PL233839B1 - Method and a kit for identification of nematodes, pests of grains and grasses, by Real Time PCR based method - Google Patents

Abstract

A method and kit for identifying nematodes, cereal and grass pests using the Real Time PCR method are disclosed. In particular, the invention relates to a method and kit for identifying nematodes including the species Anguina tritici, Bitylenchus dubius and Helicotylenchus varicaudatus. Thanks to specifically selected primers and probes, the solution enables precise identification of selected nematode species regardless of the type of samples tested, their origin and purpose, and the stage of development.

Description

The subject of the invention is a method and a kit for the identification of nematodes, pests of cereals and grasses by Real Time PCR, and in particular the invention relates to a method and kit for the identification of nematodes selected from the group consisting of Anguina tritici species from the Anguinidae family, Bitylenchus dubius from the Telotylenchidae family, Helicotylenchus varicaudatus from the Hoplolaimidae family.

Identification of nematode species is based on the analysis of morphological and morphometric features, including the diagnosis of female coloration at various stages of development, cyst shape, length and shape of dagger tumors, length of invasive larvae, pattern on the perineal plate. However, this is a very laborious and time-consuming analysis. It requires a lot of knowledge and experience in working with biological material. Moreover, there is the possibility of overlapping dimensions of different species. The method based on the analysis of morphological and morphometric features cannot be used to identify adolescents in which morphological features are not yet developed.

Currently, techniques based on the analysis of nucleic acids, including the polymerase chain reaction (PCR), are increasingly used in nematological diagnostics. The basis of the PCR technique is the amplification of a DNA fragment (s) specific for a specific organism to a level that allows for its quick and simple detection using electrophoresis. This is achieved by using short single-stranded oligonucleotides (12-40 nucleotides), the so-called primers, specific for the amplified DNA fragment, and the enzyme - thermostable polymerase, which enables the amplification of the desired fragment in a cyclic, three-step reaction consisting of denaturation, primer binding and DNA synthesis. Typically, after about 30 reaction cycles, more than a million copies of the amplified DNA fragment are obtained, which can be identified by gel electrophoresis.

An improvement on the polymerase chain reaction is Real Time PCR, that is, a PCR reaction with the measurement of the amount of amplified fragment in each reaction cycle. To measure the amount of the amplified fragment, fluorochromes (fluorescent dyes) are used, e.g. SYBR Green I, SYTO9, Eva Green, SYBR Gold, whose fluorescence is proportional to the amount of the amplified fragment. Identification of the resulting products is carried out by measuring the amount of fluorescence and analyzing the melting curve of the reaction products without electrophoresis. The sensitivity of Real Time PCR is much higher than that of traditional PCR, and the lack of electrophoresis shortens the analysis time. The disadvantage of Real Time PCR with fluorescent dyes (similar to traditional PCR) is the limited specificity of the reaction. In most cases, the PCR reaction occurs not only when the primer sequence is 100% identical to the template sequence, but also when 1-2 nucleotides are not identical. This property of traditional PCR and Real Time PCR with fluorescent dyes requires precise setting of the thermal parameters of the reaction. Moreover, fluorescent dyes bind to each double-stranded DNA fragment, also resulting from primer amplification (primer-primer, primer-dimer products), which also requires careful selection of the appropriate concentration of primers.

An alternative to fluorescent dyes are fluorescently labeled DNA probes. These are short sections of DNA, complementary to the searched sequence, which, when attached to DNA during PCR reactions, emit fluorescence at a specific wavelength. Currently, several types of probes are known, e.g. TaqMan, FRET, molecular beacons or scorpions. The specificity of the Real Time PCR reaction with labeled probes is much higher than with fluorescent dyes. Unlike primers, a single nucleotide mismatch in the probe sequence usually leads to no reaction or a very significant reduction in yield, which is easy to see when monitoring the course of the reaction or analyzing the results of the reaction.

Until now, the most frequently used method of molecular identification of nematodes was PCR-RFLP (Restriction Fragments Length Polymorphism). The restriction fragment length polymorphism method uses restriction enzymes that cut the DNA strand at a specific site for itself. Differences in the length of the cut DNA fragments indicate variability. Powers T.O., Szalanski A.L., Mullin P.G., Harris T.S., Bertoldi T., and Griesbach J.A. Identification of Seed Gall Nematodes of Agronomic and Regulatory Concern with PCR-RFLP of ITS11. Journal of Nematology 33 (4): 191-194. 2001 analyzed 18 populations belonging to the genus Anguina with this method. For identification, they used seven restriction enzymes Alu I, Bsr I, Eco RI, Hae III, Hha I, Hinf I and Taq I, which allowed them to identify the species.

Cbjvh Umarao, Sharma Amita, Rao S.B. in his 2009 publication RAPD-PCR Analysis of Genetic Similarity Between Males and Females of Anguina tritici. Indian Journal of Nematology, 2009

PL 233 839 Β1

39 (1): 90-97 used the RAPD method - Randomly Amplified Polymorphic DNA (method of random amplification of polymorphic DNA). This method uses only one short (about 10-20 nucleotides) primer, runs at a lower temperature (about 35 ° C), but at the same time requires an increased number of cycles compared to standard PCR - as much as 40-50. As a result of electrophoretic analysis, bands of various lengths are obtained, the arrangement of which is characteristic for an individual and is something like a fingerprint.

In the works of Wendt K.R., Vrain T.C. & Webster J.M. (1993). Separation of three species of Ditylenchus and some host races of D. dipsaci by restriction fragment length polymorphism. Journal of Nematology 25, 555-563 and Marek M., Zouhar M., Rysanek P. & Havranek P. (2005). Analysis of ITS sequences of nuclear rDNA and development of a PCR-based assay for the rapid identification of the stem nematode Ditylenchus dipsaci (Nematoda: Anguinidae) in plant tissues. Helminthology 42, 49-56, primers and restriction enzymes for the identification of Ditylenchus dipsaci have been described.

Identification primers / 7. varicaudatus was described by Schrek-Reis in 2010, Schreck Reis C., Vieira Dos Santos M.C., Marais M., Santos M.S., Duyts H., Freitas H., Van Der Putten W., Abrantes I.M. 2010. First record of Helicotylenchus varicaudatus Yuen, 1964 (Nematoda: Hoplolaimidae) parasitizing Ammophila arenaria (L.) in Portuguese coastal sand dunes. Phytopathol. Mediterr. 49: 212-226. Identification of B. dubius is still based on morphological features.

In the state of the art, there is still a need to provide a tool enabling the detection of selected nematode species that are not genetically identified, as well as an improved method of identifying those nematode species that are detected by known genetic techniques, but do not ensure high precision and do not exclude errors in analysis.

The object of the invention is to provide a method that allows the identification of nematode species with high sensitivity and specificity. The aim of the invention is also to provide a method for the identification of nematodes which have not been detected so far by methods of analyzing the genetic material of the species tested. It is also an object of the invention to provide new nucleotide sequences of primers and probes or a non-obvious selection of known sequences and probes, applicable in the method of detecting nematodes by PCR, especially Real-Time PCR, regardless of the type of test, their origin and purpose, and the stage of development.

The above objectives have been achieved in the present invention.

The subject of the invention is a method of identifying nematodes in a soil sample selected from the group consisting of species Anguina tritici, Bitylenchus dubius, Helicotylenchus varicaudatus, comprising the following steps:

1) providing a soil sample containing nematodes for identification;

2) rinsing the nematodes from the soil;

3) DNA isolation;

4) performing PCR reactions, especially Real-Time PCR, using a pair of 3 'and 5' primers and a probe;

5) comparison of the amplification curve of the tested sample with the amplification curves of the blank sample and the negative control, with the identification of one of the above species of nematodes in the PCR reaction, especially Real-Time PCR, with the use of 3 'and 5' primers appropriate for a given species and a selected probe from the list:

5 'starter 3 * starter Probe

Type

Name Sequence Name Sequence Name Sequence Anguina tritici Atrifv tgctgtgtttgaatgttag Atrirv gtcggatagatgaccaac Atri aatccgcaccagcaacctac Bitylenchus dubius Bdufv actggatggtaaggcatg Bdurv cagcttttacaccgagga Bdu caagaccgaactagccactgg Helicotylenchus varicaudatus Hvafv tgctgaccgagataatgg Hvarv gccaaatgctttagctgta Hva ttacctctcacgcagcaatacg

The subject of the invention is also a kit for the identification of nematodes selected from the group consisting of Anguina tritici, Bitylenchus dubius, Helicotylenchus varicaudatus species, by PCR, especially Real-Time PCR, containing species-specific 3 'and 5' primers and a probe selected from the list:

PL 233 839 Β1

5 'starter 3' starter Poll

Type

Name Sequence Name Sequence Name Sequence Anguina tritici Atrifv tgctgtgtttgaatgttag Atrirv gtcggatagatgaccaac Atri aatccgcaccagcaacctac Bitylenchus dubius Bdufv actggatggtaaggcatg Bdurv cagcttttacaccgagga Bdu caagaccgaactagccactgg Helicotylenchus varicaudatus Hvafv tgctgaccgagataatgg Hvarv gccaaatgctttagctgta Hva ttacctctcacgcagcaatacg Mixture reactionary contains a buffer, thermostable Taq polymerase, ions magnesium, starters

and a probe. The concentration of primers in the reaction mixture is 1-2 μM, probes 50-100 nM, magnesium ions 2-5 mM. The reaction is carried out at an annealing temperature of the primers of 55-60 ° C, in a volume of the reaction mixture of 10-20 µΙ, using 35 to 40 reaction cycles. Product identification is accomplished by comparing the amplification curves of the test sample with the amplification curves of the blank.

The names of the primer and probe sequences correspond to the sequential sequence numbers: Atrifv (SEQ ID NO: 1), Atrirv (SEQ ID NO: 2), Atri (SEQ ID NO: 3), Bdufv (SEQ ID NO: 4), Bdurv (SEQ ID NO: 5), Bdu (SEQ ID NO: 6), Hvafv (SEQ ID NO: 7), Hvarv (SEQ ID NO: 8), Hva (SEQ ID NO: 9).

Fig. 1 shows the amplification curves for Anguina tritici.

Fig. 2 shows the amplification curves for Bitylenchus dubius.

Fig. 3 shows the amplification curves for Helicotylenchus varicaudatus.

Examples of identifying each of the nematode species included in the set are given below. In each case, the same isolation and amplification conditions were applied to the blank (deionized H2O free from nuclease) and the negative sample. The material for the negative sample was DNA of a nematode species belonging to the same genus as the tested species, a mixture of equal amounts of nematode DNA belonging to the same species as the tested species, or in the absence of species belonging to the same genus, a species from the same family.

Example 1

Identification of nematodes of the species Anguina tritici

DNA was isolated using Macherey-Nagel's commercial NucleoSpin Tissue XS DNA isolation kits. The reaction used primers and probes with the following sequences:

Starter / probe Sequence Atrifv tgctgtgtttgaatgttag Atrirv gtcggatagatgaccaac Atri aatccgcaccagcaacctac

The Real Time PCR reaction was performed in a 20 μΙ mixture in a Qiagen RotorGene 6000 apparatus using reagents from the LuminoCt qPCR ReadyMix kit (Sigma-Aldrich) in the following amounts:

- Nuclease-free H2O up to a volume of 20 μΙ,

- 2 μ110.0 μΜ of each Atrifv and Atrirv primers,

- 1 μΙ 4.0 μΜ Atri probe labeled at the 5 'end with JOE dye, and at the 3' end with HBQ1 quencher,

- 10 μΙ 2X LuminoCt qPCR ReadyMix (Sigma-Aldrich),

- 2 μΙ DNA.

The reaction mixture was placed in a 20 μΙ tube, placed in the rotor of a RotorGene 6000 thermal cycler, and the amplification reaction was performed for 40 cycles under the following conditions:

PL 233 839 Β1

Stage Temperature [ ^C C] Time [s] Fluorescence measurement Pre-incubation 95 180 - Amplification denaturation 95 thirty - connecting 55 thirty single synthesis 72 thirty Cooling 40 twenty -

The negative control was a mixture of equal volumes of DNA solutions: Ditylenchus destructor, Ditylenchus dipsaci (2 μΙ DNA).

The amplification curves obtained from the performed analysis are shown in Fig. 1

Example 2

Identification of the nematodes of the species Bitylenchus dubius

The isolation and amplification conditions were as set out in Example 1. The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Bdufv actggatggtaaggcatg Bdurv cagcttttacaccgagga Bdu caagaccgaactagccactgg

The negative control was a mixture of equal volumes of DNA solutions: Bitylenchus bryobius, Bitylenchus parvus.

The amplification curves obtained from the performed analysis are shown in Fig. 2.

Example 3

Identification of the nematodes of the species Helicotylenchus yaricaudatus

The isolation and amplification conditions were as set out in Example 1. The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Hvafv tgctgaccgagataatgg Hvarv gccaaatgctttagctgta Hva ttacctctcacgcagcaatacg

The negative control was a mixture of equal volumes of DNA solutions: Helicotylenchus exallus, Helicotylenchus pseudorobustus, Helicotylenchus yulgaris. The amplification curves obtained from the performed analysis are presented in Fig. 3.

The solution according to the invention allows the detection of nematodes in soil within a few hours, including the stages of sample preparation, DNA isolation and Real-Time PCR. The method according to the invention can be used to identify the abovementioned species of nematodes irrespective of the type of test, their origin and destination, and the stage of development.

The proposed set of probes enables the identification of the above-mentioned species of nematodes in the Real Time PCR reaction, which is much more sensitive and faster than other PCR methods. The use of probes in the Real Time PCR reaction significantly increases the specificity of the reaction in relation to the Real Time PCR reaction with fluorescent dyes.

Claims (2)

1. A method of identifying the species of nematodes Anguina tritici, Bitylenchus dubius and Helicotylenchus vańcaudatus in a soil sample, comprising the following steps: (a) providing a soil sample containing nematodes for identification; b) rinsing the nematodes from the soil; c) DNA isolation; d) performing a Real-Time PCR reaction using a 3 'and 5' primer pair and probe; e) comparison of the amplification curve of the tested sample with the amplification curves of the blank sample and the negative control, with the identification of one of the above species in Real-Time PCR using species-specific 3 'and 5' primers and probes selected from the list: Type 5 'starter 3 'starter Probe Sequence Name Sequence Name Sequence Name Anguino tritici Atrifv tgctgtgtttgaatgttag Atrirv gtcggatagatgaccaac Atri aatccgcaccagcaacctac Bitylenchus dubius Bdufv actggatggtaaggcatg Bdun? cagcttttacaccgagga Bdu caagaccgaactagccactgg Helicotylenchus yaricaudatus Hvafv tgctgaccgagataatgg Hvarv gccaaatgctnagctgta Hva rtacctctcacgcagcaatacg 2. Set for the identification of the species of nematodes Anguina tritici, Bitylenchus dubius and Helicotylenchus varicaudatus using the Real-Time PCR method, containing species-specific 3 'and 5' primers and probes selected from the list: S 'starter 3' probe starter Type Name Sequence Name Sequence Name Sequence Anguino tritici Atrifv tgctgtgtttgaatgttag Atrirv gtcggatagatgaccaac Atri aatccgcaccagcaacctac Bitylenchus dubius Bdufv actggatggtaaggcatg Bdurv cigcttttacaccgagga Bdu caagaccgaactagccactgg Helicotylenchus varicaudotus Hvafv tgctgaccgagataatgg Hvarv gccaaatgctnagctgta Hva ttacctctcacgcagcaatacg PL 233 839 Β1