CA2396879A1 - Microbial 9a-hydroxylation of steroids - Google Patents

Abstract

A method is described to construct genetically modified strains of steroid degrading micro-organisms wherein multiple genes involved in steroid nucleus degradation are inactivated, such as steroid dehydrogenase genes. Examples for such genes are kstD1 and kstD2: strains with multiple inactivated steroid degrading enzyme genes can be used in the accumulation of steroid intermediates with a high yield. A preferred accumulation product is 9.alpha.-hydroxy-4-androstene-3,17-dione.

Description

Microbial 9a-hydroxylation of steroids The invention relates to a method to prepare genetically modified micro-organisms s having inhibited capacity for nucleus degradation of steroids, the use of such micr-organism in steroid accumulation as well as such modified micro-organisms.
The ability to degrade phytosterols is widespread in nocardioform actinomycetes and requires a set of enzymes degrading the side-chain and the steroid nucleus structure.
The enzyme 3-ketosteroid 0'-dehydrogenase (KSTD) [4-ene-3-oxosteroid:(acceptor)-1-to ene-oxidoreductase, EC 1.3.99.4] is involved in cleavage of ring B of the steroid nucleus by introducing a double bond at the C1-C2 position. More particularly, the enzyme is involved in the conversion of 4-androstene-3,17-dione in 1,4-androstadiene-3,17-dione and of 9a-hydroxy-4-androstene-3,17-dione in 9a-hydroxy-1,4-androstadiene-3,17-dione (see Figure 1). The enzyme has been identified in several is bacteria: Arthrobacter simplex (Penasse and Peyre, 1968 Rhodococcus. Crit Rev Biotech 14:29-73), Pseudomonas (Levy and Talalay, 1959 J Biol Chem 234:2009-20013; 1959 J Biol Chem 234:2014-2021 ), Nocardia restrictus (Sih and Bennet, Biochem Biophys Acta 56:587-592), Nocardia corallina (Itagaki et al., 1990 Biochim Biophys Acta 1038:60-67), Nocardia opaca (Drobnic et al., 1993 Biochim Biophys Res 2o Comm 190:509-515), Mycobacterium fortuitum (Wovcha et al., 1979 Biochim Biophys Acta 574:471-479) and Rhodococcus erythropolis IMET7030 (Kaufmann et al., 1992 J
Steroid Biochem Molec Biol 43:297-301). KSTD of N. opaca has been characterized as a flavoprotein (Lestrovaja et al., 1978 Z Allg Mikrobiol 18:189-196). Only the KSTD
encoding genes (kstD: 3-ketosteroid D' Dehydrogenase) of A. simplex, Comamonas 2s testosterone and Rhodococcus rhodochrous have been fully characterized (Plesiat et al., 1991 J Bacteriol 173:7219-7227; Molnar et al., 1995 Mol Microbiol 15:895-905;
Morii et al., 1998 J. Biochem 124:1026-1032).
The exclusive inhibition of the steroid 1,2-dehydrogenase causes accumulation of 9a-hydroxy-4-androstene-3,17-dione, an excellent starting material for corticoid synthesis 30 (Kieslich K., 1985 J Basic Microbiol 25:461-474). 9a-Hydroxyandrogens are of industrial importance as anti-androgens, anti-estrogens and antifertility. The 9a-hydroxy group is easily dehydrated to the 9( 11 )-dehydro system and offers a starting structure for the production of 9a-halogen corticoids.

eppi~' ~~; DESC =w .
'' ~ ~.~ ~ CA 02396879 2002-07=10 t Rhodococcus species are well-known for their large catabolic potential (Warhurst and Fewson, 1994 Rhodococcus. Crit Rev Biotech 14:29-73; Bell et al., 1998 J Appl Microbiol 85:195-210). Several Rhodococcus species are able to degrade natural phytosterols, which are inexpensive starting materials for the production of bioactive s steroids (Kieslich K., 1986 Drug Res 36: 888-892). Rhodococcus and Mycobacterium strains treated with mutagens and/or incubated with enzyme inhibitors convert sterols into 4-androstene-3,17-dione and 1,4-androstadiene-3,17-dione (Martin, 1977 Adv Appl Microbiol 22:29-58).
Although cloning of kstD and expression of an inactive KSTD pmtein of R.
erythropolis to IMET7030 in Escherichia coli have been described (Wagner et al., 1992 J
Basic Microbiol 32:65-71; 1992 J Basic Microbiol 32:269-277) and a nucleotide sequence of N. opaca (Dmbni~ et al., 1993 Biochem Biophys Res Comm 190:509-S 15) (synonym R.
erythropolis IMET7030) is available (DDBJ/EMBL/GenBank U59422), no molecular characterization of this gene has been reported. KSTD activity is essential for steroid is nucleus degradation and kstD gene inactivation is needed to accumulate steroid intermediates. According to one aspect of the present invention the nucleotide sequence of the kstD gene of R. erythropolis has been provided. KSTD1 protein is encoded by nucleotides 820-2329 of SEQ ID NO:1.
Inactivation of genes is a powerful tool for analysis of gene function and for 2o introduction of metabolic blocks. Gene disruption with a non-replicative vector carrying a selective marker is the commonly used method for gene inactivation.
Construction of strains with desirable properties via metabolic pathway engineering approaches, however, may require the stepwise inactivation or replacement of several genes. This is only possible when a suitable strategy for introduction of unmarked gene deletions or 2s gene replacements, allowing infinite rounds of metabolic engineering without being dependent on multiple markers, is available. According to another aspect of the present invention there is provided a stepwise inactivation of genes, preferably dehydrogenase genes, involved in steroid degradation. In particular the invention applies for an inactivation of genes involved in the accumulation of 9a-hydroxy-4-androstene-3,17-ao dione by growing of micro-organisms on 4-androstene-3,17-dione. Preferably, at least the gene kstDl is inactivated.
It was unexpectedly found that disruption of the kstDl gene encoding 3-ketosteroid ~~-dehydrogenase in R.erythropolis SQ1 did not result in inactivation of steroid nucleus degradation. The remaining activity appeared to be based on the presence of a second ss enzyme. It has now been found that inactivation of more than one gene is required to obtain a strain completely blocked in steroid nucleus degradation. Preferably the second s, enzyme is a dehydrogenase, more preferably a KSTD isoenzyme. In order to make it possible to disrupt or delete several genes, preferably a method of site-directed mutagenesis can be used. A method for introduction of unmarked gene deletions is to be preferred for the stepwise inactivation of KSTD genes. The resulting genetically s modified strains would be free of heterologous DNA.
According to another preferred embodiment of this invention, at least the gene kstD2 is inactivated. Most preferably, at least both the genes kstDl and kstD2 are inactivated.
Another aspect of the present invention is the nucleotide sequence of the kstD2 gene of R. erythropolis. KSTD2 protein is encoded by nucleotides 1-1678 of SEQ ID
NO:S.
o No methods for introduction of unmarked gene deletions in the genus Rhodococcus have been reported. Gene deletion or gene replacement methods, however, have been described for some other members of the actinomycetales, namely Streptomyces (Hillemann et al., 1991 Nucleic Acid Res 19:727-731; Hosted and Baltz, 1997 J.
Bacteriol 179:180-186), Corynebacterium (Schafer et al., 1994 Gene 145:69-73) and is Mycobacterium (Marklund et al., 1995 J Bacteriol 177:6100-6105; Norman et al., 1995 Mol Microbiol 16:755-760; Sander et al., 1995 Mol Microbiol 16:991-1000;
Pelicic et al., 1996 Mol Microbiol 20:919-125; Knipfer et al., 1997 Plasmid 37:129-140).
Counter-selectable markers may be used to screen for the rare second recombination event resulting in gene deletion or gene replacement. In this respect, both sacB and rpsL
2o proved to be useful reporter genes (Hosted and Baltz, 1997 J Bacteriol 179:180-186;
Schafer et al., 1994 J Bacteriol 172:1663-1666; Sander et al., 1995 Mol Microbiol 16:991-1000; Pelicic et al., 1996 Mol Microbiol 20:919-925; Jager et al., 1992 J
Bacteriol 174:5462-5465), but other suitable markers can be used as well. The use of rpsL in Rhodococcus has not been reported, but sacB (encoding the Bacillus subtilis 2s levansucrase) provides a potent positive selection marker in this genus (Jager et al., 1995 FEMS Microbiol Lett 126:1-6; Denis-Larose et al., 1998 Appl Environ Microbiol 64:4363-4367).
The B. subtilis levansucrase, encoded by the sacB gene, catalyzes hydrolysis of sugars and synthesis of levans (high-molecular weight fructose polymers). Expression of sacB
3o in Rhodococcus is lethal in the presence of sucrose. The biochemical basis for toxicity of levansucrase action on sucrose is still unknown. Conditional lethality (i.e. presence or absence of sucrose) of the sacB gene therefore can be used as a counter-selectable marker. Counter-selection in this context means that expression of the marker is lethal, instead of giving rise to resistance as is the case for selectable markers (e.g. resistance 3s markers).

Counter-selection is needed to select for those mutants that have undergone a second recombination event, thereby losing the sacB marker and introducing the desired mutation. The advantage of this system is that during selection solely potentially good mutants will survive the selection. Compared to a system in which only one selection s marker is used, counter-selection avoids a time consuming screening process for loss of the resistance marker that would be necessary in an one-selection-marker system.
An advantage of unmarked mutation is that it allows the repetitive introduction of mutations in the same strain. Foreign DNA (vector DNA) is removed in the process of introducing the mutation. Newly introduced vector DNA, for the introduction of a o second mutation, therefore cannot integrate at the site of the previous mutation (by homologous recombination between vector DNA's). Integration will definitely happen if vector DNA is still present in the chromosome and will give rise to a large number of false-positive integrants. The system enables the use of a sole antibiotic gene for the introduction of an infinite number of mutations. Unmarked mutation also allows easy is use in the industry because of the absence of heterogeneous DNA allowing easy disposal of fermentation broth.
Gene inactivation by gene deletion enables the construction of stable, non-reverting mutants. Especially small genes (<500 bp) are inactivated more easily by gene deletion compared to gene disruption by a single recombination integration. Gene deletion 2o mutagenesis can also be applied to inactivate a cluster of several genes from the genome. The gene deletion mutagenesis strategy can be applied also for gene-replacement (e.g. changing wild type into mutant gene).
The preferred strain for mutagenesis of the catabolic steroid dehydrogenases genes is Rhodococcus erythropolis. However, unmarked gene deletion of kstDl and/or kstD2 in 2s other species, genetically accessible by conjugation, is conceivable if the molecular organization is the same (or similar) as in R. erythropolis SQ1. Preferably these species belong to the genus Rhodococcus but also related species such as Nocardia, Mycobacterium and Arthrobacter can be used.
Gene inactivation in Rhodococcus is hampered by the occurrence of illegitimate 3o recombination events resulting' in random genomic integration of the mutagenic vector (Desomer et al., 1991 Mol Microbiol 5:2115-2124; Barnes et al., 1997 J
Bacteriol 179:6145-6153), a phenomenon we encountered when attempting to disrupt the kstDl gene in R. eryrhropolis SQ1. Illegitimate recombination is also a well-known phenomenon in some slow-growing species of Mycobacterium (McFadden, 1996 Mol 3s Microbiol 121:205-211). Conjugative plasmid transfer from E.coli S17-1 to Rhodococcus has been shown to minimize random integration (Powell and Archer, Antinie van Leeuwenhoek 74:175-188). Conjugative mobilization of plasmids from E.
coli strain S17-1 to many different strains of coryneform bacteria and to Rhodococcus fascians DSM20131 has been proven possible (Schafer et al., 1990 J. Bacteriol 172:1663-1666; Jager et al., 1995 FEMS Microbiol Lett 126:1-6). According to the s present invention conjugative transfer of a mutagenic vector carrying the sacB gene as counter-selectable marker therefore was adopted for introduction of unmarked gene deletions in steroid catabolism in R. erythropolis SQ1.
As a further embodiment of the present invention, the introduction of a second gene inactivation event can be performed using the same methods as is illustrated in the Examples for kstD2. For even further gene inactivation, the same methods may be used again, or, alternatively, IJV irradiation or chemical means such as nitroguanidine or diepoxyethaan may be used. Methods to introduce gene mutations in that way are well known in the art.
Also, methods to construct vehicles to be used in the mutagenesis protocol are well is known (Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, latest edition). Furthermore, techniques for site directed mutagenesis, ligation of additional sequences, PCR, sequencing of DNA
and construction of suitable expression systems are all, by now, well known in the art.
Portions or all of the DNA encoding the desired protein can be constructed synthetically 2o using standard solid phase techniques, preferably to include restriction sites for ease of ligation.
Modifications and variations of the method for introducing disrupted gene mutations or umnarked gene deletion as well as transformation and conjugation will be obvious to those skilled in the art from the foregoing detailed description of the invention. Such 2s modifications and variations are intended to come within the scope of present application.
According to another aspect of the present invention micro-organisms possessing multiple gene inactivation's can be used to accumulate steroid intermediates.
Preferably the accumulated product is 9a-hydroxy-4-androstene-3,17-dione. The starting material 3o may depend on the enzyme genes which are inactivated. Suitable starting materials are e.g. phytosterols or 4-androstene-3,17-dione. The preferred starting material is 4-androstene-3,17-dione.
An advantage of the present method is that high conversion yields from the starting steroid into the accumulated product can be obtained: The yields may exceed 80%, 3s preferably more than 90% and often reach a value of almost 100%.

Still another aspect of the invention resides in genetically modified micro-organisms with multiple inactivated genes which are involved in steroid degradation.
Especially these genes are dehydrogenases. Preferably at least the gene kstD 1 or kstD2 is inactivated. In particular preferred is the inactivation of both genes kstD1 and kstD2.
s Preferred are micro-organisms belonging to the genus Rhodococcus. Most preferred is the strain Rhodococcus erythropolis RG1-LTV29.
The micro-organism strains Rhodococcus erythropolis RG1-UV29 and Rhodococcus erythropolis RG1 have been deposited at the Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH (DSMZ), Mascheroder Weg 1b, D-38124 to Braunschweig, Germany under the accession numbers DSM 13157 and DSM 13156, respectively. These deposits have been made under the terms of the Budapest Treaty.
A person skilled in the art will understand how to use the methods and materials described and referred to in this document in order to construct micro-organisms lacking the ability to degrade the steroid nucleus. Multiple genes encoding for several other is steroid nucleus degrading enzymes can similarly be inactivated.
The following examples are illustrative for the invention and should in no way be interpreted as limiting the scope of the invention.
Legends to the figures Figure 1 2o Schematic representation of steroid nucleus degradation in R. erythropolis SQ1. The positions of the 3-ketosteroid O'-dehydrogenase (KSTD) isoenzymes are indicated with KSTD 1 and KSTD3 Figure 2 Schematic representation of the mutagenic vector pSDH422 with the counter-selectable 2s marker sacB used for construction of Rhodococcus erythropolis strain RGl with an 1062 by unmarked kstDl gene deletion. ORF2 and ORF3 are the flanking genes of kstD 1 in R. erythropol is S Q 1.
Figure 3 Schematic overview of the molecular organization of kstDl in wild type R.
erythropolis 3o SQ1 and after integration of pSDH422 by a single cross-over event at the targeted locus downstream (strain SDH422-3) and upstream (strain SDH422-4) of kstDl, respectively.
Inserted window: Southern analysis, using kstDl as a probe, of R. erythropolis _7_ chromosomal DNA digested with BamHI of wild type (lane 1 ), strain SDH422-3 (lane 2); SDH422-4 (lane 3) and two individual kstDl deletion mutants (lanes 4 and 5).
Figure 4 Bioconversions in 6 liter culture of Rhodococcus erythropolis SQ1 I1V-29 of 4-s androstene-3,17-dione into 9a-hydroxy-4-androstene-3,17-dione. 10 g/1 AD (-O-) and 20 g/1 AD (-O-, - ~ -, -X-) Figure 5 Bioconversion in 6 liter culture of Rhodococcus erythropolis RG8 of 4-androstene-3,17-dione into 9a-hydroxy-4-androstene-3,17-dione. 10 g/1 AD (-0-, -X-) to Examples Ezample 1 kstDl characterization.
A degenerated kstD oligonucleotide probe [5' ttcgg(c/g)gg(c/g)ac(c/g)tc(c/g)gc(c/g)tac ~s tc(c/g)gg(c/g)gc(c/g)tc(c/g)atctgg] (SEQ ID N0:2) was developed from an alignment of the N-terminal parts of known KSTD protein sequences of A. simplex, C.
testosterone and N. opaca. Total DNA of R. erythropolis SQ1 digested with BgIII was sized by sucrose gradient centrifugation. Southern analysis at 68 °C (stringent washes with 2xSSC for 2x15 min and O.IxSSC for 2x10 min) of fractions obtained yielded a 6 kb 2o DNA fragment hybridizing with digoxigenine-labelled kstD oligonucleotide probe. This fragment was legated into the BgIB site of the Rhodococcus-E. coli shuttle-vector pDA71 (Dabs et al., 1995 Development of improved Rhodococcus plasmid vectors and their use in cloning genes of potential commercial and medical importance, p.129-135.
In: Proceedings of the Ninth Symposium on the Actinomycetes, Moscow, Russia) and 2s subcloned into BamHI digested pBluescript II KS (Stratagene) (pSDH200).
From restriction mapping analysis we concluded that only one EcoRV site was present on the 6 kb fragment, dividing it into equally sized fragments of approximately 3 kb.
Southern analysis showed that an approximately 2.9 kb EcoRV fragment of pSDH200 contained sequences homologous to the kstD oligonucleotide. Nucleotide sequencing 3o revealed an open reading frame of 1,533 nt (kstDl, see SEQ ID NO:1) encoding KSTD1, as was demonstrated by heterologous expression in Escherichia. Further _g-nucleotide sequencing revealed two ORFs of 1,533 nt (ORF1) and 627 nt (ORF2) encoding putative proteins of S 10 as and 208 aa, respectively.
Example 2 KstD 1 deletion strain.
s A mutagenic vector was constructed that contains a R. erythropolis SQ1 chromosomal DNA fragment with a kstDl deletion. A 1062 by BsmI fragment of pSDH200, encoding a large internal part of KSTD1, was deleted to construct pSDH200)BsmI. For construction of the mutagenic vector a 2724 by SmaIlEcoRI fragment of pSDH200)BsmI harbouring the remaining 468 by of kstDl and its flanking regions was to cloned into the SmaIlEcoRI site of pKl8mobsacB (pSDH422, see Figure 2). The vector pSDH422, encoding kanamycin resistance to select for integration of the mutagenic vector into the chromosome and harbouring the sacB gene of B. subtilis for counter-selection, was introduced into E.coli S17-l and mobilized to R. erythropolis SQ1 by conjugation as follows. Cells of the R. erythropolis SQ1 recipient strain were spread on is LBP agar supplemented with 30 ~g~ml-' nalidixic acid and grown for 5 days.
The mutagenic vector pSDH422 was first introduced in E.coli S17-1 by transformation.
Transformants (approx. 1000 per plate) grown overnight on selective media (kanamycin 25 pg~ml-') were incubated at room temperature for another 24 h. Colonies of both Rhodococcus and E.coli strains were resuspended in a final volume of 1.5 ml of LBP
20 (1% bacto-pepton (Difco), 0.5% yeast extract (BBL) and 1% NaCI). Aliquots of 750 ~1 of each strain were mixed and gently pelleted by centrifugation. The pellet was resuspended in 1 ml LBP and cells were spread on non-selective LBP agar in 250 ~.l aliquots. After growth overnight at 30°C the confluently grown material was resuspended in 2 ml LBP medium and 100 p1 aliquots spread on LBP agar 2s supplemented with kanamycin (200 pg~ml-') and nalidixic acid (30 ~g~ml-').
R.
erythropolis SQ1 transconjugants appeared after 3 days. All resulting kanamycin resistant (kan') Rhodococcus transconjugants were sucrose sensitive (sucs); no growth occurred after replica plating on LBPS (1% bacto-pepton, 0.5% yeast extract, 1% NaCI, 10% sucrose) agar supplemented with 200 pg~ml-' kanamycin.
3o Southern analysis (Fig. 3) of wild type (lane 1: single band of approx.
4500 bp) and of two transconjugants, SDH422-3 (lane 2: two bands of approx. 2900 and 10100 bp) and SDH422-4 (lane 3: two bands of approx. 4000 and 9000 bp) revealed that both had retained one copy of pSDH422 integrated at the targeted locus by a single recombination event. Gene deletion of kstDl in the R.erythropolis SDH422-3 strain was achieved during growth overnight under non-selective conditions, made visible by subsequent plating on selective medium, i.e. LBPS agar Gene deletion of the kstDl gene was achieved during growth overnight under non-selective conditions and subsequent plating on selective medium, i.e. LBPS
agar.
s Colony PCR with kstD 1 primers (forward primer [5' gcgcatatgcaggactggaccagcgagtgc]
(SEQ ID N0:3); reverse primer [5' gcgggatccgcgttacttcgccatgtcctg](SEQ ID
N0:4)) on 9 suc'/kans colonies resulted in 6 PCR products with fragment sizes of 468 by comprising the deleted kstDl gene. Gene deletion was confirmed by Southern analysis at 60 °C (stringent washes with 2xSSC for 2x5 min and O.IxSSC for 2x5 min) using to randomly digoxigenine-labelled kstDl gene as a probe. The 4.5 kb kstDl DNA
fragment of wild type obtained after BamHI digestion of chromosomal DNA was reduced to 3.4 kb in the gene deletion mutants, indicating deletion of the expected 1062 by kstDl DNA
fragment. The resulting strain was denoted R. erythropolis RGl.
Ezample 3 is Inactivation of steroid D'-dehydrogenation by UV mutagenesis.
Late exponential phase R. erythropolis RG1 cells (2~10g CFUs~ml~') grown in 10 mM
glucose mineral medium (KZHPO4 4.65 g~l-', NaHzP04~H20 1.5 g~l-', NH4C1 3 g~l-', MgS04~7Hz0 1 g~f', Vishniac trace elements, pH 7.2) were sonicated for a short period of time to obtain single cells. Diluted (104) samples were spread on glucose mineral agar 2o medium and irradiated for 15-20 sec with an L1V lamp (Philips TAW 15 W) at a distance of 27 cm, on average resulting in 95% killing of cells. After 4 days of incubation, colonies were replica plated on 4-androstene-3,17-dione (0.5 g~l-', solubilized in DMSO
(50 mg~ml-')) mineral agar medium. Steroid growth deficient mutants scored after 3-4 days were selected for further characterization. To select for strains blocked in 0'-2s dehydrogenation the mutant population was screened for 4-androstene-3,17-dione growth deficient mutants able to grow on 1,4-androstadiene-3,17-dione (0.25 g~l-') mineral agar medium It can be concluded that the gene was inactivated. The gene was called kstD3 (see Figure 1 ).
Example 4 3o Microbiological 9a-hydroxylation of 4-androstene-3,17dione with LJV-mutant Rhodococcus erythropolis UV-29.
Rhodococcus erythropolis SQ1 LTV-29 is a LTV-mutant which is capable of conversion of4-androstene-3,17-dione (AD) into 9a-hydroxy-4-androstene-3,17-dione (9aOH-AD) with concentration of 10 to 20 g/1.

This conversion was performed using the following method:
A 250 ml Erlenmeyer flask containing 75 ml sterile medium ( 1.5% yeast extract, 1.5%
glucose; pH 7.0) was grown with Rhodococcus erythropolis SQ1 LJV-29 on a rotary shaker (180 rpm) at 28 °C for 24 hours (preculture). A 10 liter fermentor with 6 liter in s situ sterilized fermentation broth (1.5% yeast extract, 1.5% glucose, 0.01%
antifoaming agent polypropylene glycol; pH 7.5) was inoculated with preculture (1%) and incubated at 28°C for 16 hours under sparging with sterile air and the culture was agitated to induce submerged growth. Then a suspension of 60 gram 4-androstene-3,17-dione in 300 ml polysorbate (0.1%) was introduced. Aerobic incubation with agitation at 28°C
to was then resumed for 24 hours. Samples of the culture were then extracted with methanol (70%) and filtrated over a dead-end 0.45g.m filter before the steroid composition was determined with HPLC. The same procedure was performed in triplo with a two-times higher AD-concentration of 20 g/1, by adding 120 g instead of 60 g AD.
is As shown in figure 4 within 24 hours 10-20 g/1 of 4-androstene-3,17-dione is almost completely conversed into 9oc-hydroxy-4-androstene-3,17-dione (approximately 93% of total 4-androstene-3,17-dione).
Ezample 5 2o kstD2 characterization.
A gene library of R. erythropolis RG1 was introduced into competent R.
erythropolis strain RG1-UV29 by electrotransformation. Colonies obtained were replica plated onto mineral agar medium containing 4-androstene-3,17-dione (0.5 g/1) as sole carbon and 2s energy source. Complementation of the strain RG1-ITV29 phenotype was scored after three days of incubation at 30 °C. Colonies growing on 4-androstene-3,17-dione mineral agar medium were cultivated in LBP medium for isolation of plasmid DNA, that was subsequently re-introduced into strain RG1-UV29 to check for genuine complementation. Plasmid pKSD101, isolated from a transformant that showed restored 3o growth on 4-androstene-3,17-dione mineral medium, was introduced into E.
coli DHSa for further analysis. An insert of approximately 6.5 kb rhodococcal DNA was identified in pKSD101 and subjected to restriction mapping analysis, subcloning and subsequent complementation experiments. A 3.6 kb EcoRI DNA fragment of pKSD 1 O l was still able to restore the strain RG1-LTV29 phenotype and thus was subcloned in 3s pBluescript(II) KS (pKSD105) for nucleotide sequencing. Nucleotide sequence analysis revealed the presence of a large open reading frame (ORF) of 1,698 nt, encoding a putative protein of 565 amino acids with a calculated molecular weight of 60.2 kDa.
This ORF was designated kstD2 (SEQ ID NO:S)(which is identical to the previously described kstD3 - see Example 3). The deduced amino acid sequence of kstD2 showed high similarity to known 3-ketosteroid 0~-dehydrogenases (KSTD) indicating that kstD2 s encodes a second KSTD enzyme in R. erythropolis RG1.
Ezampte 6 kstD2 deletion strains.
to R. erythropolis strain RG7 is a mutant strain, obtained from wild type R.
erythropolis strain SQ1, containing a single kstD2 gene deletion. R. erythropolis strain RG8 is constructed by the successive deletion of two genes encoding 3-ketosteroid 0'-dehydrogenase activity, i.e. kstDl and kstD2, from wild type R. erythropolis strain SQl.
Strain RG8 was obtained by deletion of the kstD2 gene from the genome of the kstDl ~s deletion mutant R. erythropolis strain RG1. The method used for kstD2 gene deletion was analogous to the method described for kstDl gene deletion in example 2, except for the fact that a different mutagenic vector was used (pKSD201 versus pSDH422).
The mutagenic vector pKSD201 was constructed as follows. A 1,093 by internal DNA
2o fragment of the kstD2 gene was deleted by MIuI digestion and subsequent self ligation of pKSD105, resulting in construction of pKSD200. A 2.4 kb EcoRI fragment of pKSD200 harboring the mutated kstD2 gene was ligated into EcoRI digested pKl8mobsacB, thereby constructing pKSD201. Plasmid pKSD201 was introduced into E. coli S17-1 and mobilized by conjugation to R. erythropolis strain SQ1 (to construct zs strain RG7), or strain RG1 (to construct strain RG8). Transconjugants (sucs kan'), resulting from targeted integration of pKSD201 into the genome appeared after 3 days of growth at 30 °C. Deletion of kstD2 was achieved by growth of one selected transconjugant (sucs kan') overnight under non-selective conditions (i.e. LBP
medium) and subsequent plating on selective LBPS agar medium. Colony PCR performed on 3o suc'/kans colonies with kstD2 primers (forward primer [5' gcgcatatggctaagaatcaggcaccc](SEQ ID N0:6); reverse primer [5' gcgggatccctacttctctgctgcgtgatg](SEQ ID N0:7)) resulted in 4 PCR products with fragment sizes of 0.6 kb, comprising the remaining part of the kstD2 gene.
Southern analysis using dig-labeled kstD2 gene as a probe on Asp718 digested chromosomal DNA of wild type and these 4 obtained mutants confirmed deletion of kstD2:
wild type Asp718 DNA fragment of 2.4 kb was reduced to 1.3 kb in the mutant strains.
s Ezample 7 Microbial 9a-hydroxylation of 4-androstene-3,17-dione with R. erythropolis strain RGB.
Rhodococcus erythropolis RG8 is a kstDl and kstD2 double deletion mutant which is capable of conversion of 4-androstene-3,17-dione (AD) into 9a-hydroxy-4-androstene-to 3,17-dione (9aOH-AD) with a concentration of 10 g/1.
This conversion was performed using the following method:
A 250 ml Erlenmeyer flask containing 75 ml sterile medium (1.5% yeast extract, 1.5%
glucose; pH 7.0) was grown with Rhodococcus erythropolis RG8 on a rotary shaker ( 180 rpm) at 28 °C for 24 hours (preculture). A 10 liter fermentor with 6 liter in situ is sterilized fermentation broth (1.5% yeast extract, 1.5% glucose, 0.01%
antifoaming agent polypropylene glycol; pH 7.5) was inoculated with preculture (1%) and incubated at 28°C for 16 hours under sparging with sterile air and the culture was agitated to induce submerged growth. Then a suspension of 60 gram 4-androstene-3,17-dione in 300 ml polysorbate (0.1%) was introduced. Aerobic incubation with agitation at 28°C
2o was then resumed for 24 hours. Samples were taken during the process. These samples were extracted with methanol (70%) and filtrated over a dead-end 0.45pm filter before the steroid composition was determined with HPLC. This process was performed twice.
As shown in figure 5 within 15 hours 10 g/1 of 4-androstene-3,17-dione is almost completely converted into 9a-hydroxy-4-androstene-3,17-dione (approximately 92-96%
2s of the total 4-androstene-3,17-dione).

BUDAPEST TREATY ON THE INTERNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Akzo Nobel N.V.
Velperweg 76 NL-2824 BM Arnhem VIABILITY STATEMENT
issued pursuant to Rule 10.2 by the INTERNATIONAL DEPOSITARY AUTHORITY
identified at the bottom of this page I. DEPOSITOR II. IDENTIFICATION OF THE MICROORGANISM

Name: AkZ O Nobe 1 N . V . Accession number given by the Velperweg 76 INTERNATIONAL DEPOSITARY AUTHORITY:

Aadrcss: DSM 13156 NL-2824 BM Arnhem Date of the deposit or the transfer':

!ll. VIABILITY STATEMENT

The viability of the microorganism identified under !I above was tested on 19 9 9 -11- 2 S ' .

On that date, the said microorganism was (X)' viable ( )' no longer viable IV. CONDITIONS UNDER WHICH THE
VIABILITY TEST HAS BEEN PERFORMED' V. INTERNATIONAL DEPOSITARY AUTHORITY

Name: DSMZ-DEUTSCHE SAMMLUNG VON Signatures) of persons) having the power to represent the MIKROORGANISMEN UND ZELLKULTUREN International Depositary Authority GmbH or of authorized official(s):

Address: Mascheroder Weg 1b D-38124 Braunschweig Date: 1999-11-29 Indicate the date of original deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit or date of the transfer).
' In the cases referred to in Rule I0.2(a) (ii) and (iii), refer to the most recent viability test.
' Mark with a cross the applicable box.
' Fill in if the information has been requested and if the results of the test were negative.
Form DSMZ-BP/9 (sole page) 0196 BUDAPEST TREATY ON THE INTERNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Akzo Nobel N.V.
Velperweg 76 NL-2824 BM Arnhem RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT
issued pursuant to Rule 7.1 by the identified at the bottom of this page 1. IDENTIFICATION OF THE MICROORGANISM

Identificuion rcferenx given by Aecasion number given by the the DEPOSITOR:

RGl ~RNAT10NAL DEPOSITARY AUfNORIIY:

11. SCIENTIFIC DESCRIPTION AND/OR
PROPOSED TAXONOMIC DESIGNATION

The miaoorganitm identified under 1. above was accompanied by:

(X ) a scientific description (X ) a proposed taxonomic designuion (Mark with a cross where applicable).

11I. RECEIPT AND ACCEPTANCE

This Intanuional Depository Authority accepts the microorganism identified under 1. above, which was rcceivcd by it on 19 9 9 -11- 2 5 (Date of the original deposit)'.

IV. RECEIPT OF REQUEST FOR CONVERSION

The microorganism identified under I above was received by this International Depository Authority on (date of original deposit) and a request to convert the original deposh to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).

V. INTERNATIONAL DEPOSITARY AUTHORITY

Name: DSMZ-DEUTSCHE SAMMLUNG VON Signuurc(s) of persons) having the power to represent the M1KROORGANISMEN UND ZELLKULTUREN International Depository Authority GmbH or of authorized official(s):

Address: Mascheroder Weg Ib D-38124 Hraunschweig Date: 1999-11-29 Where Rule 6.4 (d) applies. such date is the date on which the status of international dcposttary authority was acquired.
Form DSMZ-HP/4 (sole page) 0196 BUDAPEST TREATY ON THE INTERNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Akzo Nobel N.V.
Velperweg 76 NL-2824 BM Arnhem VIABILITY STATEMENT
issued pursuant to Rule 10.2 by the INTERNATIONAL DEPOSITARY AUTHORITY
identified at the bottom of this page I. DEPOSITOR 11. IDENTIFICATION OF THE MICROORGANISM

Name: Ak20 Nobel N . V . Actxssion number given by the Velperweg 76 INTERNATIONAL DEPOSITARY AUTHORITY:

Address: DSM 13157 NL-2824 BM Arnhem Date of the deposit or the transfer:

III. VIABILITY STATEMENT

The viability of the microorganism identified under 1l above was tested on 19 9 9 -11- 2 5 ' .

On that date, the said microorganism was (X)' viable ( )' no longer viable IV. CONDITIONS UNDER WHICH THE
VIABILITY TEST HAS BEEN PERFORMED' V. INTERNATIONAL DEPOSITARY AUTHORITY

Name: DSMZ-DEUTSCHE SAMMLUNG VON Signatures) of persons) having MIKROORGANISMEN UND ZELLKULTUREN the power to represent the GmbH International Depositary Authority or of authorized officiat(s):

Address: Mascheroder Weg Ib D-38124 Braunschweig Date: 1999-11-29 Indicate the date of original deposit or, where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit or date of the Vansfer).
In the cases referred to in Rule I0.2(a) (ii) and (iii), refer to the most recent viability test.
Mark with a cross the applicable box.
' Fill in if the information has been requested and if the results of the test were negative.
Form DSMZ-BP/9 (sole page) 0196 BUDAPEST TREATY ON THE INTERNATIONAL
RECOGNITION OF THE DEPOSIT OF MICROORGANISMS
FOR THE PURPOSES OF PATENT PROCEDURE
INTERNATIONAL FORM
Akzo Nobel N.V.
Velperweg 76 NL-2824 BM Arnhem RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT
issued pursuant to Rule 7.l by the INTERNATIONAL DEPOSITARY AUTHORITY
identified at the bottom of this page 1. IDENTIFICATION OF THE MICROORGANISM

Identification reference given Accession number given by the by the DEPOSITOR:

INTERNATIONAL DEPOSITARY AUTHORITY:

11. SCIENTIFIC DESCRIPTION AND/OR
PROPOSED TAXONOMIC DESIGNATION

The microorganism identified under I. above was accompanied by:

(X ) a scientific description (X ) a proposed taxonomic designation (Mark with a cross where applicable).

III. RECEIPT AND ACCEPTANCE

This International Depository Authority accepts the microorganism identified under I. above, which was received by it on 19 9 9 (Date of the original deposit)'.

IV. RECEIPT OF REQUEST FOR CONVERSION

The microorganism identified under 1 above was received by this International Depository Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by it on (date of receipt of request for conversion).

V. INTERNATIONAL DEPOSITARY AUTHORITY

Name: DSMZ-DEUTSCHE SAMMLUNG VON Signaturc(s) of persons) having the power to represent the MIKROORGANISMEN UND ZELLKULTUREN International Depository Authority GmbH or of authorized offtcial(s):

Address: Mascheroder Weg Ib D-38124 Braunschweig s Date: 1999-11-29 Where Rule 6.4 (d) applies, such date is the date on which the status of international depository authority was acquired.
Forth DSMZ-BP/4 (sole page) 0196 SEQUENCE LISTING
<110> AKZO NOBEL N.V.
<120> Microbial 9 alpha-hydroxylation of steroids <130>
<140>
<141>
<160> 7 <170> PatentIn Ver. 2.1 <210> 1 <211> 2398 <212> DNA
<213> Rhodococcus erythropolis <400> 1 ggacatgacg aacccacccc gagaaggggc gaggtcacgt cagtgtcgtg agagattcac 60 cagaagcagg tcgcacccct tgcggatgtc gtactccgca tccgggatgg aaattcgacc 120 gttgaggcac gattggatga ccccgaacca cagctgcatc agcagacgca acccggtgtt 180 gtcttcctcg gtcgggttct cgatcccggc cgcatcgagg atgatctgcc ggaagccgcg 240 atcgatcttg cccacgtccg gcaccgtcgc gacgttggcg gtactggacg actgcagcat 300 cgcagtcgaa agggccggcc gacgcagtaa cccgcgagtc gcgcgcacca ggacctcgta 360 cacggcgtcc tgcggattgg ccgactgcac ctgatgcttg gcgaaactgt cgccgatctg 420 atcgatctgc tcgaccatca cagcgacgaa gaggtgcgtc ttcgaaggga aatagcggta 480 gagagtgccg atggccacgc ctgcccgctt ggcaacttcg tgcatctgaa cccgtgagag 540 ttctttctcg gtccccaatt cggcggccgc ttccagcatc cgcacatggc gcgcccgctg 600 ctcgtccgaa ctgggctcag cagcgtccct gacctcggca attctcggca acgtcgcccc 660 catcatcgat tatgtgtccc ggccgcgaac gaccgcgcta attctctcac ctggaccacc 720 catctcggca tattgcccgc tcagtgggac ctggcatggc cttccagtgc cgtgcggtat 780 tccgtggaca ccccaccctc ttggagtaag gacgcaatga tgcaggactg gaccagcgag 840 tgcgacgtgt tggtagtcgg ctccggcggc ggagcgctga ccggcgcata taccgccgct 900 gctcagggat tgacgacgat cgtcctcgag aaaaccgatc gtttcggcgg gacctccgcc 960 tactcgggcg cctcgatctg gctcccaggt acccaggtgc aggaacgcgc cggacttccc 1020 gactcgaccg agaatgcccg cacctatctg cgcgcgttgc tcggtgacgc cgagtccgag 1080 cgccaggacg cctacgtcga gaccgctccc gctgtcgtcg ctctactcga gcagaacccg 1140 aacatcgaat tcgagttccg tgcgttcccc gactactaca aagccgaagg ccggatggac 1200 acgggacgct ccatcaaccc tctcgatctc gatcccgccg acatcggtga cctcgccggc 1260 aaggtgcgtc cggaactgga ccaagaccgc accggtcagg atcatgctcc cggcccgatg 1320 atcggtgggc gcgcactgat cggccgtctg ctggccgcag ttcagagcac cggtaaggca 1380 gaacttcgca ccgaatccgt cctcacctcc ctgatcgtgg aagacggccg tgttgtcggc 1440 gccgaggtcg aatccggcgg cgaaacccag cgaatcaagg cgaaccgcgg tgtcctgatg 1500 gcagcaggcg gcatcgaagg caacgccgag atgcgtgagc aggcaggcac ccccggcaag 1560 gcgatctgga gtatgggtcc cttcggcgcc aacaccggcg acgcgatctc tgccggtatt 1620 gctgtcggcg gcgcaacagc cttgctcgat caggcgtggt tctgccccgg cgtcgagcag 1680 cccgacggca gcgccgcctt catggtcggc gttcgcggtg ggctcgtcgt cgacagcgcc 1740 ggtgagcgct acctcaacga gtcgcttccg tacgaccagt tcggacgagc catggatgct 1800 cacgacgaca acggttctgc cgtgccgtcg ttcatgatct tcgactcgcg cgagggtggc 1860 ggactgcccg ccatctgcat cccgaacacg gcgcccgcca agcacctcga agccggaacg 1920 tgggtcggtg ccgacactct cgaagaactc gctgccaaga ccggactacc ggccgacgca 1980 ttgcgcagca ctgtcgaaaa gttcaacgat gccgcaaaac tgggcgtcga cgaagagttc 2040 catcgcggcg aagacccgta cgacgcgttc ttctgcccac ccaacggcgg tgcgaatgcg 2100 gcactgacgg ccatcgagaa cggaccgttc tacgcggccc gcatcgtcct cagtgacctc 2160 ggcaccaagg gcggattggt caccgacgtc aacggccgag tcctgcgtgc tgacggcagc 2220 gccatcgacg gcctgtacgc cgccggcaac acgagcgcgt cactgagcgg ccgcttctac 2280 cccggccccg gagttccact cggcacggct atggtcttct cgtaccgagc agctcaggac 2340 atggcgaagt aacgcagttc aatcacactc cgtggaaaca gatcgtgggg cagccgat 2398 <210> 2 <211> 39 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: degenerate probe <400> 2 ttcggsggsa cstcsgcsta ctcsggsgcs tcsatctgg 39 <210> 3 <211> 30 <212> DNA
<213> Rhodococcus erythropolis <400> 3 gcgcatatgc aggactggac cagcgagtgc 30 <210> 4 <211> 30 <212> DNA
<213> Rhodococcus erythropolis <400> 4 gcgggatccg cgttacttcg ccatgtcctg 30 <210> 5 <211> 1698 <212> DNA
<213> Rhodococcus erythropolis <400> 5 atggctaaga atcaggcacc ccccgcgaca caagccaagg acatcgttgt cgatctattg 60 gtgatcgggt ccggtaccgg catggctgcc gctctcaccg cgaacgaact cggcttgtcc 120 acgctgatcg tggagaagac gcagtacgtc ggcggttcga cggcgcggtc cggtggggcg 180 ttctggatgc ctgccaaccc gatcttggcg aaagccggtg cgggcgacac cgttgagcga 240 gcgaagacat acgtgcgttc ggtggtcggt gatactgccc ctgcccaacg aggagaagca 300 ttcgtcgaca acggtgcggc cactgtcgac atgctctacc gcacgacgcc catgaagttc 360 ttctgggcca aggaatactc cgattaccac cccgaactgc cgggcggtag cgccgccgga 420 cgtacctgcg agtgcctgcc gttcgacgcg tcggtactgg gagcggaacg cggtcgcctg 480 cgcccaggtt tgatggaagc cggactgccg atgccggtga cgggtgcgga ttacaagtgg 540 atgaacctga tggtgaagaa gccgagcaag gcttttcccc gcatcatccg ccgcctggcg 600 caaggcgttt acggcaagta cgtcctcaag cgtgaataca tcgcgggcgg tcaggcgctc 660 gccgccggac tgttcgccgg tgtggtccag gccggtatcc cggtgtggac ggaaacgtcg 720 ttggttcggc tcatcaccga agatggccgc gtaacgggtg cagttgtggt gcaagacgga 780 cgtgaagtga cggtgaccgc tcggcgcggt gtcgtcctgg cagccggcgg gttcgaccac 840 aacatggagt ggcgccacaa gtaccagtcg gagagcctcg gtgagcatga gagcctgggc 900 gcagagggca acaccggcga agcgatcgag gcagcacaag agctcggtgc aggtatcgga 960 tcgatggatc agtcctggtg gttccccgcg gtggcaagca tcaagggccg cccgccgatg 1020 gtgatgctcg cagagcgtgc gctgcccggc tctttcatcg tcgaccagac cggtcgtcga 1080 ttcgtgaacg aggcgacgga ctacatgtcg ttcggccagc gcgtgctcga acgggaaaag 1140 gctggcgatc cggccgagtc gatgtggttt gttttcgacc aggagtaccg caacagctac 1200 gtgttcgcag gcggtatctt cccccgtcag ccccttccgc aggcattctt cgagtccggc 1260 atcgcgcacc aggcgagcag tccggccgaa ctcgcccgca aggtcggtct ccccgaggat 1320 gcgtttgccg agtccttcca gaagttcaac gaggccgctg ctgcaggtag cgatgcggag 1380 ttcggtcgcg gcggcagcgc atacgatcgg tactacggcg acccgacagt gtctccgaac 1440 ccgaatctgc gccagctcga caagagcgcc ctctatgcgg tgaagatgac gctcagcgac 1500 ctgggcacct gcggcggtgt gcaggcggac gagaatgcac gcgtgcttcg tgaggacggc 1560 agcgtcatcg acggcctgta cgcgatcggc aataccgcgg ccaacgcatt cggtcacacc 1620 tacccaggcg ccggcgcgac gatcggccag gggctggttt acggatacat cgcggcccat 1680 cacgcagcag agaagtag 1698 <210> 6 <211> 27 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: forward primer <400> 6 gcgcatatgg ctaagaatca ggcaccc 27 <210> 7 <211> 30 <212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: reverse primer <400> 7 gcgggatccc tacttctctg ctgcgtgatg 30

Claims (13)

Claims

1. Method to construct a genetically modified strain of a steroid-degrading micro-organism lacking the ability to degrade the steroid nucleus, the method comprising inactivation of multiple genes involved in steroid nucleus degradation, wherein the first gene is deleted by unmarked gene deletion.

2. Method according to claim 1, wherein the method comprises deletion of multiple steroid dehydrogenase genes.

3. Method according to claim 2, wherein a first deleted gene is kstD1 or kstD2.

4. Method according to claim 3, wherein any subsequent gene is inactivated by UV irradiation.

5. Method according to claims 3 or 4, wherein any subsequent gene is deleted by unmarked gene deletion.

6. Method according to claim 1, wherein the second gene is deleted by unmarked gene deletion.

7. Method according to claims 1-6 wherein the micro-organism is Rhodococcus, preferably R erythopolis.

8. Micro-organism prepared according to claims 1-7.

9. Micro-organism according to claim 8 wherein at least both kstD1 and kstD2 are inactivated.

10. Genetically modified strain Rhodococcus erythropolis RG1-UV29 (DSM 13157).

11. Use of micro-organisms according to claims 8-10 in the preparation of 9.alpha.-hydroxy-4-androstene-3,17-dione by growing said micro-organisms on a culture medium comprising 4-androstene-3,17-dione.

12. Nucleotide sequence encoding KSTD1 protein encoded by nucleotides 820-2329 of SEQ ID NO:1.

13. Nucleotide sequence encoding KSTD2 protein encoded by nucleotides 1-1678 of SEQ ID NO:5.