu Val Ala Ser Gly Ile Ala Pro Lys Ser Phe

995 1000 1005

Tyr Glu Leu Asp Ser Glu Gly Asn Arg Gln Arg Ser His Tyr Asp

1010 1015 1020

Gly Leu Pro Val Glu Phe Ile Ala Glu Ser Ile Ser Thr Leu Gly

1025 1030 1035

Gly Gln Ser Val Glu Ser Phe Glu Thr Tyr His Val Met Asn Pro

1040 1045 1050

Tyr Asp Asp Gly Leu Gly Met Asp Glu Phe Val Asp Trp Leu Ile

1055 1060 1065

Glu Ala Gly Tyr Pro Ile Glu Arg Ile Glu Asp Tyr Gly Gln Trp

1070 1075 1080

Val Gln Arg Phe Glu Ser Thr Leu Arg Ala Leu Pro Asp Lys Gln

1085 1090 1095

Arg Gln Ala Ser Leu Leu Pro Leu Leu His Asn Tyr Gln Lys Pro

1100 1105 1110

Glu Arg Pro Met Leu Gly Ala Leu Ala Pro Thr Asp His Phe Arg

1115 1120 1125

Ala Ala Val Gln Glu Ala Lys Ile Gly Pro Asp Lys Asp Ile Pro

1130 1135 1140

His Val Ser Pro Ala Val Ile Val Lys Tyr Ile Thr Asp Leu Gln

1145 1150 1155

Gln Leu Gly Leu Leu

1160

<210> 5

<211> 35

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 5

tgttgccatt gctgcaggca tctcgcacca tcagc 35

<210> 6

<211> 35

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 6

aggtcacttg gtcgagccag cgccgcctga ttctc 35

<210> 7

<211> 36

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 7

cagcgccgcc tgattctcgc tcgaccaagt gacctg 36

<210> 8

<211> 35

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 8

cgcggccgct taattaacga tcggcttgct ctagg 35

<210> 9

<211> 38

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 9

tgttgccatt gctgcaggat cagactcaca gcacattg 38

<210> 10

<211> 36

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 10

gatcttcgtg gtgagcgcgg cgagcgaggc atacag 36

<210> 11

<211> 36

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 11

ctgtatgcct cgctcgccgc gctcaccacg aagatc 36

<210> 12

<211> 35

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 12

cgcggccgct taattaaggt tcccctgagc aaatc 35

<210> 13

<211> 1149

<212> PRT

<213>mycobacteria (Mycobacterium neoaurum)

<400> 13

Met Phe Ala Glu Asn Leu Asp Asp Gln Gln Arg Leu Ala Asp Leu Tyr

1 5 10 15

Ala Thr Asp Pro Glu Phe Ala Ala Ala Ala Pro Asp Pro Ala Ile Ala

20 25 30

Asp Ala Val Ala Ala Pro Glu Met Arg Leu Pro Glu Ile Ile Arg Thr

35 40 45

Val Leu Thr Gly Tyr Ala Glu Arg Pro Ala Leu Gly Ser Arg Ala Val

50 55 60

Gln Leu Val Thr Asp Glu Ala Thr Gly Arg Thr Arg Ala Glu Leu Leu

65 70 75 80

Gly His Phe Glu Thr Ile Thr Tyr Gly Gln Leu Trp Asp Arg Val Arg

85 90 95

Ala Val Thr Asn Ala Trp Ser Asp Thr Val Arg Pro Gly Asp Arg Val

100 105 110

Ala Ile Leu Gly Phe Gly Ser Val Asp Phe Thr Val Ile Asp Ile Ala

115 120 125

Leu Thr Gln Leu Gly Ala Val Ser Val Pro Leu Gln Thr Ser Ala Thr

130 135 140

Ala Ala Ala Leu Ala Pro Ile Val Ala Glu Thr Glu Pro Ala Leu Ile

145 150 155 160

Ala Ser Asp Val Asn His Leu Asp Asp Ala Val Thr Leu Ala Leu Glu

165 170 175

Ser Gly Val Ala Thr Val Val Val Phe Asp Gln Asn Pro Ala Val Asp

180 185 190

Asp Asp Arg Glu Ala Ile Ala Ala Ala Thr Ala Arg Leu Asp Gly Gln

195 200 205

Thr Leu Ala Thr Leu Asp Glu Val Ile Ala Ala Gly Ala Glu Arg Pro

210 215 220

Asp Val Ala Ile Pro Ala Gln Glu Gly Asp Pro Leu Ser Leu Leu Ile

225 230 235 240

Tyr Thr Ser Gly Ser Thr Gly Ala Pro Lys Gly Ala Met Tyr Pro Gln

245 250 255

Gly Lys Val Ala Asp Ile Trp Arg Pro Ala Ile Asn Ser His Trp Asp

260 265 270

Ala Arg Gln Gly His Val Pro Ala Ile Val Leu Ser Phe Met Pro Met

275 280 285

Ser His Val Met Gly Arg Gly Ile Leu Tyr Ala Ser Leu Ala Ser Gly

290 295 300

Gly Val Val Asn Phe Ala Ala Arg Ala Asp Leu Ser Thr Leu Leu Glu

305 310 315 320

Asp Leu Ala Leu Thr Arg Pro Thr Gln Leu Asn Phe Val Pro Arg Val

325 330 335

Trp Asp Met Leu Phe Gln Asp Tyr Gln Ser Arg Ala Ala His Gly Gly

340 345 350

Ser Glu Ala Asp Ile Leu Ala Asp Met Arg Thr Asn Leu Leu Gly Gly

355 360 365

Arg Tyr Val Ser Ala Leu Thr Gly Ser Ala Pro Ile Ser Pro Glu Leu

370 375 380

Lys Ala Trp Val Glu Arg Leu Leu Asp Leu His Leu Val Glu Gly Tyr

385 390 395 400

Gly Ser Thr Glu Ala Gly Ala Val Phe Val Asp Gly Gln Ile Ser Arg

405 410 415

Pro Pro Val Leu Glu Tyr Lys Leu Val Asp Val Pro Glu Leu Gly Tyr

420 425 430

His Ser Thr Asp Val Pro His Pro Arg Gly Glu Leu Leu Ile Arg Ser

435 440 445

Glu Gln Leu Phe Pro Gly Tyr Tyr Lys Arg Pro Glu Val Thr Ala Ser

450 455 460

Val Phe Asp Glu Asp Gly Phe Tyr Arg Thr Gly Asp Ile Val Ala Glu

465 470 475 480

Leu Gly Pro Asp Gln Val Ala Tyr Ile Asp Arg Arg Asn Asn Val Leu

485 490 495

Lys Leu Ser Gln Gly Glu Phe Val Thr Val Ser Lys Leu Glu Ala Val

500 505 510

Phe Asn Thr Ala Pro Leu Val His Gln Ile Tyr Ile Tyr Gly Asn Ser

515 520 525

Ala Arg Pro Tyr Leu Leu Ala Val Val Val Pro Thr Asp Pro Ala Ala

530 535 540

Thr Lys Ala Glu Ile Ala Asp Ala Leu Lys Ala Ala Ala Arg Lys Ala

545 550 555 560

Asp Leu Gln Ser Tyr Glu Leu Pro Arg Asp Phe Leu Val Glu Thr Gln

565 570 575

Glu Phe Thr Thr Glu Asn Gly Leu Leu Thr Gly Ile Lys Lys Leu Ala

580 585 590

Trp Pro Lys Leu Lys Glu Arg Tyr Gly Ala Glu Leu Glu Gln Leu Tyr

595 600 605

Thr Asp Leu Ala Asp Gly Gln Ala Gly Glu Leu Gln Ala Leu Arg Ala

610 615 620

Thr Gly Ala Asp Ala Pro Val Leu Glu Thr Val Gly Arg Ala Ala Val

625 630 635 640

Ala Leu Leu Gly Ala Ala Ser Ser Asp Ile Ala Pro Asp Val His Phe

645 650 655

Thr Asp Leu Gly Gly Asp Ser Leu Ser Ala Leu Thr Phe Gly Asn Leu

660 665 670

Leu Ala Asp Ile Phe Asp Val Glu Val Pro Val Ser Val Ile Val Ser

675 680 685

Pro Thr Ala Asp Leu Ala Ser Ile Ala Ala His Ile Glu Thr Gln Arg

690 695 700

Ser Gly Ser Gly Leu Arg Pro Ser Phe Ala Ser Val His Gly Lys Asp

705 710 715 720

Ala Thr Val Ala Arg Ala Ala Asp Leu Thr Leu Asp Lys Phe Ile Asp

725 730 735

Ala Glu Thr Leu Ala Ala Ala Gly Asp Leu Ala Gly Pro Ala Thr Asn

740 745 750

Val Arg Thr Val Leu Leu Thr Gly Ala Thr Gly Phe Leu Gly Arg Tyr

755 760 765

Leu Ala Leu Glu Trp Leu Glu Arg Met Asn Leu Val Asp Gly Lys Val

770 775 780

Ile Ala Leu Val Arg Ala Arg Ser Asp Ala Glu Ala Arg Ala Arg Leu

785 790 795 800

Asp Ala Thr Phe Asp Thr Gly Asp Pro Lys Leu Val Ala His Tyr Arg

805 810 815

Glu Leu Ala Asp Lys His Leu Glu Val Leu Ala Gly Asp Lys Gly Glu

820 825 830

His Asp Leu Gly Leu Asp Arg Gln Thr Trp Gln Arg Leu Ala Asp Thr

835 840 845

Val Asp Leu Ile Val Asp Pro Ala Ala Leu Val Asn His Val Leu Pro

850 855 860

Tyr Asn Glu Leu Phe Gly Pro Asn Ala Leu Gly Thr Ala Glu Leu Ile

865 870 875 880

Arg Val Ala Leu Thr Thr Arg Ile Lys Pro Phe Val Tyr Val Ser Thr

885 890 895

Ile Gly Val Gly Ala Gly Ile Glu Pro Gly Arg Phe Val Glu Asp Ala

900 905 910

Asp Ile Arg Glu Ile Ser Ala Thr Arg Val Leu Asp Asp Ser Tyr Ala

915 920 925

Asn Gly Tyr Gly Ala Ser Lys Trp Ala Gly Glu Val Leu Leu Arg Glu

930 935 940

Ala His Glu Gln Phe Gly Leu Pro Val Ser Val Phe Arg Cys Asp Met

945 950 955 960

Ile Leu Ala Asp Thr Ser Tyr Ala Gly Gln Leu Asn Leu Pro Asp Met

965 970 975

Phe Thr Arg Met Met Leu Ser Leu Val Ala Thr Gly Ile Ala Pro Lys

980 985 990

Ser Phe Asn Gln Leu Asp Ala Gln Gly Asn Arg Gln Arg Ser His Tyr

995 1000 1005

Asp Gly Leu Pro Val Glu Phe Ile Ala Glu Ala Ile Ser Thr Leu

1010 1015 1020

Gly Ala Asp Val Thr Asp Gly Phe Glu Thr Tyr His Val Met Asn

1025 1030 1035

Pro His Asp Asp Gly Leu Gly Leu Asp Glu Phe Val Asp Trp Leu

1040 1045 1050

Val Asp Ala Gly His Pro Ile Arg Arg Ile Asp Asp Tyr Gln Ala

1055 1060 1065

Trp Phe Glu Gln Phe Gly Ala Thr Leu Arg Thr Leu Pro Asp Arg

1070 1075 1080

Gln Arg Gln Ala Ser Leu Leu Pro Leu Leu His Asn Tyr Thr Thr

1085 1090 1095

Pro Gly Gln Pro Val Asn Gly Ala Met Ala Pro Thr Asp Val Phe

1100 1105 1110

Arg Thr Ala Val Gln Glu Ala Lys Ile Gly Pro Asp Lys Asp Ile

1115 1120 1125

Pro His Val Ser Arg Asp Val Ile Val Lys Tyr Val Thr Asp Leu

1130 1135 1140

Gln Leu Leu Gly Leu Leu

1145

<210> 14

<211> 1160

<212> PRT

<213>mycobacteria (Mycobacterium neoaurum)

<400> 14

Met Thr Glu Asn Asp Thr Arg Lys Val Ala Asp Leu Glu Arg Ile Thr

1 5 10 15

Ala Lys Leu Met Gly Leu Leu Gly Ser Asp Pro Gln Phe Ala Ala Ala

20 25 30

Leu Pro Asp Ala Thr Ile Ala Glu Ala Val Lys Ala Pro Gly Met Arg

35 40 45

Leu Ala Glu Met Leu Ala Val Val Met Glu Gly Tyr Gly Pro Arg Pro

50 55 60

Ala Leu Gly Glu Arg Thr Tyr Arg Leu Thr Thr Asp Ala Ala Gly Arg

65 70 75 80

Thr Ser Arg Glu Phe Leu Ser Asp Phe Ala Thr Ile Thr Tyr Ala Glu

85 90 95

Leu Trp Arg Arg Val Gly Ala Leu Ala Ser Ala Trp Arg His Glu Ser

100 105 110

Thr Asp Val Arg Pro Gly Ser Phe Val Cys Thr Ala Gly Arg Ala Gly

115 120 125

Ile Asp Tyr Thr Val Ala Asp Leu Ala Cys Ile Arg Met Gly Ala Val

130 135 140

Ala Val Pro Leu Pro Ala Thr Ala Thr Glu Ser Glu Phe Thr Ala Met

145 150 155 160

Leu Glu Glu Val Arg Pro Ala Val Val Cys Ser Asp Met Glu Thr Val

165 170 175

Gly Arg Leu Ser Arg Ala Val Leu Ala Cys Ser His Lys Pro Arg Gln

180 185 190

Leu Val Leu Leu Asp Tyr Gln Ala Glu Asn Asp Glu Gln Arg Gln Ala

195 200 205

Phe Glu Ser Thr Val Gly Glu Val Gly Thr Met Phe Asp Val Asp Thr

210 215 220

Leu Gln Ser Leu Thr Glu Arg Gly Gly Gln Tyr Pro Ala Ile Ser Pro

225 230 235 240

Tyr Val Asp Ala Glu Asp Asp Asn Pro Met Ala Ala Leu Leu Tyr Thr

245 250 255

Ser Gly Ser Thr Gly Thr Pro Lys Ala Ala Ile Cys Thr Glu Arg Met

260 265 270

Cys Ala Met Ala Trp Thr Ser Ala Ser Leu Ala Pro Ala Ile Gly Leu

275 280 285

Thr Tyr Met Pro Met Ser His Phe Tyr Gly Arg Gly Phe Leu Tyr Thr

290 295 300

Thr Leu Ser Gly Gly Gly Thr Asn Tyr Phe Val Thr Glu Ser Asp Leu

305 310 315 320

Ser Ser Leu Phe Asp Asp Leu Ala Leu Ile Arg Pro Thr Ala Leu Pro

325 330 335

Leu Val Pro Arg Val Cys Glu Met Ile Ala His Arg Tyr His Gly Glu

340 345 350

Val Val Ala Arg Val Ala Ala Gly Cys Asp Arg Ala Ala Ala Glu Asp

355 360 365

Glu Ala Lys Thr Leu Val Arg Asp Gln Val Leu Gly Gly Arg Tyr Leu

370 375 380

Trp Ala Ser Cys Ala Ser Ala Pro Leu Ser Pro Ala Met His Thr Leu

385 390 395 400

Met Glu Glu Leu Leu Asp Ala Pro Leu Val Ile Ser Tyr Gly Ala Thr

405 410 415

Glu Ile Val Gly Val Thr Ile Asp Gly Val Val Ser Arg Pro Pro Val

420 425 430

Ile Asp Tyr Lys Leu Val Asp Val Pro Ala Leu Gly Tyr Phe Gly Thr

435 440 445

Asp Gln Pro Tyr Pro Arg Gly Glu Leu Leu Val Lys Thr Val Asn Ala

450 455 460

Met Ala Gly Tyr Tyr Lys Arg Pro Glu Leu Thr Ala Glu Ser Phe Asp

465 470 475 480

Ala Asp Gly Tyr Tyr Arg Thr Gly Asp Ile Met Ala Glu Ile Ala Pro

485 490 495

Asp Arg Leu Lys Tyr Val Asp Arg Val Asn Asn Val Leu Lys Leu Ala

500 505 510

Gln Gly Glu Phe Val Ala Val Ser Gln Leu Glu Ala Thr Phe Cys Ser

515 520 525

His Pro Leu Ile Glu Gln Ile Phe Val Tyr Gly Asn Ser Ser Gln Ser

530 535 540

Phe Val Leu Ala Ile Val Val Pro Asp Ala Thr Glu Ala Ala Arg His

545 550 555 560

Pro Ala Asp Ile Ser Ser Gln Ile Arg Asp Ala Leu His Ser Val Gly

565 570 575

Arg Glu Thr Gly Leu Lys Ser Trp Glu Val Pro Arg His Phe Leu Val

580 585 590

Glu His Gln His Phe Thr Ala His Asn Gly Leu Leu Thr Ala Ser Asn

595 600 605

Lys Leu Ala Arg Pro Lys Leu Ile Ala Arg Tyr Gly Ala Arg Leu Glu

610 615 620

Gln Leu Tyr Ala Glu Ile Ala Asp Ala Ala Ala Arg Asn Leu Arg Asp

625 630 635 640

Leu His Ser Gly Lys Thr Glu Arg Pro Val Val Asp Thr Ile Glu Arg

645 650 655

Ala Val Leu Val Ala Leu Asp Leu Pro Asp Thr Gly Gln Leu Arg His

660 665 670

Ala Arg Phe Val Asp Leu Gly Gly Asp Ser Met Ser Ala Leu Ser Leu

675 680 685

Ala Asn Leu Leu Glu Glu Ile Phe Glu Val Asp Val Pro Val Ala Asp

690 695 700

Ile Ile Asp Pro Thr Ile Glu Leu His His Leu Ala Ala Arg Ile Ser

705 710 715 720

Ala Arg Ile Asp Thr Arg Ser Ala Val Pro Asn Ala Lys Ser Val His

725 730 735

Gly Ser Glu His Ala Arg Ile Ser Ala Ala Gln Leu Thr Leu Asp Ala

740 745 750

Phe Ala Ala Gly Pro Gly Gln Ala Pro Gly Ala Gly Glu Val Asp Ala

755 760 765

Val Thr Arg Pro Pro Arg Thr Val Leu Leu Thr Gly Ala Thr Gly Phe

770 775 780

Leu Gly Arg Phe Gln Cys Val Glu Leu Met Thr Met Met Ala Asn Gly

785 790 795 800

Thr Gly Gly Lys Val Val Cys Ile Val Arg Gly Arg Ser His Asp Asp

805 810 815

Ala Arg Asp Arg Leu Leu Arg Ala Val Ala Ala Asp Ser Ala Phe Met

820 825 830

Glu Lys Phe Thr Arg Leu Ala Glu Asn His Leu Glu Val Leu Ala Gly

835 840 845

Asp Leu Gly Leu Pro Arg Phe Gly Met Gln Asn Gly Asp Trp Asp Arg

850 855 860

Leu Cys Asp Thr Val Asp Ala Ile Val His Ala Gly Ala Leu Val Asn

865 870 875 880

His Ala Leu Pro Tyr Arg Ala Leu Phe Ala Pro Asn Val Phe Gly Thr

885 890 895

Ser Glu Val Leu Arg Leu Ala Val Thr Gly Arg Leu Lys Pro Val Ser

900 905 910

Phe Ile Ser Thr Val Ala Ala Ala Val Thr Pro Thr Gly Ser Leu Val

915 920 925

Asp Glu Asn Ser Asp Ile Arg His Ala Ser Pro Tyr Arg Asp Leu Asp

930 935 940

Asn Thr Tyr Ala Asn Gly Tyr Gly Ala Ser Lys Trp Ala Ala Glu Val

945 950 955 960

Leu Cys Arg Asp Ala His Gln Arg Tyr Gly Leu Pro Val Asn Val Phe

965 970 975

Arg Cys Ser Met Leu Leu Pro His Arg Leu Phe Pro Gly His Val Asn

980 985 990

Ser Gln Asp Val Leu Ser Arg Leu Leu Ala Ser Leu Ile Asp Thr Gly

995 1000 1005

Leu Ala Pro Gly Ser Phe Tyr Thr Gly Asp Ser Gln His Ala His

1010 1015 1020

Phe Asp Gly Leu Pro Val Asp Phe Val Ala His Ala Thr Thr His

1025 1030 1035

Ile His Pro Glu Thr Arg Thr Phe Arg Thr Phe Asn Val Val Asn

1040 1045 1050

Pro Asn Pro Asp Asn Val Ser Ile Asp Thr Phe Val Thr Trp Leu

1055 1060 1065

Val Glu Ala Gly Phe Pro Ile Arg Tyr Ile Asp Asp Tyr Asp Glu

1070 1075 1080

Trp Phe Cys Arg Thr His Thr Ala Leu Arg Ala Leu Pro Asp Ser

1085 1090 1095

Val Arg His Gln Thr Leu Phe Asp Leu Pro Ser Val Phe Ala His

1100 1105 1110

Pro Ser Pro Ala Ile Pro Gly Ser Met Phe Pro Ala Asp Met Phe

1115 1120 1125

Cys Ala Thr Val Arg Asp Thr Leu Ala Ala Asp Gly Ala Ile Pro

1130 1135 1140

Thr Val Glu Gly Val His Ile Val Arg Leu Ala Glu Ala Leu Arg

1145 1150 1155

Pro Arg

1160

<210> 15

<211> 41

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 15

acgttgttgc cattgctgca gagcagtgag gcctgccgtt g 41

<210> 16

<211> 50

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 16

gacacagctc aacttcgtcc cagtactggg aactggcaga caaacacctg 50

<210> 17

<211> 50

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 17

ggtgtttgtc tgccagttcc cagtactggg acgaagttga gctgtgtcgg 50

<210> 18

<211> 46

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 18

cttaattaag cggccgcggt acccgccgaa aatcttgatg accagc 46

<210> 19

<211> 49

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 19

tagcgcgcga agtgctgtgt agtactcagc atctcggcaa gtcgcattc 49

<210> 20

<211> 49

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 20

tagcgcgcga agtgctgtgt agtactcagc atctcggcaa gtcgcattc 49

<210> 21

<211> 49

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 21

tgcgacttgc cgagatgctg agtactacac agcacttcgc gcgctaccc 49

<210> 22

<211> 46

<212> DNA

<213>artificial sequence (Artifical sequence)

<400> 22

cttaattaag cggccgcggt acctcgccga gctgctggat gagatg 46

Claims

1. a kind of method for producing paddy lactone by microbial fermentation, including the use of paddy lactone production bacterium by sterol fermenting and producing paddy Lactone, which is characterized in that the paddy lactone production bacterium has at least one fatty acid coa A/ carboxylate reductase, which can urge Change the reaction i of following compound I to II, and the method includes inhibiting described at least one of described paddy lactone production bacterium The activity and/or expression quantity of fatty acid coa A/ carboxylate reductase, the reaction are as follows:

Wherein, "-X " is hydroxyl or carbonyl；"-Y " is hydroxyl or "-SCoA ".

2. according to the method described in claim 1, wherein the paddy lactone production bacterium bag includes actinomyces (Actinomycetales) With pseudomonad (Pseudomonas)；Preferably, the actinomyces include Rhodococcus sp (Rhodococcus), promise cassette bacterium (Nocardia), mycobacteria (Mycobacterium), streptomycete (streptomyces) and arthrobacterium (Arthrobacter)。

3. according to the method described in claim 1, the wherein amino acid sequence such as SEQ of the fatty acid coa A/ carboxylate reductase Shown in ID NO:2,4,13 or 14.

4. according to the method described in claim 1, wherein the inhibition is realized by gene knockout or gene mutation.

5. according to the method described in claim 1, wherein the fermenting and producing carries out 3-12 days at 25-45 DEG C, the pH of 7-8.

6. a kind of paddy lactone production engineering bacterium, which is characterized in that at least one of described paddy lactone production engineering bacterium fatty acid Coacetylase/carboxylate reductase activity and/or expression quantity are suppressed, wherein the fatty acid coa A/ carboxylate reductase can urge Change the reaction i of following compound I to II:

Wherein, "-X " is hydroxyl or carbonyl；"-Y " is hydroxyl or "-SCoA ".

7. paddy lactone production engineering bacterium according to claim 6, wherein paddy lactone production bacterium bag includes actinomyces (Actinomycetales) and pseudomonad (Pseudomonas)；Preferably, the actinomyces include Rhodococcus sp (Rhodococcus), promise cassette bacterium (Nocardia), mycobacteria (Mycobacterium), streptomycete (streptomyces) With arthrobacterium (Arthrobacter).

8. paddy lactone production engineering bacterium according to claim 6, wherein the ammonia of the fatty acid coa A/ carboxylate reductase Base acid sequence is as shown in SEQ ID NO:2,4,13 or 14.

9. paddy lactone production engineering bacterium according to claim 8, wherein the inhibition is prominent by gene knockout or gene Become to realize.

10. application of the paddy lactone production engineering bacterium in fermenting and producing paddy lactone according to any one of claim 6-9.

11. application according to claim 10, wherein the fermenting and producing carries out 3-12 at 25-45 DEG C, the pH of 7-8 It.

12. the application that fatty acid coa A/ carboxylate reductase is used to be catalyzed the reaction i of following compound I to II:

Wherein, "-X " is hydroxyl or carbonyl；"-Y " is hydroxyl or "-SCoA ".

13. application according to claim 12, wherein the amino acid sequence of the fatty acid coa A/ carboxylate reductase is such as Shown in SEQ ID NO:2,4,13 or 14.

14. application according to claim 12, wherein the catalysis carries out at pH 7-10,25-45 DEG C.