CN1224716C

CN1224716C - Microbial 9alpha-hydroxylation of steroids

Info

Publication number: CN1224716C
Application number: CNB008175675A
Authority: CN
Inventors: R·范德盖兹; G·赫塞尔斯; L·迪杰奎兹恩
Original assignee: Akzo Nobel NV
Current assignee: Organon NV
Priority date: 1999-10-22
Filing date: 2000-10-17
Publication date: 2005-10-26
Anticipated expiration: 2020-10-17
Also published as: WO2001031050A1; RU2002113373A; CA2396879A1; AU1514501A; NZ519039A; EP1232278A1; CZ20021784A3; NO20022449L; NO20022449D0; AR026186A1; IL149715A0; RU2268935C2; CN1413260A; AU775476B2

Abstract

A method is described to construct genetically modified strains of steroid degrading micro-organisms wherein multiple genes involved in steroid nucleus degradation are inactivated, such as steroid dehydrogenase genes. Examples for such genes are kstD1 and kstD2: strains with multiple inactivated steroid degrading enzyme genes can be used in the accumulation of steroid intermediates with a high yield. A preferred accumulation product is 9 alpha -hydroxy-4-androstene-3,17-dione.

Description

Microorganism 9 'alpha '-hydroxylations of steroid

The present invention relates to prepare that degraded has the inhibiting method of microorganism of modifying through genetic engineering to steroid nuclear, application and this modified microorganism of this microorganism in the steroid accumulation.

The ability of degrading plant sterol extensively is present in the Nocardia shape actinomycetes, and this ability needs the enzyme of a group of can degrade side chain and steroid nuclear structure.

3-ketosteroid Δ ¹-desaturase (KSTD) [4-alkene-3-oxosteroid: (acceptor)-1-alkene-oxydo-reductase, EC 1.3.99.4] is by introducing the cracking that two keys participate in the B ring of steroid nuclear in the C1-C2 position.More particularly, this enzyme participates in 4-androstene-3,17-diketone to 1, the male diene-3 of 4-, the conversion of 17-diketone, and 9 Alpha-hydroxies-4-androstene-3,17-diketone to 9 Alpha-hydroxy-1, the male diene-3 of 4-, the conversion (see figure 1) of 17-diketone.In several bacteriums, identified this enzyme: Arthrobacter simplex (Arthrobacter simplex) (Penasse and Peyre, 1968Rhodococcus.Crit Rev Biotech 14:29-73), Rhodopseudomonas (Pseudomonas) (Levy and Talalay, 1959 J Biol Chem 234:2009-20013; 1959 J Biol Chem 234:2014-2021), limitation Nocardia bacteria (Nocardiarestrictus) (Sih and Bennet, 1962 Biochem Biophys Acta56:587-592), coral Nocardia bacteria (Nocardia corallina) (people such as Itagaki., 1990 Biochim Biophys Acta 1038:60-67), nocardia opaca (Nocardiaopaca) (people such as Drobnic., 1993 Biochim Biophys Res Comm190:509-515), accidental Arthrobacter (Mycobacterium fortuitum) (people such as Wovcha., 1979 Biochim Biophys Acta 574:471-479) and Rhodococcus (Rhodococcus erythropolis) IMET7030 (people such as Kaufmann., 1992 JSteroid Biochem Molec Biol 43:297-301).The KSTD of nocardia opaca be accredited as a kind of flavoprotein matter (people such as Lestrovaja., 1978 Z Allg Mikrobiol18:189-196).Gene (the kstD:3-ketosteroid Δ that has only encoded K STD in Arthrobacter simplex, Comamonas testosteroni (Comamonasrestosteroni) and the prunosus red coccus (Rhodococcus rhodochrous) ¹-desaturase) character identified fully (people such as Plesiat., 1991 J Bacteriol 173:7219-7227; People such as Molnar., 1995 Mol Microbiol 15:895-905; People such as Morii., 1998 J Biochem124:1026-1032).

Steroid 1, the proprietary restraining effect of 2-desaturase causes 9 Alpha-hydroxies-4-androstene-3, the accumulation of 17-diketone, the latter is the fabulous initiator of corticoid synthetic (Kieslich K, 1985 J Basic Microbil 25:461-474).9 Alpha-hydroxy male sex hormones are as androgen antagonist, estrogen antagonist and resist the fertilization material industrial significant.9 Alpha-hydroxies are easy to dehydration and form 9 (11)-dehydrogenation systems, thereby provide initial structure for 9 alpha-halogen corticoids generate.

As everyone knows, rhodococcus (Rhodococcus) bacterial classification has huge katabolism potentiality (Warhurst and Fewson, 1994 Rhodococcus.Crit Rev Biotech14:29-73; People such as Bell., 1998 J Appl Microbiol 85:195-210).Several rhodococcus natural phytosterin of degrading, the latter generates the cheap initiator (Kieslich K, 1986 Drug Res 36:888-892) that bioactive steroid is arranged.Rhodococcus and genus arthrobacter bacterial strain can change into sterol 4-androstene-3 after hatching through the mutagenic compound processing and/or with enzyme inhibitors, 17-diketone and 1, the male diene-3 of 4-, 17-diketone (Martin, 1977 Adv ApplMicrobiol 22:29-58).

Although the expression of the non-activity KSTD protein of the clone of kstD and Rhodococcus IMET7030 in intestinal bacteria (Escherichia coli) is existing to be described (people such as Wagner., 1992J Basic Microbiol 32:65-71; 1992 J Basic Microbiol 32:269-277), and nocardia opaca (people such as Drobnic., 1993 Biochem Biophys Res Comm190:509-515) one section nucleotide sequence can obtain (DDBJ/EMBL/GenBankU59422), but this gene molecule evaluation aspect is not reported.Degraded is necessary to the KSTD activity to steroid nuclear, and the inactivation of kstD gene is essential to accumulation steroid intermediate.The nucleotide sequence of the kstD gene of Rhodococcus is provided according to an aspect of the present invention.KSTD1 protein is by the Nucleotide 820-2329 coding of SEQ ID NO:1.

Making gene inactivation is analyzing gene function and the strong instrument of introducing the metabolism obstruction.Destroying gene with the non-replicability carrier that has selective marker is a kind of common method that makes gene inactivation.Yet making up the bacterial strain with required feature with the metabolic pathway engineering method may need to make step by step several gene inactivations or replacement.Only have suitable strategy, can be used for introducing the genetically deficient that is not labeled or gene and replace, can infinitely take turns metabolism processing and do not rely on the use of a plurality of marks, just can make it feasible.According to another aspect of the present invention, the gene that provides the substep inactivation to participate in the steroid degraded, the method for preferred dehydrogenase gene.Especially, the present invention can be applicable to having participated in by at 4-androstene-3, culturing micro-organisms on the 17-diketone and accumulate 9 Alpha-hydroxies-4-androstene-3, and the gene of the process of 17-diketone carries out deactivation.Preferably, make gene kstD1 inactivation at least.

Be surprised to find that, destroy coding 3-ketosteroid Δ among the Rhodococcus SQ1 ¹The gene kstD1 of-desaturase, the inactivation that does not cause steroid nuclear to be degraded.The activity that keeps is seemingly based on the existence of another enzyme.Have now found that the bacterial strain of the degraded of steroid nuclear being blocked in acquisition fully above the inactivation of a gene is essential.The second preferably enzyme is a desaturase, more preferably the KSTD isozyme.In order to destroy or lack some gene, a preferable methods is a site-directed mutagenesis.For inactivation KSTD gene step by step, preferably introduce the method for unlabelled genetically deficient.The bacterial strain of being transformed in the heredity that is produced should be not contain foreign DNA.

According to another preferred version of the present invention, make gene kstD2 inactivation at least.Most preferably, make all inactivations of gene kstD1 and kstD2 at least.Another aspect of the present invention is the nucleotide sequence of the kstD2 gene of Rhodococcus.KSTD2 protein is the Nucleotide 1-1678 coding by SEQ ID NO:5.

Introducing the method for the genetically deficient that is not labeled in Rhod does not also report.Yet, in other members of actinomycetales, promptly streptomyces (Streptomyces) (people such as Hillemann., 1991 Nucleic Acid Res 19:727-731; Hosted and Baltz, 1997J.Bacteriol 179:180-186), Corynebacterium (Corynebacterium) (people such as Schafer, 1994 Gene 145:69-73) and genus arthrobacter (people such as Marklund, 1995 JBacteriol 177:6100-6105; People such as Morman, 1995 Mol Microbiol16:755-760; People such as Sander, 1995 Mol Micorbiol 16:991-1000; People such as Pelicic, 1996 Mol Microbiol 20:919-125; People such as Kinpfer, 1997Plasmid 37:129-140) in, the method that genetically deficient or gene replace is existing to be described.Anti-selective marker can be used for screening the recombination event second time of the rareness that produces genetically deficient or gene replacement.In this respect, sacB and rpsL are proved to be useful reporter gene (Hosted and Baltz, 1997 J Bacteriol 179:180-186; People such as Schafer, 1994 J Bacteriol172:1663-1666; People such as Sander, 1995 Mol Microbiol 16:991-1000; People such as Pelicic, 1996 Mol Microbiol 20:919-925; People such as Jager, 1992 JBacteriol 174:5462-5465), but also have other suitable mark to use.Also in Rhod, do not use the report of rpsL, but at this genus, sacB (coding subtilis (Bacillus subtilis) levansucrase) can provide strong positive selective marker (people such as Jager, 1995 FEMS Microbiol Lett 126:1-6; People such as Denis-Larose, 1998 Appl Environ Microbiol 64:4363-4367).

The subtilis levansucrase catalysis syrup of SacB genes encoding is separated and Polylevulosan (high molecular fructose polymer) synthesizes.When sucrose existed, the expression of sacB in Rhod was lethal.Levansucrase acts on the toxigenous biochemical foundation of sucrose and does not still know.Therefore, conditioned lethal (that is, being with or without sucrose) of sacB gene can be used as anti-selective marker.Anti-selection herein is that the expression of digit synbol is lethal, rather than can improve resistance, but promptly is like this under the situation of selective marker (for example, resistance marker) for example.

Need select those to experience recombination event for the second time by anti-selection, thereby lose the sacB mark and introduced the mutant that expectation suddenlys change.The advantage of this system is, in chosen process, only the potential physical efficiency of suddenling change well survives through selection.Compare the process that anti-selection has avoided long-time selection resistance marker essential in a selecting and labelling system to lose with the system that has only a selective marker.

The advantage of unmarked sudden change is that it allows to introduce repeatedly sudden change in same bacterial strain.In introducing mutation process, foreign DNA (carrier DNA) is removed.Like this, for introducing the position at (by the homologous recombination between the carrier DNA) place that once suddenlys change before second new carrier DNA of introducing of sudden change just can not be incorporated into.If carrier DNA still on karyomit(e), is integrated the generation that is bound to so, and will be improved the quantity of false positive intasome greatly.This system can guarantee only to use single antibiotic resistance gene to be used to introduce the sudden change of unlimited amount.Unmarked sudden change also is easy to be applied in the industry, because there is not the existence of allogeneic dna sequence DNA, thus can the simple process fermentation culture.

Carry out gene inactivation by genetically deficient and can construct stablely, regressive mutant does not take place.Than carrying out gene disruption by single recombination and integration, especially little gene (＜500bp) easier by genetically deficient and inactivation.Genetically deficient mutagenesis strategy also can be used for gene and replace (for example, change wild-type, form mutator gene).

The preferred strain of mutagenesis katabolism steroid dehydrogenase gene is a Rhodococcus.Yet, if molecular composition identical with Rhodococcus SQ1 (or similar) is also included within by engaging heredity and goes up the kstD1 that carries out in enterable other bacterial classification and/or the unmarked genetically deficient of kstD2.Preferably, these bacterial classifications belong to Rhod, but also can use relevant bacterial classification, for example Nocardia, genus arthrobacter and genus arthrobacter.

Gene inactivation in the rhodococcus can be hindered by unusual recombination event.These unusual recombination event cause mutagenesis carrier random integration to go into genome (people such as Desomer, 1991 MolMicrobiol 5:2115-2124; People such as Barnes, 1997 J Bacteriol179:6145-6153), this is the phenomenon that we run into when attempting to destroy the kstD1 gene of Rhodococcus SQ1.Unusual reorganization also is a phenomenon (McFadden, 1996 Mol Microbiol 121:205-211) known in some poky Arthrobacter bacterial classification.Transferring to the rhodococcus demonstration in conjunction with plasmid from intestinal bacteria S17-1 can make random integration minimize (Powell and Archer, 1998 Antinie van Leeuwenhoek 74:175-188).The bacterial strain of plasmid from coli strain S17-1 conjugal transfer to many different bar shaped bacterias, and transfer to bunchy rhodococcus (Rhodococcus fascians) DSM20131 and be proved to be possible (people such as Schafer, 1990 J.Bacteriol 172:1663-1666; People such as Jager, 1995FEMS Microbiol Lett 126:1-6).According to the present invention, adopt to have of the conjugal transfer of sacB gene as the mutagenesis carrier of anti-selective marker, in the steroid katabolism of Rhodococcus SQ1, introduce unmarked genetically deficient.

As another one embodiment of the present invention, can with embodiment in the same procedure that shows about kstD2 realize introducing another gene inactivation incident.For further gene inactivation, can use the same method once more, or as an alternative, also available ultraviolet radiation or chemical process, for example nitrosoguanidine or bisoxirane (diepoxyethaan).In this area, the method for in this way introducing transgenation is well-known.

Same, the method that structure is used for the carrier of mutagenesis scheme is well-known (people such as Sambrook, molecular cloning: laboratory manual (Molecular Cloning:a LaboratoryManual), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, latest edition).And up to now, the technology of the structure of the connection of site-directed mutagenesis, appended sequence, PCR, dna sequencing and suitable expression system is well known in the art.The solid phase technique of the part or all of DNA available standards of coding desired protein is synthetic, preferably includes restriction site so that connect.

In the past in the face of in the detailed description of the present invention, those skilled in the art are clear clear to the sudden change of introducing gene disruption or the disappearance of unmarked gene and the modifications and changes of conversion and method of joining.These modifications and changes are included in the application's the scope.

According to another aspect of the present invention, can utilize the microbial accumulation steroid intermediate of polygene inactivation.Preferably, the product of accumulation is 9 Alpha-hydroxies-4-androstene-3, the 17-diketone.Initiator may depend on the enzyme gene that is inactivated.For example, suitable initiator is plant sterol or 4-androstene-3, the 17-diketone.Preferred initiator is a 4-androstene-3, the 17-diketone.

An advantage of present method is the high conversion yield that can obtain from initial steroid to the accumulation product.Productive rate can surpass 80%, preferably can surpass 90%, and usually almost can reach 100%.

Certainly, another aspect of the present invention relates to heredity and goes up the microorganism of modifying, and the gene of a plurality of participation steroid degradeds is by inactivation in these microorganisms.Especially, these genes are desaturases.Preferably, at least kstD1 or kstD2 gene by inactivation.Especially preferred is that gene kstD1 and kstD2 are by inactivation.The microorganism that preferably belongs to Rhod.Bacterial strain Rhodococcus RG1-UV29 most preferably.

Microorganism strains Rhodococcus RG1-UV29 and Rhodococcus RG1 have been deposited in Deutsche Sammlung von Mikroorganismen und ZellkulturenGmbH (DSMZ), Mascheroder Weg Ib, D-38124 Braunschweig, Germany, numbering is respectively DSM13157 and DSM13156.They are according to the preservation of Budapest treaty.

How those skilled in the art's understanding is used described herein and method and material that mention, makes up the microorganism of the ability that lacks degraded steroid nuclear.The gene of other several steroid nuclear degrading enzymes of a plurality of codings can be similarly by inactivation.

Below be illustrative embodiment of the present invention, limit the scope of the present invention and should not be construed as.

Legend

Fig. 1

The synoptic diagram of steroid nuclear degraded among the Rhodococcus SQ1.3-ketosteroid Δ ¹The position of-desaturase (KSTD) isozyme shows with KSTD1 and KSTD3.

Fig. 2

The synoptic diagram that has the mutagenesis carrier pSDH422 of anti-selective marker sacB.This carrier is used to make up the bacterial strain RG1 that contains one section unlabelled kstD1 genetically deficient of 1062bp.ORF2 and ORF3 are the flanking genes of kstD1 among the Rhodococcus SQ1.

Fig. 3

Wild-type Rhodococcus SQ1 and integrated the schematic arrangement of the kstD1 behind the pSDH422 through the single exchange incident respectively at the target gene seat downstream of kstD1 (bacterial strain SDH422-3) and upstream (bacterial strain SDH422-4).Insert window: make probe with kstD1, the Rhodococcus chromosomal DNA through BamHI digestion is carried out Southern analyze.Wild-type (swimming lane 1), bacterial strain SDH422-3 (swimming lane 2), SDH422-4 (swimming lane 3) and two be kstD1 deletion mutant (swimming lane 4 and 5) independently.

Fig. 4

In 6 liters of cultures of Rhodococcus SQ1 UV-29,4-androstene-3, the 17-diketone is to 9 Alpha-hydroxies-4-androstene-3, the bio-transformation of 17-diketone.10 grams per liter AD (O-) and 20 grams per liter AD (Δ-,-◆-,-X-)

Fig. 5

In 6 liters of cultures of Rhodococcus RG8,4-androstene-3, the 17-diketone is to 9 Alpha-hydroxies-4-androstene-3, the bio-transformation of 17-diketone.10 grams per liter AD (Δ-,-X-)

Embodiment

The evaluation of embodiment 1 kstD1

Known KSTD protein sequence N-terminal comparison partly from Arthrobacter simplex, Comamonas testosteroni and nocardia opaca obtains a degeneracy kstD oligonucleotide probe [5 ' ttcgg (c/g) gg (c/g) ac (c/g) tc (c/g) gc (c/g) tactc (c/g) gg (c/g) gc (c/g) tc (c/g) atctgg] (SEQ ID NO:2).To measure size through sucrose gradient centrifugation through the total DNA of Rhodococcus SQ1 of BglII digestion.Each component that obtains is carried out southern blotting technique analysis (strictness is cleaned in the following manner: 2 * SSC cleaned 2 * 15 minutes and 0.1 * SSC cleaned 2 * 10 minutes), the 6kbDNA fragment of the kstD oligonucleotide probe hybridization of acquisition and digoxigenin labeled under 68 ℃.This fragment is connected to rhodococcus shuttle vehicle pDA71 (people such as Dabs, the development of the rhodococcus plasmid vector of 1995 improvement and they potential commerce and medical importance at clone gene, p.129-135. exist: the 9th actinomycetes discussion procceedings, Moscow, Russia) BglII site, and subclone to through the pBluescriptII KS (Stratagene) of BamHI digestion (pSDH200) on.

From the restriction map analysis, we conclude that only there is an EcoRV site in this 6kb fragment, and this site is divided equally into two equal and opposite in directions, the fragment of about 3kb with it.The southern blotting technique analysis shows that the EcoRV fragment of the about 2.9kb of pSDH200 contains and kstD oligonucleotide homologous sequence.The nucleotide sequencing analysis revealed has open reading frame (kstD1 sees SEQ ID NO:1) the encoded K STD1 of one section 1533 Nucleotide, and this sequence is proved by heterogenous expression in intestinal bacteria.Further the nucleotide sequencing analysis revealed has two open reading frame, i.e. 1533 Nucleotide (open reading frame 1) and 627 Nucleotide (open reading frame 2), and what coding was inferred respectively contains 510 amino acid whose protein and contains 208 amino acid whose protein.

Embodiment 2 KstD1 deletion mycopremnas

Structure contains one section mutagenesis carrier that has the Rhodococcus SQ1 chromosomal dna fragment of kstD1 disappearance.The 1062bp BsmI fragment of a big internal portion of one section encoded K STD1 is built into pSDH200 among the disappearance pSDH200) BsmI.For making up such mutagenesis carrier, with pSDH200) the SamI/EcoRI fragment cloning of one section 2724bp of BsmI is to the SmaI/EcoRI site of pK18mobsacB (pSDH422 sees Fig. 2), and this fragment comprises the kstD1 that remains 468bp and its flank region.(the coding kalamycin resistance is used to select this integration of mutagenesis carrier on karyomit(e) with carrier pSDH422, the sacB gene that comprises subtilis is used for anti-selection) introduce intestinal bacteria S17-1, and transfer among the Rhodococcus SQ1 by conjugation described below.Rhodococcus SQ1 F-strain cell is spread on the LBP agar of the nalidixic acid that is added with 30 mcg/ml, grew 5 days.By transformation, pSDH422 at first introduces intestinal bacteria S17-1 with the mutagenesis carrier.

To at room temperature hatch again 24 hours selecting substratum (kantlex 25 mcg/ml) to go up the transformant of overnight growth (approximately each dull and stereotyped 1000).With the bacterium colony of rhodococcus and coli strain be suspended in again final volume be 1.5 milliliters LBP (1% bacto peptone (Dif), 0.5% yeast extract (BBL) and 1%NaCl) in.With 750 mul aliquots sample mixed of every kind of bacterial strain, and leniently centrifugal its precipitation that makes.To precipitate and be suspended in again among 1 milliliter of LBP, and cell will be spread on the non-selection LBP agar with 250 mul aliquots.After 30 ℃ of overnight growth, the material that is paved with growth is suspended in 2 milliliters of LBP substratum again, and spreads on the LBP agar that is added with kantlex (200 mcg/ml) and nalidixic acid (30 mcg/ml) with 100 mul aliquots samples.After 3 days, Rhodococcus SQ1 transconjugant occurs.Kalamycin resistance (the kan of all generations ^r) the rhodococcus transconjugant is to sucrose sensitivity (suc ^s); On the LBPS that is added with 200 mcg/ml kantlex (1% bacto peptone, yeast extract O.5%, 1%NaCl and 10% sucrose) agar, growth occurs through replica plating.

The single band of about 4500bp) and two kinds of transconjugants to wild-type (swimming lane 1:, Southern engram analysis (Fig. 3) demonstration of SDH422-3 (swimming lane 2: approximately two bands of 2900bp and 10100bp) and SDH422-4 (swimming lane 3: approximately two bands of 4000bp and 9000bp), the copy that the two all maintains pSDH422 is incorporated into target position by a recombination event.After overnight growth under the non-selection condition, the kstD1 genetically deficient in the Rhodococcus SDH422-3 bacterial strain.By being to pave plate on the LBPS agar plate continuously to observe this genetically deficient selecting substratum.

Through the overnight growth under the non-selection condition with selecting substratum is to pave plate on the LBPS agar plate continuously, has reached the genetically deficient of kstD1.To 9 suc ^r/ kan ^sBacterium colony carries out bacterium colony PCR, with kstD1 primer (forward primer [5 ' gcgcatatgcaggactggaccagcgagtgc] (SEQ ID NO:3); Reverse primer [5 ' gcgggatccgcgttacttcgccatgtcctg] (SEQID NO:4)), the PCR product that to obtain 6 fragment lengths be 468bp is comprising the kstD1 gene of disappearance.Is that the Southern engram analysis that probe carries out has confirmed genetically deficient 60 ℃ (strict in the following manner the cleaning: 2 * SSC cleaned 2 * 5 minutes, and 0.1 * SSC cleaned 2 * 5 minutes) with the random labeled kstD1 gene of digoxin.Chromosomal DNA is after the BamHI enzyme is cut digestion, and what obtain in wild-type is the kstD1 dna fragmentation of 4.5kb, and in the genetically deficient mutant, this fragment reduces and becomes 3.4kb, and this 1062bp kstD1 dna fragmentation that shows expection has been lacked.With the bacterial strain called after Rhodococcus RG1 that obtains.

Embodiment 3 by ultraviolet mutagenesis to the steroid Δ ¹-dehydrogenation is carried out inactivation

To cultivate at 10mM glucose mineral substratum (K ₂HPO ₄4.65 grams per liter, NaH ₂PO ₄H ₂The O1.5 grams per liter, NH ₄Cl 3 grams per liters, MgSO ₄7H ₂O 1 grams per liter, the Vishniac trace element, pH7.2), be in the Rhodococcus RG1 cell (2 * 10 of late exponential phase of growth ⁸The CFU/ milliliter) obtains individual cells through the short period of time supersound process.With diluted sample (10 ⁴) be coated on the glucose mineral nutrient agar, shine 15-20 second with ultraviolet lamp (15 watts of Philip TAW) in distance 27 centimeters, on average make 95% necrocytosis.Cultivate through 4 days, with the bacterium colony replica plating at 4-androstene-3,17-diketone (0.5 grams per liter is dissolved among the DMSO of 50 mg/ml) mineral nutrient agar.After 3-4 days, the steroid growth defect screening mutant that obtains is come out to do further evaluation.For filtering out Δ ¹The bacterial strain that-dehydrogenation is blocked can be 1 to the screening of sudden change population, the male diene-3 of 4-, the 4-androstene-3 of 17-diketone (0.25 grams per liter) mineral nutrient agar growth, 17-diketone growth defect mutant.This gene inactivation can have been concluded.This gene is called as the kstD3 (see figure 1)

Embodiment 4 ultraviolet mutation body Rhodococcus UV-29 are to 4-androstene-3, the microorganism 9 'alpha '-hydroxylation effects of 17-diketone

Rhodococcus SQ1 UV-29 is a kind of ultraviolet mutation body, can be the 4-androstene-3 of 10-20 grams per liter with concentration, and 17-diketone (AD) changes into 9 Alpha-hydroxies-4-androstene-3,17-diketone (9 α OH-AD).

Carry out this conversion by the following method:

With 75 milliliter aseptic culture mediums (1.5% yeast extract, 1.5% glucose of Rhodococcus SQ1 UV-29 at 250 milliliters of triangular flasks; PH7.0) in, cultivate 24 hours (pre-culture) for last 28 ℃ at gyrate shaker (180 rev/mins).To the fermentation broth that contains 6 liters of in-situ sterilizations (1.5% yeast extract, 1.5% glucose, 0.01% defoamer polypropylene glycol; PH7.5) inoculation pre-culture (1%) in 10 liters of fermentor tanks was cultivated 16 hours for 28 ℃ under the situation of spraying sterile air, stirred substratum to induce the deep layer growth.Add then and contain 60 gram 4-androstenes-3, the suspension of 300 milliliters of poly sorbic esters (0.1%) of 17-diketone.Under the situation of stirring, proceed aerobic cultivation 24 hours for 28 ℃.Before HPLC measures the steroid composition, culture samples methyl alcohol (70%) extracting, and 0.45 micron filter of dead end filters.Undertaken three times by same program, wherein by adding 120 grams rather than 60 gram AD, making AD concentration is former 2 times, i.e. 20 grams per liters.

As shown in Figure 4, in 24 hours, the 4-androstene-3 of 10-20 grams per liter, 17-diketone almost all change into 9 Alpha-hydroxies-4-androstene-3,17-diketone (account for whole 4-androstenes-3,17-diketone 93%).

Embodiment 5 kstD2 identify

Transform by electricity, Rhodococcus RG1 gene library is introduced competence Rhodococcus bacterial strain RG1-UV29.To with 4-androstene-3,17-diketone (0.5 grams per liter) is on the mineral nutrient agar flat board of unique carbon source and energy derive with the bacterium colony replica plating that obtains.Through 30 ℃ of cultivations in 3 days, the complementation of bacterial strain RG1-UV29 phenotype is marked.To be grown in 4-androstene-3, the bacterium colony on the 17-diketone mineral nutrient agar is cultivated in the LBP substratum, with isolated plasmid dna, subsequently plasmid DNA is introduced again bacterial strain RG1-UV29 to detect real complementation.To be presented at 4-androstene-3, and separate the plasmid pKSD101 that obtains in the transformant of recovering in the 17-diketone mineral substratum to grow and introduce bacillus coli DH 5 alpha, to be further analyzed.The rhodococcus DNA that identifies an about 6.5kb in pKSD101 inserts fragment, limiting it property atlas analysis, subclone and follow-up complementation test.The 3.6kb EcoRIDNA fragment of pKSD101 still can be recovered the phenotype of bacterial strain RG1-UV29, therefore with its subclone to pBluescrip (II) KS (pKSD105), with the mensuration nucleotide sequence.Nucleotide sequence analysis is shown the open reading frame (ORF) that has 1698 big Nucleotide, 565 the amino acid whose supposition protein of encoding, it calculates molecular weight is 60.2kDa.With this ORF called after kstD2 (SEQ ID NO:5) (it is identical with above-mentioned kstD3, sees embodiment 3).The kstD2 aminoacid sequence of inferring shows and known 3-ketone sterone Δ ¹-desaturase (KSTD) has very high similarity, and this shows in Rhodococcus RG1, kstD2 another KSTD enzyme of encoding.

Embodiment 6 kstD2 deletion mycopremnas

Rhodococcus bacterial strain RG7 is a mutant strain, and SQ1 obtains from wild-type Rhodococcus bacterial strain, contains a kstD2 genetically deficient.Rhodococcus bacterial strain RG8 is by 3-ketosteroid Δ that two of wild-type Rhodococcus bacterial strain SQ1 are encoded ¹The gene of-dehydrogenase activity (being kstD1 and kstD2) consecutive miss and obtaining.By obtaining bacterial strain RG8 by disappearance kstD2 gene in the genome of kstD1 deletion mutant Rhodococcus bacterial strain RG1.Except used mutagenesis carrier (pKSD201 is to pSDH422) difference, the method for the disappearance kstD1 gene of mentioning among the method for disappearance kstD2 gene and the embodiment 2 is similar.

Mutagenesis carrier pKSD201 makes up by the following method.By the inside dna fragmentation disappearance of MluI digestion with a 1093bp of kstD2 gene, pKSD105 constructs pKSD200 from connecting subsequently.The 2.4kb EcoRI fragment that contains sudden change kstD2 gene of pKSD200 is connected to the pK18mobsacB that cuts through the EcoRI enzyme, constructs pKSD201.Plasmid pKSD201 is introduced intestinal bacteria S17-1, arrive Rhodococcus bacterial strain SQ1 (to make up bacterial strain RG7) or bacterial strain RG1 (to make up bacterial strain RG8) by conjugal transfer.Because of the transconjugant (suc of pKSD201 targeted integration to the genome generation ^sKan ^r) occur after 3 days 30 ℃ of cultivations.With a transconjugant (suc who screens ^sKan ^r) (being the LBP substratum) incubated overnight under non-selection condition, pave plate subsequently and selecting the LBPS nutrient agar, obtain the disappearance of kstD2.To 15 suc ^s/ kan ^rBacterium colony carries out bacterium colony PCR, with kstD2 primer (forward primer [5 ' gcgcatatggctaagaatcaggcaccc] (SEQ ID NO:6)), reverse primer [5 ' gcgggatccctacttctctgctgcgtgatg] (SEQ ID NO:7)), the PCR product that to obtain 4 clip size be 0.6kb wherein comprises kstD2 gene rest parts.Make probe with the kstD2 gene of digoxigenin labeled the chromosomal DNA through 4 mutant of the wild-type chromosomal DNA of Asp718 digestion and acquisition is carried out the Southern engram analysis, confirmed the disappearance of kstD2: the 2.4kb Asp718 dna fragmentation of wild-type is reduced to 1.3kb in mutant strain.

Embodiment 7 Rhodococcus bacterial strain RG8 are to 4-androstene-3, the microorganism 9 'alpha '-hydroxylation effects of 17-diketone

Rhodococcus RG8 is the dual deletion mutant of kstD1 and kstD2, can be the 4-androstene-3 of 10 grams per liters with concentration, and 17-diketone (AD) changes into 9 Alpha-hydroxies-4-androstene-3,17-diketone (9 α OH-AD).

Transform by the following method:

Rhodococcus RG8 is grown in 75 milliliters of aseptic culture mediums (1.5% yeast extract, 1.5% glucose of 250 milliliters of triangular flasks; PH7.0) in, cultivate 24 hours (pre-culture) for last 28 ℃ at gyrate shaker (180 rev/mins).To containing 6 liters of in-situ sterilization fermentation broth (1.5% yeast extract, 1.5% glucose, 0.01% defoamer polypropylene glycol; PH7.5) inoculation pre-culture (1%) in 10 liters of fermentor tanks was cultivated 16 hours for 28 ℃ under the situation of spraying sterile air, stirred substratum to induce the deep layer growth.Add then and contain 60 gram 4-androstenes-3, the suspension of 300 milliliters of poly sorbic esters (0.1%) of 17-diketone.Under the situation of stirring, proceed aerobic cultivation 24 hours for 28 ℃.Sample thief in this process.Before HPLC measures the steroid composition, methyl alcohol (70%) extracting of these samples, and 0.45 micron filter of dead end filters.This process is carried out twice.

As shown in Figure 5, in 15 hours, the 4-androstene-3 of 10 grams per liters, 17-diketone almost all change into 9 Alpha-hydroxies-4-androstene-3,17-diketone (accounting for whole 4-androstenes-3, the 92-96% of 17-diketone).

Sequence table

<110>AKZO?NOBEL?N.V.

＜120〉microorganism 9 'alpha '-hydroxylations of steroid

<130>

<140>

<141>

<160>7

<170>PatentIn?Ver.2.1

<210>1

<211>2398

<212>DNA

＜213〉Rhodococcus (Rhodococcus erythropolis)

<400>1

ggacatgacg?aacccacccc?gagaaggggc?gaggtcacgt?cagtgtcgtg?agagattcac?60

cagaagcagg?tcgcacccct?tgcggatgtc?gtactccgca?tccgggatgg?aaattcgacc?120

gttgaggcac?gattggatga?ccccgaacca?cagctgcatc?agcagacgca?acccggtgtt?180

gtcttcctcg?gtcgggttct?cgatcccggc?cgcatcgagg?atgatctgcc?ggaagccgcg?240

atcgatcttg?cccacgtccg?gcaccgtcgc?gacgttggcg?gtactggacg?actgcagcat?300

cgcagtcgaa?agggccggcc?gacgcagtaa?cccgcgagtc?gcgcgcacca?ggacctcgta?360

cacggcgtcc?tgcggattgg?ccgactgcac?ctgatgcttg?gcgaaactgt?cgccgatctg?420

atcgatctgc?tcgaccatca?cagcgacgaa?gaggtgcgtc?ttcgaaggga?aatagcggta?480

gagagtgccg?atggccacgc?ctgcccgctt?ggcaacttcg?tgcatctgaa?cccgtgagag?540

ttctttctcg?gtccccaatt?cggcggccgc?ttccagcatc?cgcacatggc?gcgcccgctg?600

ctcgtccgaa?ctgggctcag?cagcgtccct?gacctcggca?attctcggca?acgtcgcccc?660

catcatcgat?tatgtgtccc?ggccgcgaac?gaccgcgcta?attctctcac?ctggaccacc?720

catctcggca?tattgcccgc?tcagtgggac?ctggcatggc?cttccagtgc?cgtgcggtat?780

tccgtggaca?ccccaccctc?ttggagtaag?gacgcaatga?tgcaggactg?gaccagcgag?840

tgcgacgtgt?tggtagtcgg?ctccggcggc?ggagcgctga?ccggcgcata?taccgccgct?900

gctcagggat?tgacgacgat?cgtcctcgag?aaaaccgatc?gtttcggcgg?gacctccgcc?960

tactcgggcg?cctcgatctg?gctcccaggt?acccaggtgc?aggaacgcgc?cggacttccc?1020

gactcgaccg?agaatgcccg?cacctatctg?cgcgcgttgc?tcggtgacgc?cgagtccgag?1080

cgccaggacg?cctacgtcga?gaccgctccc?gctgtcgtcg?ctctactcga?gcagaacccg?1140

aacatcgaat?tcgagttccg?tgcgttcccc?gactactaca?aagccgaagg?ccggatggac?1200

acgggacgct?ccatcaaccc?tctcgatctc?gatcccgccg?acatcggtga?cctcgccggc?1260

aaggtgcgtc?cggaactgga?ccaagaccgc?accggtcagg?atcatgctcc?cggcccgatg?1320

atcggtgggc?gcgcactgat?cggccgtctg?ctggccgcag?ttcagagcac?cggtaaggca?1380

gaacttcgca?ccgaatccgt?cctcacctcc?ctgatcgtgg?aagacggccg?tgttgtcggc?1440

gccgaggtcg?aatccggcgg?cgaaacccag?cgaatcaagg?cgaaccgcgg?tgtcctgatg?1500

gcagcaggcg?gcatcgaagg?caacgccgag?atgcgtgagc?aggcaggcac?ccccggcaag?1560

gcgatctgga?gtatgggtcc?cttcggcgcc?aacaccggcg?acgcgatctc?tgccggtatt?1620

gctgtcggcg?gcgcaacagc?cttgctcgat?caggcgtggt?tctgccccgg?cgtcgagcag?1680

cccgacggca?gcgccgcctt?catggtcggc?gttcgcggtg?ggctcgtcgt?cgacagcgcc?1740

ggtgagcgct?acctcaacga?gtcgcttccg?tacgaccagt?tcggacgagc?catggatgct?1800

cacgacgaca?acggttctgc?cgtgccgtcg?ttcatgatct?tcgactcgcg?cgagggtggc?1860

ggactgcccg?ccatctgcat?cccgaacacg?gcgcccgcca?agcacctcga?agccggaacg?1920

tgggtcggtg?ccgacactct?cgaagaactc?gctgccaaga?ccggactacc?ggccgacgca?1980

ttgcgcagca?ctgtcgaaaa?gttcaacgat?gccgcaaaac?tgggcgtcga?cgaagagttc?2040

catcgcggcg?aagacccgta?cgacgcgttc?ttctgcccac?ccaacggcgg?tgcgaatgcg?2100

gcactgacgg?ccatcgagaa?cggaccgttc?tacgcggccc?gcatcgtcct?cagtgacctc?2160

ggcaccaagg?gcggattggt?caccgacgtc?aacggccgag?tcctgcgtgc?tgacggcagc?2220

gccatcgacg?gcctgtacgc?cgccggcaac?acgagcgcgt?cactgagcgg?ccgcttctac?2280

cccggccccg?gagttccact?cggcacggct?atggtcttct?cgtaccgagc?agctcaggac?2340

atggcgaagt?aacgcagttc?aatcacactc?cgtggaaaca?gatcgtgggg?cagccgat 2398

<210>2

<211>39

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: degeneracy probe

<400>2

ttcggsggsa?cstcsgcsta?ctcsggsgcs?tcsatctgg 39

<210>3

<211>30

<212>DNA

＜213〉Rhodococcus

<400>3

gcgcatatgc?aggactggac?cagcgagtgc 30

<210>4

<211>30

<212>DNA

＜213〉Rhodococcus

<400>4

gcgggatccg?cgttacttcg?ccatgtcctg 30

<210>5

<211>1698

<212>DNA

＜213〉Rhodococcus

<400>5

atggctaaga?atcaggcacc?ccccgcgaca?caagccaagg?acatcgttgt?cgatctattg?60

gtgatcgggt?ccggtaccgg?catggctgcc?gctctcaccg?cgaacgaact?cggcttgtcc?120

acgctgatcg?tggagaagac?gcagtacgtc?ggcggttcga?cggcgcggtc?cggtggggcg?180

ttctggatgc?ctgccaaccc?gatcttggcg?aaagccggtg?cgggcgacac?cgttgagcga?240

gcgaagacat?acgtgcgttc?ggtggtcggt?gatactgccc?ctgcccaacg?aggagaagca?300

ttcgtcgaca?acggtgcggc?cactgtcgac?atgctctacc?gcacgacgcc?catgaagttc?360

ttctgggcca?aggaatactc?cgattaccac?cccgaactgc?cgggcggtag?cgccgccgga?420

cgtacctgcg?agtgcctgcc?gttcgacgcg?tcggtactgg?gagcggaacg?cggtcgcctg?480

cgcccaggtt?tgatggaagc?cggactgccg?atgccggtga?cgggtgcgga?ttacaagtgg?540

atgaacctga?tggtgaagaa?gccgagcaag?gcttttcccc?gcatcatccg?ccgcctggcg?600

caaggcgttt?acggcaagta?cgtcctcaag?cgtgaataca?tcgcgggcgg?tcaggcgctc?660

gccgccggac?tgttcgccgg?tgtggtccag?gccggtatcc?cggtgtggac?ggaaacgtcg?720

ttggttcggc?tcatcaccga?agatggccgc?gtaacgggtg?cagttgtggt?gcaagacgga?780

cgtgaagtga?cggtgaccgc?tcggcgcggt?gtcgtcctgg?cagccggcgg?gttcgaccac?840

aacatggagt?ggcgccacaa?gtaccagtcg?gagagcctcg?gtgagcatga?gagcctgggc?900

gcagagggca?acaccggcga?agcgatcgag?gcagcacaag?agctcggtgc?aggtatcgga?960

tcgatggatc?agtcctggtg?gttccccgcg?gtggcaagca?tcaagggccg?cccgccgatg?1020

gtgatgctcg?cagagcgtgc?gctgcccggc?tctttcatcg?tcgaccagac?cggtcgtcga?1080

ttcgtgaacg?aggcgacgga?ctacatgtcg?ttcggccagc?gcgtgctcga?acgggaaaag?1140

gctggcgatc?cggccgagtc?gatgtggttt?gttttcgacc?aggagtaccg?caacagctac?1200

gtgttcgcag?gcggtatctt?cccccgtcag?ccccttccgc?aggcattctt?cgagtccggc?1260

atcgcgcacc?aggcgagcag?tccggccgaa?ctcgcccgca?aggtcggtct?ccccgaggat?1320

gcgtttgccg?agtccttcca?gaagttcaac?gaggccgctg?ctgcaggtag?cgatgcggag?1380

ttcggtcgcg?gcggcagcgc?atacgatcgg?tactacggcg?acccgacagt?gtctccgaac?1440

ccgaatctgc?gccagctcga?caagagcgcc?ctctatgcgg?tgaagatgac?gctcagcgac?1500

ctgggcatct?gcggcggtgt?gcaggcggac?gagaatgcac?gcgtgcttcg?tgaggacggc?1560

agcgtcatcg?acggcctgta?cgcgatcggc?aataccgcgg?ccaacgcatt?cggtcacacc?1620

tacccaggcg?ccggcgcgac?gatcggccag?gggctggttt?acggatacat?cgcggcccat?1680

cacgcagcag?agaagtag 1698

<210>6

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: forward primer

<400>6

gcgcatatgg?ctaagaatca?ggcaccc 27

<210>7

<211>30

<212>DNA

＜213〉artificial sequence

<220>

＜223〉artificial sequence description: reverse primer

<400>7

gcgggatccc?tacttctctg?ctgcgtgatg 30

Claims

1. the method that make up to lack the genetically modified bacterial strain of the steroid degraded microorganism of ability of degraded steroid nuclear, described steroid degraded microorganism is selected from Rhod (Rhodococcus), Nocardia (Nocarida), Mycobacterium (Mycobacterium) and genus arthrobacter (Arthrobacter), this method comprises the steroid dehydrogenase gene inactivation that makes the degraded of a plurality of participation steroid nuclear, wherein by unmarked genetically deficient with first genetically deficient, first gene that is lacked is steroid dehydrogenase gene kstD1 or kstD2.

2. according to the process of claim 1 wherein that any follow-up gene is by the ultraviolet radiation inactivation.

3. according to the method for claim 1 or 2, wherein any follow-up gene is by unmarked genetically deficient.

4. according to the process of claim 1 wherein that second gene lacks by unmarked genetically deficient.

5. according to the method for claim 1-4, wherein said microorganism is Rhod (Rhodococcus).

6. according to the method for claim 1-5, wherein said microorganism is Rhodococcus (R.erythopolis).

7. according to the microorganism of the method for claim 1-6 preparation.

8. according to the microorganism of claim 7, wherein at least kstD1 and kstD2 the two all by inactivation.

9. genetically modified bacterial strain Rhodococcus RG1-UV29.

10. the microorganism according to claim 7-9 is used for containing 4-androstene-3 by described microorganism, growing and preparing 9 Alpha-hydroxies on the substratum of 17-diketone-4-androstene-3, the purposes of 17-diketone.

11. coding is by the coded proteic nucleotide sequence of KSTD1 of the Nucleotide 820-2329 of SEQ ID NO:1.

12. coding is by the coded proteic nucleotide sequence of KSTD2 of the Nucleotide 1-1678 of SEQ ID NO:5.