AU775476B2 - Microbial 9alpha-hydroxylation of steroids - Google Patents

Description

WO 01/31050 wo 0131050PCT/EPOO/10223 Microbial 9at-hydroxylation of steroids The invention relates to a method to prepare genetically modified micro-organisms having inhibited capacity for nucleus degradation of steroids, the use of such microrganism in steroid accumulation as well as such modified micro-organisms.

The ability to degrade phytosterols is widespread in nocardioform actinomycetes and requires a set of enzymes degrading the side-chain and the steroid nucleus structure.

The enzyme 3-ketosteroid A' -dehydrogenase (KSTD) [4-ene-3-oxosteroid:(acceptor)-lIto ene-oxidoreductase, EC 1.3.99.4] is involved in cleavage of ring B of the steroid nucleus by introducing a double bond at the CI-C2 position. More particularly, the enzyme is involved in the conversion of 4-androstene-3,1I7-dione in 1 ,4-androstadiene- 3,1 7-dione and of 9c-hydroxy-4-androstene-3,l 7-dione in 9ct-hydroxy-l Aandrostadiene-3,17-dione (see Figure The enzyme has been identified in several bacteria: Arthrobacter simplex (Penasse and Peyre, 1968 Rhodococcus. Crit Rev Biotech 14:29-73)), Pseudornonas (Levy and Talalay. 1959 J Bil Chem 234:2009- 20013-; 1959 J Biol Chemn 234:2014-2021 Nlocardia restrictus (Sih and Bennet, 1962 Biochem Biophys Acta 56:587-592). Alocaidia corallina (Itagaki ei at., 1990 Biochim Biophys Acta 1038:60-67), Nocardia opaca (DrobnJ6 et at., 1993 Biochim Biophys Res Comm 190:509-5 15), Mycobacteriumfortuitum (Wovcha et al., 1979 Biochim Biophys Acta 574:471-479) and Rhodocaccus erythropolis IMET7030 (Kaufmnann et al., 1992 J 0 Steroid Biochem Molec Biol 43:297-30 KSTD of N. opaca has been characterized as a flavoprotein (Lestrovaja el at., 1978 Z AlIg Mikrobiol 18:189-196). Only the KSTD encoding genes 3-ketosteroid A' Dehydrogenase) of A. simplex, Comamonas testosteroni and Rhodococcus rhodochrous have been fully characterized (Plesiat el al, 1991 J Bacterial 173:7219-7227; Moln~r ea al., 1995 Mol Microbial 15:895-905; Morii el al., 19981 Biochem 124:1026-1032).

The exclusive inhibition of the steroid 1 ,2-dehydrogenase causes accumulation of 9cihydroxy-4-androstene-3, 17-diane, an excellent starting material for corticoid synthesis (Kieslich 1985 J Basic Microbial 25:461-474). 9a-Hydroxyandrogens are of industrial importance as anti-androgens, anti-estrogens and antifertility. The 9a-hydroxy group is easily dehydrated to the 9(1 I1-dehvdra system and offers a starting structure for the production of 9a-halogen corticoids.

-2 o 2 7. 02. 2002 2 Rhodococcus species are wveHknown for their large catabolic potential (Warhurst and Fewson, 1994 RhodococchsPCrit Rev Biotech 14:29-73; Bell et al., 1998 J Appl Microbiol 85:195-210). Several Rhodococcus species are able to degrade natural phytosterols, which are inexpensive starting materials for the production of bioactive steroids (Kieslich 1986 Drug Res 36: 888-892). Rhodococcus and Mycobacterium strains treated with mutagens and/or incubated with enzyme inhibitors convert sterols into 4-androstene-3,17-dione and 1,4-androstadiene-3,17-dione (Martin, 1977 Adv Appl Microbiol 22:29-58).

Although cloning of kstD and expression of an inactive KSTD protein ofR. erythropolis IMET7030 in Escherichia coli have been described (Wagner et al., 1992 J Basic Microbiol 32:65-71; 1992 J Basic Microbiol 32:269-277) and a nucleotide sequence of N. opaca (Drobnia et al., 1993 Biochem Biophys Res Comm 190:509-515) (synonym R.

erythropolis IMET7030) is available (DDBJ/EMBIJGenBank U59422), no molecular characterization of this gene has been reported. KSTD activity is essential for steroid is nucleus degradation and kstD gene inactivation is needed to accumulate steroid intermediates. According to one aspect of the present invention the nucleotide sequence of the kstD gene of R. erythropolis has been provided. KSTD1 protein is encoded by nucleotides 820-2329 of SEQ ID NO:1.

Inactivation of genes is a powerful tool for analysis of gene function and for introduction of metabolic blocks. Gene disruption with a non-replicative vector carrying a selective marker is the commonly used method for gene inactivation. Construction of strains with desirable properties via metabolic pathway engineering approaches, however, may require the stepwise inactivation or replacement of several genes. This is only possible when a suitable strategy for introduction of unmarked gene deletions or gene replacements, allowing infinite rounds of metabolic engineering without being dependent on multiple markers, is available. According to another aspect of the present invention there is provided a stepwise inactivation of genes, preferably dehydrogenase genes, involved in steroid degradation. In particular the invention applies for an inactivation of genes involved in the accumulation of 9a-hydroxy-4-androstene-3,17dione by growing of micro-organisms on 4-androstene-3,17-dione. Preferably, at least the gene ktDI is inactivated.

It was unexpectedly found that disruption of the ktDI gene encoding 3-ketosteroid A t dehydrogenase in R.erythropolis SQ1 did not result in inactivation of steroid nucleus degradation. The remaining activity appeared to be based on the presence of a second 3s enzyme. It has now been found that inactivation of more than one gene is required to obtain a strain completely blocked in steroid nucleus degradation. Preferably the second 'f~r.3 jJS^^S'JJ't~ii^-J~l^.SW155(g WO 01/31050 PCT/EP00/10223 -3enzyme is a dehydrogenase, more preferably a KSTD isoenzyme. In order to make it possible to disrupt or delete several genes, preferably a method of site-directed mutagenesis can be used. A method for introduction of unmarked gene deletions is to be preferred for the stepwisc inactivation of KSTD genes. The resulting genetically modified strains would be free of heterologous DNA.

According to another preferred embodiment of this invention, at least the gene kstD2 is inactivated. Most preferably, at least both the genes kstD1 and kstD2 are inactivated.

Another aspect of the present invention is the nucleotide sequence of the kstD2 gene of R. erythropolis. KSTD2 protein is encoded by nucleotides 1-1678 of SEQ ID to No methods for introduction of unmarked gene deletions in the genus Rhodococcus have been reported. Gene deletion or gene replacement methods, however, have been described for some other members of the actinomycetales, namely Streptomyces (Hillemann et al., 1991 Nucleic Acid Res 19:727-731; Hosted and Baltz, 1997 J.

Bacteriol 179:180-186), Corynebacterium (Schifer et al., 1994 Gene 145:69-73) and is Mycobacterium (Marklund et al., 1995 J Bacteriol 177:6100-6105; Norman et al., 1995 Mol Microbiol 16:755-760; Sander et al., 1995 Mol Microbiol 16:991-1000; Pelicic et al., 1996 Mol Microbiol 20:919-125; Knipfer et al., 1997 Plasmid 37:129-140).

Counter-selectable markers may be used to screen for the rare second recombination event resulting in gene deletion or gene replacement. In this respect, both sacB and rpsL L.,c uiu r"e on r 2 c:d c~i 1997 J B3c:. ,ri: l 1: 6 atl., 1994 J Bacicrioi 1'2:1,,o3- Sander et al., 1995 Mol Microbiol 16:991-1000; Pelicic et al., 1996 Mol Microbiol 20:919-925; Jager et al., 1992 J Bacteriol 174:5462-5465), but other suitable markers can be used as well. The use of rpsL in Rhodococcus has not been reported, but sagB (encoding the Bacillus subtilis levansucrase) provides a potent positive selection marker in this genus (Jager et al., 1995 FEMS Microbiol Lett 126:1-6; Denis-Larose et al., 1998 Appl Environ Microbiol 64:4363-4367).

The B. subtilis levansucrase, encoded by the sacB gene, catalyzes hydrolysis of sugars and synthesis of levans (high-molecular weight fructose polymers). Expression of sacB in Rhodococcus is lethal in the presence of sucrose. The biochemical basis for toxicity of levansucrase action on sucrose is still unknown. Conditional lethality presence or absence of sucrose) of the sacB gene therefore can be used as a counter-selectable marker. Counter-selection in this context means that expression of the marker is lethal, instead of giving rise to resistance as is the case for selectable markers resistance markers).

WO 01/31050 PCT/EP00/10223 -4- Counter-selection is needed to select for those mutants that have undergone a second recombination event, thereby losing the sacB marker and introducing the desired mutation. The advantage of this system is that during selection solely potentially good mutants will survive the selection. Compared to a system in which only one selection marker is used, counter-selection avoids a time consuming screening process for loss of the resistance marker that would be necessary in an one-selection-marker system.

An advantage of unmarked mutation is that it allows the repetitive introduction of mutations in the same strain. Foreign DNA (vector DNA) is removed in the process of introducing the mutation. Newly introduced vector DNA, for the introduction of a 0o second mutation, therefore cannot integrate at the site of the previous mutation (by homologous recombination between vector DNA's). Integration will definitely happen if vector DNA is still present in the chromosome and will give rise to a large number of false-positive integrants. The system enables the use of a sole antibiotic gene for the introduction of an infinite number of mutations. Unmarked mutation also allows easy use in the industry because of the absence of heterogeneous DNA allowing easy disposal of fermentation broth.

Gene inactivation by gene deletion enables the construction of stable, non-reverting mutants. Especially small genes (<500 bp) are inactivated more easily by gene deletion compared to gene disruption by a single recombination integration. Gene deletion r 'c sis can n' ir.,-ntiviate a clus:u. )f 1 from the Sgenome. ihe gene cicetion mutagenesis strategy can be applied also tior nereplacement changing wild type into mutant gene).

The preferred strain for mutagenesis of the catabolic steroid dehydrogenases genes is Rhodococcus erfthropolis. However, unmarked gene deletion of kstD1 and/or kstD2 in other genetically accessible by :o"i.cation, is conceivable if the molecular organization is the same (or similar) as in R. erythropolis SQ1. Preferably these species belong to the genus Rhodococcus but also related species such as Nocardia, Mycobacterium and Arthrobacter can be used.

Gene inactivation in Rhodococcus is hampered by the occurrence of illegitimate recombination events resulting in random genomic integration of the mutagenic vector (Desomer et al., 1991 Mol Microbiol 5:2115-2124; Barnes et al., 1997 J Bacteriol 179:6145-6153), a phenomenon we encountered when attempting to disrupt the kstDI gene in R. erythropolis SQ1. Illegitimate recombination is also a well-known phenomenon in some slow-growing species of Mycobacterium (McFadden, 1996 Mol J 1V;i.uuiU 121 .20-2r). C nlapomir transfer from E.coli S17-1 to Rhodococcus has been shown to minimize random integration (Powell and Archer, 1998 VO 01/31050 PCT/EP00/10223 Antinie van Leeuwenhoek 74:175-188). Conjugative mobilization of plasmids from E.

coli strain S17-1 to many different strains of coryneform bacteria and to Rhodococcus fascians DSM20131 has been proven possible (Schafer et al., 1990 J. Bacteriol 172:1663-1666; Jager et al., 1995 FEMS Microbiol Lett 126:1-6). According to the present invention conjugative transfer of a mutagenic vector carrying the sacB gene as counter-selectable marker therefore was adopted for introduction of unmarked gene deletions in steroid catabolism in R. erythropolis SQ1.

As a further embodiment of the present invention, the introduction of a second gene inactivation event can be performed using the same methods as is illustrated in the to Examples for kstD2. For even further gene inactivation, the same methods may be used again, or, alternatively, UV irradiation or chemical means such as nitroguanidine or diepoxyethaan may be used. Methods to introduce gene mutations in that way are well known in the art.

Also, methods to construct vehicles to be used in the mutagenesis protocol are well known (Sambrook et al., Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, latest edition). Furthermore, techniques for site directed mutagenesis, ligation of additional sequences, PCR, sequencing of DNA and construction of suitable expression systems are all, by now, well known in the art.

Portions or all of the DNA encoding the desired protein can be constructed synthetically I: !id thase techniau ;v :o include restriction sit-s 'br of ligation.

Modifications and variations of the method for introducing disrupted gene mutations or unmarked gene deletion as well as transformation and conjugation will be obvious to those skilled in the art from the foregoing detailed description of the invention. Such modifications and v:L'atrios are intended to come within the scope of present application.

According to another aspect of the present invention micro-organisms possessing multiple gene inactivation's can be used to accumulate steroid intermediates. Preferably the accumulated product is 9a-hydroxy-4-androstene-3,17-dione. The starting material may depend on the enzyme genes which are inactivated. Suitable starting materials are e.g. phytosterols or 4-androstene-3,17-dione. The preferred starting material is 4androstene-3,17-dione.

An advantage of the present method is that high conversion yields from the starting steroid into the accumulated product can be obtained. The yields may exceed preferably more than 90% and often reach a value of almost 100%.

Still another aspect of the invention resides in genetically modified microorganisms with multiple inactivated genes which are involved in steroid degradation.

Especially these genes are dehydrogenases. Preferably at least the gene kstDl and kstDl is inactivated. In particular, preferred is the inactivation of both genes kstD1 and kstD1.

Preferred are micro-organisms belonging to the genus Rhodococcus. Most preferred is the strain Rhodococcus erythropolis RG1-UV29.

The micro-organism strains Rhodococcus erythropolis RG1-UV29 and Rhodococcus erythropolis RG1 have been deposited at the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ), Mascheroder Weg Ib, D-38124 Braunschweig, Germany under the accession numbers DSM 13157 and DSM 13156, respectively. These deposits have been made under the terms of the Budapest Treaty.

According to one embodiment of this invention there is provided a method to construct a genetically modified strain of a steroid-degrading micro-organism lacking the ability to degrade the steroid nucleus, the method comprising inactivation of more than one steroid dehydrogenase gene involved in steroid nucleus degradation, wherein the first gene is deleted by unmarked gene deletion, the first deleted gene being the steroid o. dehydrogenase gene kstD 1 or kstD2.

a According to another embodiment of this invention there is provided the genetically modified strain Rhodococcus erythropolis RGI-UV29 (DSM 13157).

20 According to a further embodiment of this invention there is provided the use of micro-organisms prepared according to the method of the invention in the preparation of oq 9a-hydroxy-4-androstene-3,17-dione by growing said micro-organisms on a culture medium comprising 4-androstene-3,17-dione.

'.According to yet a further embodiment of this invention there is provided 25 nucleotide sequence encoding KSTD2 protein encoded by nucleotides 1-1678 of SEQ ID A person skilled in the art will understand how to use the methods and materials described and referred to in this document in order to construct micro-organisms lacking the ability to degrade the steroid nucleus. Multiple genes encoding for several other C C 0 1P q1., PI7f 1np.q rqn n -imilnrlv he. inn.tivated.

The following examples are illustrative for the invention and should in no way be interpreted as limiting the scope of the invention.

[I:\DAYLB\LIBXX]04928.doc:mpr 6a LEGENDS TO THE FIGURES Figure 1 Schematic representation of steroid nucleus degradation in R. erythropolis SQ1.

The positions of the 3-ketosteroid '-dehydrogenase (KSTD) isoenzymes are indicated with KSTD1 and KSTD3.

Figure 2 Schematic representation of the mutagenic vector pSDH422 with the counterselectable marker sacB used for construction of Rhodococcus erythropolis strain RG1 with an 1062 bp unmarked kstD gene deletion. ORF2 and ORF3 are the flanking genes to ofkstDI in R. erythropolis SQl.

Figure 3 Schematic overview of the molecular organization of kstD1 in wild type R. erythropolis SQ1 and after integration of pSDH422 by a single cross-over event at the targeted locus downstream (strain SDH422-3) and upstream (strain SDH422-4) of kstD1, respectively. Inserted window: Southern analysis, using kstDl as a probe, of S.R. erythropolis 0 0o 0 *00 *0* *o oo* *0 *o* [I:\DAYLIB\LIBXX]04928.doc:mpr WO 01/31050 PCT/EPOO/10223 chromosomal DNA digested with BamH[l of wild type (lane strain SDH422-3 (lane SDH422-4 (lane 3) and two individual kstDI deletion mutants (lanes 4 and Figure 4 Bioconversions in 6 liter culture of Rhodococcus eiythropolis SQl UJV-29 of 4androstene-3,1I7-diane into 9ct-hydroxy-4-androstene-3,1I7-dione. 10 g/l AD and g/1 AD Figure Bioconversion in 6 liter culture of Rhodococcus erythropolis RG8 of 4-androstcne-3,1 7dione into 9c-hydroxy-4-androstene-3,l 7-diane. 10 g/l AD Examples Example I kstD 1 characterization.

A degenerated kstD oligonucleotide probe ttcgg(c/g)gg(c/g)ac(c/g)tc(c/g)gc(c/g)tac tc-(c/g)gg(c/g)gc(c/g)tc(c/g)atctgg] (SEQ ID NO:2) was developed from an alignment of thc N-terminal parts of knowvn KSTD protein sequences of simplex, C testosterofli and N. opaca. Total DNA of R. erythropolis SQl digested with Bg1II wa.i sized by sucrose gradient ccntrifuigation. Southern analysis at 68 OC (stringent washes with 2xSSC for 2xI5 mini and O.1xSSC for 2x10 min) of fractions obtained yielded a 6 kb DNA fragment hybridizing with digoxigenine-9abel led kvID oligonucleotide probe. This fraimicat woas i!,-atcd into the BgffI site of the .Rhodococcus-E. coli shuttle-vector pDA7 I (Dabs et al, 1995 Development of improved Rhodococcus plasmid vectors and their use in cloning genes of potential commercial and medical importance, p.129-1 35 In: Proceedings of the Ninth Symposium on the Actinomycetes, Moscow, Russia) and subcloned into Baml digested pBluescript U1 KS (Stratagene) (pSDH200).

From restriction mapping analysis we concluded that only one EcoRV site was present on the 6 kb fragment, dividing it into equally sized fragments of approximately 3 kb.

Southern analysis showed that an approximately 2.9 kb EcoRV fragment of pSDH200 contained sequences homologous to the kstD oligonucleotide. Nucleotide sequencing revealed an open reading fr-ame of 1,533 nt (kstDl, see SEQ ID NQ:1) encoding KSTD1. as was demonstrated by heteroloeous exnress-.ion in Escherichia. Further ~~1r 0 n l 0ncn *vT v rf Wv PCTrEP0NUIi23 -8nucleotide sequencing revealed two ORFs of 1,533 nt (ORFI) and 627 nt (ORF2) encoding putative proteins of 510 aa and 208 aa, respectively.

Example 2 KstDl deletion strain.

A mutagenic vector was constructed that contains a R. erythropolis SQ1 chromosomal DNA fragment with a kstD1 deletion. A 1062 bp BsmI fragment of pSDH200, encoding a large internal part of KSTDI, was deleted to construct pSDH200)BsmI. For construction of the mutagenic vector a 2724 bp SmaIIEcoRI fragment of pSDH200)BsmI harbouring the remaining 468 bp ofkstDl and its flanking regions was to cloned into the Smal/EcoRI site of pK18mobsacB (pSDH422, see Figure The vector pSDH422, encoding kanamycin resistance to select for integration of the mutagenic vector into the chromosome and harbouring the sacB gene of B. subtilis for counterselection, was introduced into E.coli S17-1 and mobilized to R. erythropolis SQ1 by conjugation as follows. Cells of the R. erythropolis SQ1 recipient strain were spread on LBP agar supplemented with 30 gg-rml' nalidixic acid and grown for 5 days. The mutagenic vector pSDH422 was first introduced in E.coli S17-1 by transformation.

Transformants (approx. 1000 per plate) grown overnight on selective media (kanamycin gg-ml') were incubated at room temperature for another 24 h. Colonies of both Rhodococcus and E.coli strains were resuspended in a final volume of 1.5 ml of LBP bactJ.pcpton (Difco), 0.5% yeast extract (BBL) and 1% NaCI). Aliquots of 750 pl of each strain were mixed and gently pelleted by centrifugation. The pellet was resuspended in 1 ml LBP and cells were spread on non-selective LBP agar in 250 pl aliquots. After growth overnight at 30 0 C the confluently grown material was 2 L9P medium a:"i 100 ul aliquots spread on LBP agar pp ,ctiteu .%;ith .iinamycin (200 p:n mf) and nalidixic acid (30 pg-mrl"). R.

erythropoiis SQ1 transconjugants appeared after 3 days. All resulting kanamycin resistant (kan') Rhodococcus transconjugants were sucrose sensitive no growth occurred after replica plating on LBPS bacto-pepton, 0.5% yeast extract, 1% NaCI, sucrose) agar supplemented with 200 ig-ml-' kanamycin.

Southern analysis (Fig. 3) of wild type (lane 1: single band of approx. 4500 bp) and of two transconjugants, SDH422-3 (lane 2: two bands of approx. 2900 and 10100 bp) and SDH422-4 (lane 3: two bands of approx. 4000 and 9000 bp) revealed that both had retained one copy of pSDH422 integrated at the targeted locus by a single recombination event. Gene deletion ofkstDl in the R.erythropolis SDH422-3 strain was WO 01/31050 PCT/EPOO/10223 achieved during growth overnight under non-selective conditions, made visible by subsequent plating on selective medium, ie. LBPS agar Gene deletion of thc kstDl gene was achieved during growth overnight under nonselective conditions and subsequent plating on selective medium, i.e. LBPS agar.

Colony PCR with kstDl primers (fbrward primer gcgcatatgcaggactggaccagcgagtgC] (SEQ ID NO:3); reverse primer gcgggatccgcgttacttcgccatgtcctg](SEQ ID NO:4)) on 9 sucdlkan' colonies resulted in 6 PCR products with fragment sizes of 468 bp comprising the deleted kstDI gene. Gene deletion was confirmed by Southern analysis at 60 0 C (stringent washes with 2xSSC for 2x5 min and 0.IxSSC for 2x5 min) using io randomly digoxigenine-labelled kstD1I gene as a probe. The 4.5 kb kstDlI DNA fragment of wild type obtained after BamHT digestion of chromosomal DNA was reduced to 3.4 kb in the gene deletion mutants, indicating deletion of the expected 1062 bp kstD I DNA fragment. The resulting strain was denoted R. eryahropolis RGI.

Example 3 Inactivation of steroid A'-dehydrogenation by UV mutagenesis.

Late exponential phase R. erythropolis RGl cells (2-108 CFUs-ml-) grown in 10 M glucose mineral medium (K 2

HPO

4 4.65 NaH 2

PO

4

-H

2 0 1.5 gT', NH1 4 CI 3 g-r', MgSO 4 -7H 2 O I Vishniac trace elements, pH 7.2) were sonicated for a short period ot btinsiridz ccfls. Diluted (10"I samnples were spread on glucose mineral agar medium and irradiated tbr 15-20 sec with an UV lamp (Philips lT.{W 15W) at a distance of 27 cm, on average resulting in 95% killing of cells. After 4 days of incubation, colonies were replica plated on 4-androstene-3,17-dione (0.5 gri', solubilized in DMSO mngmf mineral agar medium. Steroid growth deficient mutants scored after 3-4 j. ;_o1 MuiCll oicZ ;j 'I iene-3r 4-a.:2.'12 -T mutants abic tu iC ii.-.androstadiee31-* i m-inerai agar medium. It can be concluded zhat the gene was inactivated. The acne was called kstD3 (see Figure 1).

Examiple 4 Microbiological 9a-hydroxylation of 4-androstene-3, 17dione with UTV-mutarit Rhodococcus erythropolis UTV-29.

Rhodococcuy erythropolis SQl UTV-29 is a UTV-mutant which is capable of conversion UI 4fl~iULThkTJ A TINI~l.~fjUlJ~'*.*.\ with concentration of 10 to 20 g/l.

WO 01/31050 PCT/EP00/10223 10 This conversion was performed using the following method: A 250 ml Erlenmeyer flask containing 75 ml sterile medium yeast extract, glucose; pH 7.0) was grown with Rhodococcus erythropolis SQ1 UV-29 on a rotary shaker (180 rpm) at 28 *C for 24 hours (preculture). A 10 liter fermentor with 6 liter in situ sterilized fermentation broth yeast extract, 1.5% glucose, 0.01% antifoaming agent polypropylene glycol; pH 7.5) was inoculated with preculture and incubated at 28 0 C for 16 hours under sparging with sterile air and the culture was agitated to induce submerged growth. Then a suspension of 60 gram 4-androstene-3,17-dione in 300 ml polysorbate was introduced. Aerobic incubation with agitation at 28°C o0 was then resumed for 24 hours. Samples of the culture were then extracted with methanol and filtrated over a dead-end 0.45jpm filter before the steroid composition was determined with HPLC. The same procedure was performed in triplo with a two-times higher AD-concentration of 20 g/l, by adding 120 g instead of 60 g

AD.

As shown in figure 4 within 24 hours 10-20 g/1 of 4-androstene-3,17-dione is almost completely conversed into 9a-hydroxy-4-androstene-3,17-dione (approximately 93% of total 4-androstene-3,17-dione).

Example kstD2 characterization.

A gene library of R. erythropolis RG1 was introduced into competent R erythropolis strain RG1-UV29 by electrotransformation. Colonies obtained were replica plated onto mineral agar medium containing 4-androstene-3,17-dione (0.5 g/1) as sole carbon and energy source. Complementation of the strain RG1-UV29 phenotype was scored after three days of incubation at 30 oC. Colonies growing on 4-androstene-3,17-dione mineral agar medium were cultivated in LBP medium for isolation of plasmid DNA, that was subsequently re-introduced into strain RG1-UV29 to check for genuine complementation. Plasmid pKSDIO1, isolated from a transformant that showed restored growth on 4-androstene-3,17-dione mineral medium, was introduced into E. coli for further analysis. An insert of approximately 6.5 kb rhodococcal DNA was identified in pKSDIOl and subjected to restriction mapping analysis, subcloning and subsequent complementation experiments. A 3.6 kb EcoRI DNA fragment of pKSDIO1 was still able to restore the strain RGI-UV29 phenotype and thus was subcloned in e vld n c Cnr n, lr-t;o ren rnn Ni-l-tid* cnip.nr. analvqsis revealed the presence of a large open reading f--ame (ORF) of 1,---698 -nt, encoding a revealed the presence of a large open reading frame (ORF) of 1,698 nt, encoding a nr'TI~Vflflh1 fl223 WO 01131050 puttiv prtei of565amio aidswith a calculated molecular weight of 60.2 kDa.

This ORF was designated kstD2 (SEQ ID NO:5)(which is identiatohereiUl described kstD3 see Example The deduced amino acid sequence of ksD2 showed high similarity to known 3-ketosteroid A'dhdoeae (KSTD) indicating that kstD2 encodes a second KSTD enzyme in R. erythropolis RG 1.

Example 6 ksD2 deletion strainsio R. erythropolis strain RG7 is a mutant strain, obtained from wild type R. erythrOPolis strain SQl, containing a single ksD2 gene deletion. R. erythroPolis strain RG8 is constructed by the successive deletion of two genes encoding 3-ketosteroid A' dehydrogenase activity, iLe. ksDl and ksID2, from wild type R. erythrOPolis strain SQ I Strain RG9 was obtained by deletion of the kstD2 gene from the genomfe of the kstDl deletion mutant R. erythropolis strain RGl. The method used for kstD2 gene deletion was analogous to the method described for kstDl gene deletion in example 2, except for the faict that a different mutagenic vector was used (pKSD2Ol versus pSDH422).

The mutagenic vector pKSD20 1 was constructed as follows. A 1,093 bp internal

DNA

fragment of the kstD2 gene was deleted by Ml digestion and subsequent self-ligation of pKSD IOS, resulting in construction of PKSD200. A 2.4 kb EcORd fragment of 0 harboring the mutated kstD2 gene was ligated into EcoRI digested pK18mobsacB, thereby constructing pKSD2Ol. Plasmid pKSD2OI was introduced into E. coli S 17-1 and mobilized by conjugation to 1? erYthroPOlis strain SQl (to conistructl strain RG7), or strain RGI (to construct strain RG8). Traflsconjugants (sucs kar) resulting from targeted integration of pKSD201 into the genOine appeared after 3 days of growth at 30 0 C. Deletion of kstD2 was achieved by growth of one selected transco11jLgarnt (sue 5 kanr) overnight under non-selective conditions LBP medium) and subsequent plating on selective LBPS agar medium. Colony pCR performied on sucrlkans colonies with kstD2 primers (forward primer gcgcataiggctaagaatcaggcacccII(SEQ ID NO:6); reverse primelr gcgaceatccgtctag(E ID NO:7)) resulted in 4 PCR products with fr-agment sizes of 0.6 kb, comprising tne remuisig rthe, kstD2 gene. Southern WO 01/31050 PCT/EP00/10223 12 analysis using dig-labeled kstD2 gene as a probe on Asp718 digested chromosomal DNA of wild type and these 4 obtained mutants confirmed deletion of kstD2: wild type Asp718 DNA fragment of 2.4 kb was reduced to 1.3 kb in the mutant strains.

Example 7 Microbial 9a-hydroxylation of 4-androstene-3,17-dione with R. erythropolis strain RG8.

Rhodococcus erythropolis RG8 is a kstDI and kstD2 double deletion mutant which is capable of conversion of 4-androstene-3,17-dione (AD) into 9a-hydroxy-4-androsteneio 3,17-dione (9ctOH-AD) with a concentration of 10 g/l.

This conversion was performed using the following method: A 250 ml Erlenmeyer flask containing 75 ml sterile medium yeast extract, glucose; pH 7.0) was grown with Rhodococcus erythropolis RG8 on a rotary shaker (180 rpm) at 28 OC for 24 hours (preculture). A 10 liter fermentor with 6 liter in situ sterilized fermentation broth yeast extract, 1.5% glucose, 0.01% antifoaming agent polypropylene glycol; pH 7.5) was inoculated with preculture and incubated at 28 0 C for 16 hours under sparging with sterile air and the culture was agitated to induce submerged growth. Then a suspension of 60 gram 4-androstene-3,17-dione in 300 ml polysorbate was introduced. Aerobic incubation with agitation at 28 0

C

was then resumed for 24 hours. Samples were taken during the process. These samples were extracted with methanol and filtrated over a dead-end 0.45tim filter before the steroid composition was determined with HPLC. This process was performed twice.

As shown in figure 5 within 15 hours 10 g/l of 4-androstene-3,17-dione is almost completely converted into 9a-hydroxy-4-androstene-3,17-dione (approximately 92-96% of the total 4-androstene-3,17-dione).

WO 01/31050 CIPO123 PCTiEF0Gi1022:; 13 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MIUCROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE INTERNATIONAL FORM Akzo Nobel N.V.

Velperweg 76 NL-2824 BM Arnhemn VIABILITY STATEMCENT issued pursuant to Rule 10.2 by thle INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this Page L DEPOSITOR ILID ENIFICATION OF THE MICROORGANISM Name: Akzo Nobel N.V. Acessonnumbgienby the Velperweg 76 INTERNATIONAL DEPOSITARY AUTOIRITY: Address: DSM 13156 NL-2824 BM Arnhem Date of the deposit or thle transfiet': 1999-11-25 Ill. VIABILITY STATEMENT Theviabilityof themicroorganism identified under 11 above was tested on 1999-11-25 2.

On dhat date. the said microorganism was viable 'no longer viable IV. CONDTONS UNDER MUICH THlE VIAI3IUTY TEST HAS BEEN PERFORMED' V. INTERNATIONAL DEPOSITARY AUTHOITY Nam: DSMZ.DEIJTSCHE SAMMLUNG VON Signature(s) of person(s) having the power torepresenat the MIKROORGANISMEN IJND ZELLIKULTUREN GmbH International Depositary Authority or of authotrtzd official(s): Address: Maseheroder Weg l b D-38 124 Braunschrweigc- Date: 1999-11-29 Indicate the date of original deposit or. where a new deposit or a transfer has been made, the most recent relevant date (date of the new deposit or date of the transfer).

In the cases referred to in Rule 101(a) (ii) and (iii), refer to thle most recent viability teSt.

Mark with a crass the applicable box.

Fill in if dhe information has been requested and if rte results of the teast were negative.

Form DSMZ-BP19 (sole page) 0 196 WO 01/31050 PCTIEPOO/10223 14 BUDAPEST TREATY ON THE INTERNATIONAL RECOGNTON OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE INTERNATIONAL FORM Akzo Nobel N.V.

Velperweg 76 NL-2824 BM Arnhem RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the INTERNATIONAL DEPOSITARY AUTHORITY identffied at tie bottom of this page I. IDENIIFICATION OF THE MICROORGANISM Identificaion reference given by tie DEPOSITORL Acuson number given by die INTERNATIONAL DEPOSITARY AUTHORITY: DSM 13156 IL SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOMIC DESIGNATION The ficoorgmnism iniied under 1. above was accomparticid by: (X a scientific description (X a proposed taxonomic desgmation (Mark with a erus where applicable).

III. RECEIPT AND ACCEPTANCE This Intonationial Depoitary Authoity aceis the micoorganism identified under 1. above_ which was received by it on 19 9 9 -I -2 (D=t of the original deposit)'.

V. INTERNATIONAL DEPOSITARY AUTHORITY Natne: DSMZ-DEU TSCHE SAMMLLING VON I Signazure(s) of persoa4s) having tie power to represent the NOKROOROANIMEN UND ZELL1KULTUREN Ombli. j ntenmajoai Depositary Authority or of authorzed official(s): Address: Masceider Weg l b D-38 124 Braunschweig 4t-K 6 ~4 ;E4 Dt:1999-11-29 Whene Rule 6.4 applies. such date is tie date on which tie status at international deposay authority was acquird.

Foarm DSMZ-BP/4 (role page) 0196 1111i'% All III "A PCT[EPOO/10223 BUDAPEST TREATY ON THEI INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE INTERNATIONAL FORM Akzo Nobel N.V.

Velperweg 76 NL-2824 BM Arnhem VIABILITY STATEMENT issued pursuant to Rule 10.2 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom Of this page 1. DEPOSITOR 1.IETFCTO FTEM ROGNS Nam: Akzo Nobel N.V. Acemiuonflnumber given bythe Velperweg 76 INTERNATIONAL DEPOSITARY AUTHORITY: Address:D M 3 NL-2824 BM Arnhem Date of the deposit or the tranfer': 1999-11-25 [itI. VIABI~LY STATEMENT The viability of the microorganism identifiedunderl 11 bove was ested on 199 9 -1125 2 On that date, the said mieboorganism was viable I o longer viable IV. CONDITIONS UNDER WHICH THE VIABILITY TrST HAS BEEN PERFORMED' V. INTERNATIONAL DEPOSITARY AUTHORITY Name: DSMZ-OEUTSCHE SAMMLUING VON Siguass) of personlt) haytng thse powr to represent thre MIKROORGANISMIEN UND ZELLIKULTIJREN GmobH Interriationai Depositary Authority or of authorized official(s): Address: Mascheroder Weg lb D-38 124 Braunschweig I Date: 1999-11-29 Indicate use Cate dl original deposit or, where a new deposit or a transie has menr macie. the ms ae:,7 date of the tranrsferi.

In the easm referred to in Rule 101(a) (ii) and (iii), refer to the most recest viability test.

Mark with a cross; the applicable box.

4 Fill in if the informations has been requested and if fte results of the teU were negative.

Form DSMZ-BP/9 (sole page) 0196 WO 01/310501 P('TiMflfhWlh2 16 BUDAPEST TREATY ON THE ITrERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSES OF PATENT PROCEDURE INTERNATIONAL FORM Akzo Nobel N.V.

Velperweg 76 NL-2824 BM Arnhem RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuut to Rule 7.1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at die botstom of this page 1. IDENTIFICATION OF THE MICROORGANISM The microozrgansim identifiedl under 1. above was accompanied by: MX) a scientific description (X a proposed raxonomsic designation (Mark with a cross where applicable).

Ill. RECEIPT AND ACCEPTANCE This International Depositary Authority acceps the microorganism identified wnder 1. above, which was received by it on 199 9 -11- 2 (Date of the original deposit)'.

IV. RECEIPT OF REQUEST FOR CONVERSION The microorganisnm identified under I above was received by this International Depositary Authority on (date of original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was received by is on (date of receipt Of request for conversion).

V. INTERNATIONAL DEPOSITARY AUTHORITY Name DSIQ-DUTSCE SA~Q~LUNGVONSignature(s) of person(s) having die power to represent the Nm: DMKRORGASE SNOVUN ZEVONURNOb International Depositary Audiority or of autthorized official(s): Address: Masciseroder Weg lb 0-38 124 Braunschtweig D=le1999-1129 Where Rule 6.4 appies such date is the daze on which the status of irtterntsaional depositary authority was acquired.

Forms DSMZ-BP/4 (sole page) 0196 EDITORIAL NOTE FOR 15145/01 THE FOLLOWING SEQUENCE LISTING IS PART OF THE DESCRIPTION THE CLAIMS FOLLOW ON PAGE 17 WO 0 1 /31050 WO 0131050PCT/E P00/10223 SEQUENCE LISTING <110> AKZO NOBEL N.V.

<120> Microbial 9 aipha-hydroxylation of steroids <130> <140> <160> 7 <170) Patentln Ver. 2.1 <210> 1 <211> 2398 <212> DNA <213> Rhodococcus erythropolis <400> 1 qgacatgacg cagaagcagg gttgaggcac gtcttcctCq atcgatcttg cgcagtcgaa cacggcgtcc atcgatctgc gagagtgccg ttctttctcg ctcgtccgaa catcatcgat catctcggca tccgtggaca tgcgacgtgt gctcagggat tactcgggcq gactcgaccg cgccaggacg aacatcgaat acgggacgct aaggtgcgtc atcggtgggc gaacttcgca gccgaggtcg gcagcaggcq gcgatctgga gctgtCgqgg cccgacggca ggtgagcgct cacgacgaca ggactgcccg tgggtcggtg ttgcgcagca catcgcggcq gcactgacgg ggcaccaagq aacccacccc tcgcacccct gattggatga gtcgggttct cccacgtccg aqqgccggcc tgcggattgg tcgaccatca atggccacgc gt ccccaatt ctgggctcag tatgtgtCc tattgcccgc ccccaccctc tggtagtcgg tgacgacgat cctcgatctg agaatgcccg cctacgtcga tcgagttccg ccatcaaccc cggaactgga gcgcactgat ccgaatccgt aatccggcgg gcatcgaagg gtatgggtc gcgcaacagc gcgccgcctt acctcaacga acggttctgc ccatctgcat ccgacactct ctgtcgaaaa aagacccgta ccatcgagaa gcggattggt gagaaggggc tgcggatgtc ccccgaacca cgatcccggc gcaccgtcqc gacgcagtaa ccgactgcac cagcgacgaa ctgcccgctt cggcggccgc cagcgtccct ggccgcgaac tcaqtgggac ttggagtaag ctccggcqqc cgtcctcgag gctcccaggt cacctatctg gaccgctccc tgcgttCCCC tctcgatctc ccaaqaccgc Cggccgtctg cctcacctcc cgaaacccag caacgccgag cttcggcgcc cttgctcgat catggtcggC gtcgcttccg cgtgccqtcg cccgaacacg cgaagaactc gttcaacgat cgacgcgttc cggaccgttc caccgacgtc gaggtcacgt gtactccgca cagctgcatc cgcatcgagg gacgttggcg cccgcgagtc ctgatgcttg gaggtgcgtc ggcaacttcg ttccagcatc gacctcgca gaccgcgcta ctggcatggc gacqcaatga ggagcgctga aaaaccgatc acccaggtgc cgcgcgttgc gctgtcgtCg gactactaca gatcccgccg accggtcagg ctggccgcag ctgatcgtgg cgaatcaagg atgcgtgagc aacaccgc caggcgtggt gttcqcggtg tacgaccagt ttcatgatct gcgcccgcca gctgccaaga gccgca aaa c ttctgcccac tacqcggccc aacggccgag cagtgtcgtg tccgggatgg agcagacgca atgatctgcc gtactggacg gcgcgcacca.

gcgaaactgt ttcgaaggga tgcatctgaa cgcacatggc attctcggca attctctcac cttccagtgc tgcaggactg ccggcgcata gtttcggCgg aggaacgcgc t cggtgacgc ctctactcga aagccgaagg acatcggtga atcatgctcc ttcagagcac aagacggccg cgaaccgcgg aggcaggcac acgcgatctc tctgccccgg ggctcgtCgt tcggacgagc tcgactcgcg agcacctcga ccggactacc tgggcgtcga ccaacggcgg gcatcgtCct tcctgcgtgc agaqattcac aaattcgacc acccggtgtt ggaagccgcg actgcagcat ggacctcgta cgccgatctg aatagcggta cccgtgagag gcgcccgctg acgtcgccc ctgqaccacc cgtgcggtat gaccagcgag taccqccgct gacctccgcc cggacttccc cgagtccgag gcagaacccg ccggatggac cctcgccggC cggcccgatg cggtaaggca tgttgtCggc tgtcctgatg ccccggcaag tgccggtatt cgtcgaqcag cgacagcgcc catggatgct cgagggtggc agccggaacg ggccgacgca cgaagagttc tgcgaatgcg cagtgaccuc tgacggcagc 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1740 1800 1860 1920 1980 2040 2100 2220 W O iW3150 Ciru PCTiEF00Ii0223 gccatcgacg gcctgtacgc cgccggcaac acgagcgcgt cactqagcgg ccgcttctac cccggccccg gagttccact cggcacggct atggtcttct cgtaccgagc agctcaggac atqgcgaagt aacgcagttc aatcacactc cgtggaaaca gatcgtgggg cagccgat 2280 2340 2398 <210> 2 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: degenerate probe <400> 2 ttcggsggsa cstcsgcsta ctcsggsgcs tcsatctgg <210> 3 <211> <212> DNA <213> Riodococcus erythropoiis <400> 3 gcgcatatgc aggactggac cagcgagtgc <210> 4 <211> <212> DNA <213> Rhodococcus erythropois <400> 4 gcgggatccg cgttacttcg ccatgtcctg <210> <211> 1698 <212> DNA <213> Rhodococcus erythropolis <400> 5 atggctaaga gtgatcgggt acgctgatcg ttctggatgC gcgaagacat ttcgtcgaca ttctgggcca cgtacctgcg cgcccaggtt atgaacctga caaggcgttt gccgccggac ttggttcggC cgtgaagtga aacatggagt gcagagggca tcqatggatc atcaggcacc ccggtaccgg tggagaagac ctgccaaccc acgtqcgttc acggtgcggc aggaatactc agtgcctgcc tgatggaagc tggtgaagaa acggcaagta tgttcgCcgg tcatcaccga cggtgaccgc ggcgccacaa acaccggcgt agtcctggtg ccccgcgaca catggctgcc gcagtacgtc gatcttggcg ggtggt cggt cactgtcgac cgattaccac gttcgacgcg cggactgccg gccgagcaag cgtcctcaag tqtggtccag agatggccgc tcggcgcggt gtaccagtcg c6YUYaLUyay gttccccgcg ca agccaagg gctctcaccg ggcggttcga aaagccggtg gatactgccc atgctCtac cccgaactgc tcggtactgg atgccggtga gcttttcccc cgtgaataca gccggtatcc gtaacgggtg gtcgtCCtgg gagagcctcg ytLao yL. gtggcaagca acatcgttgt cgaacgaact cggcgcggtc cgggcgacac ctgcccaacg gcacgacgcc cgggcggtag gagcggaacg cgggtgcgga gcatcatccg t cgcgggcgg cggtgtggac cagttgtggt cagccggcgg gtgagcatga tcaagggccg cgatctattg cggcttgtcc cggtggggcg cgttgagcga aggagaagca catqaagttc cgccgccgga cggtcgcctg ttacaagtg ccgcctggcg tcaggcgctc ggaaacgtcg gcaagacqga gttcgaccac gagcctgggccccgccqatg 60 120 180 240 300 360 420 480 540 600 660 720 780 840 900 960 1020 OIL I PCTEruuii62 gtqatgctcg ttcgtgaacg gctggcgatc gtgttcgcag atcgcgcacc gcgtttgcq ttcggtcgcg ccgaatctgc ctgggcacct agcgt cat cg tacccaggcg cacgcagcag cagagcgtgc aggcgacgga cggccgagtc gcggtatctt aggcgagcag agtccttcca gcggcagcgc gccagctcga gcggcggtgt acggcctgta ccggcgcgac agaagtag gctgcccggc ctacatgtcg gatgtggttt cccccgtcag tccgqccgaa gaagttcaac atacgatcgg caagagcgcc gcaggcggac cgcgatcggc gatcggccag tctttcatcg ttcggccagc gttttcgatc ccccttccgc ctcgcccgca gaggccgctg tactacggcg ctctatgcyg gagaatgcac aataccgcgg gggctggttt tcgaccagac gcgtgctcga aggagtaccg aggcattctt aggtcggtct ctgcaggtag acccgacagt tgaagatgac gcgtgcttcg ccaacgcatt acggatacat cggtcgtcga acgggaaaag caacagctac cgagtccggc ccccgaggat cgatgcggag gtctccgaac gctcagcgac tgaggacggc cggtcacacc cgcggcccat 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1680 1698 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: forward primer <400> 6 gcgcatatgg ctaagaatca ggcaccc <210> 7 <211> <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: reverse primer <400> I gcgggatccc tacttctctg ctgcgtgatg

Claims (8)

1. Method to construct a genetically modified strain of a steroid-degrading micro-organism lacking the ability to degrade the steroid nucleus, the method comprising inactivation of more than one steroid dehydrogenase gene involved in steroid nucleus degradation, wherein the first gene is deleted by unmarked gene deletion, the first deleted gene being the steroid dehydrogenase gene kstD1 or kstD2.

2. Method according to claim 1, wherein any subsequent gene is inactivated by UV irradiation.

3. Method according to claims 1 or 2, wherein any subsequent gene is deleted by unmarked gene deletion.

4. Method according to claim 1, wherein the second gene is deleted by unmarked gene deletion. Method according to any one of claims 1-4 wherein the micro-organism is Rhodococcus.

6. Method according to claim 5 wherein the micro-organism is R. erythopolis.

7. Micro-organism prepared according to any one of claims 1-6.

8. Micro-organism according to claim 7 wherein at least both kstDI and kstD2 are inactivated. 0 S9. Genetically modified strain Rhodococcus erythropolis RG1-UV29 (DSM S 20 13157). Use of micro-organisms according to any one of claims 7-9 in the preparation of 9c0-hydroxy-4-androstene-3,17-dione by growing said micro-organisms on a culture medium comprising 4-androstene-3,17-dione. 0 11. Nucleotide sequence encoding KSTD2 protein encoded by nucleotides 1-1678 25 ofSEQ ID

12. Method according to claim 1 and substantially as herein described with reference to the Examples. Dated 3 June, 2004 N.V. ORGANON Patent Attorneys for the Applicant/Nominated Person SPRUSON FERGUSON :\DAYLIB\LIBXX04928.doc:mpr