PL233893B1 - Method and a kit for identification of Heterodera goettingiana nematode, important farm plants pest, by the Real Time PCR based method - Google Patents

Abstract

The subject of the application is a method and kit for identifying the nematode Heterodera goettingiana, a pest of crop plants, using the Real Time PCR method. Thanks to specifically selected primers and probes, this solution enables precise identification of selected nematode species regardless of the type of samples tested, their origin and purpose, and the stage of development.

Description

Description of the invention

The present invention relates to a method and a kit for identifying the Heterodera goettingiana nematode by Real Time PCR.

According to the latest classification, the Heteroderidae family is represented in Poland by 17 species. Heterodera goettingiana is an important pest of crops. Infected plants have a damaged root system, and reduced water uptake leads to their dieback. The ground part of the infected plant turns yellow, and the tubers are smaller, covered with brown spots, which reduces their commercial value,

Identification of nematode species is based on the analysis of morphological and morphometric features, including the diagnosis of female coloration at various stages of development, cyst shape, length and shape of dagger tumors, length of invasive larvae, pattern on the perineal plate. However, this is a very laborious and time-consuming analysis. It requires a lot of knowledge and experience in working with biological material. Moreover, there is the possibility of overlapping dimensions of different species. The method based on the analysis of morphological and morphometric features cannot be used to identify adolescents in which morphological features are not yet developed.

Currently, techniques based on the analysis of nucleic acids, including the polymerase chain reaction (PCR), are increasingly used in nematological diagnostics. The basis of the PCR technique is the amplification of a DNA fragment (s) specific for a specific organism to a level that allows for its quick and simple detection using electrophoresis. This is achieved by using short single-stranded oligonucleotides (12-40 nucleotides), the so-called primers, specific for the amplified DNA fragment, and the enzyme - thermostable polymerase, which enables the amplification of the desired fragment in a cyclic, three-step reaction consisting of denaturation, primer binding and DNA synthesis. Typically, after about 30 reaction cycles, more than a million copies of the amplified DNA fragment are obtained, which can be identified by gel electrophoresis.

An improvement on the polymerase chain reaction is Real Time PCR, that is, a PCR reaction with the measurement of the amount of amplified fragment in each reaction cycle. To measure the amount of the amplified fragment, fluorochromes (fluorescent dyes) are used, e.g. SYBR Green I, SYTO9, Eva Green, SYBR Gold, the fluorescence of which is proportional to the amount of the amplified fragment. Identification of the resulting products is carried out by measuring the amount of fluorescence and analyzing the melting curve of the reaction products without electrophoresis. The sensitivity of Real Time PCR is much higher than that of traditional PCR, and the lack of electrophoresis shortens the analysis time. The disadvantage of Real Time PCR with fluorescent dyes (similar to traditional PCR) is the limited specificity of the reaction. In most cases, the PCR reaction occurs not only when the primer sequence is 100% identical to the template sequence but also when 1-2 nucleotides are non-identical. This property of traditional PCR and Real Time PCR with fluorescent dyes requires precise setting of the thermal parameters of the reaction. Moreover, fluorescent dyes bind to each double-stranded DNA fragment, also resulting from primer amplification (primer-primer, primer-dimer products), which also requires careful selection of the appropriate concentration of primers. An alternative to fluorescent dyes are fluorescently labeled DNA probes. These are short sections of DNA, complementary to the searched sequence, which, when attached to DNA during PCR reactions, emit fluorescence at a specific wavelength. Currently, several types of probes are known, e.g. TaqMan, FRET, molecular beacons, and scorpions. The specificity of the Real Time PCR reaction with labeled probes is much higher than with fluorescent dyes. Unlike primers, a single nucleotide mismatch in the probe sequence usually leads to no reaction or a very significant reduction in yield, which is easy to see when monitoring the course of the reaction or analyzing the results of the reaction.

Until now, the most frequently used method of molecular identification of nematodes was PCR-RFLP (Restriction Fragments Length Polymorphism). The restriction fragment length polymorphism method uses restriction enzymes that cut the DNA strand at a specific site for itself. Differences in the length of the cut DNA fragments indicate variability. Amiri S., Subbotin SA and Moens M., Identification of the beet cyst nematode Heterodera schachtii by PCR, European Journal of Plant Pathology (2002), 108: 497-506 analyzed a total of almost 60 cyst-forming nematodes using this method, which allowed them to select the appropriate restriction enzymes for the identification of H. schachtii, H.betae and H. trifolii. Subbotin S. A., Waeyenberge L. and Moens M. used in their publication Identification of cyst forming nematodes of the genus Heterodera (Nematoda: Heteroderidae) based on the ribosomal

PL 233 893 Β1

DNA-RFLP, Nematology (2000), 2 (2): 153-164 as many as 26 different restriction enzymes: Alul, Aval, BamHI, Bgll, BsiZI, BsuRI, Bsh1236I, Bsp143I, Cfol, Ddel, EcoRI, Hpall, Hindlll, Hinfl , KpnI, Mval, Pstl, PvuII, Psal, Sali, Stul, Sspl, ScrFI, Taql, Tru9I, and Xbal, thus distinguishing 27 different species and types of nematodes in the sample, including H.carotae, H, cruciferae, Heterodera humuli and Heterodera schachtii. Madani, M; Vovlas, N; Castillo, P; Subbotin, SA, Moens, M. 2004. Molecular characterization of cyst nematode species (Heterodera spp.) From the Mediterranean Basin using RFLPs and sequences of ITS-rDNA. Journal of phytopathology 152 (4): 229-234 describe the identification of Heteroder goettingian by PCR-RFLP.

The latest approach to molecular identification of nematodes is based on real-time polymerase chain reaction. Madani M., Subbotin SA and Moens M. in Quantitative detection of the potato cyst nematode, Globodera pallida, and the beet cyst nematode, Heterodera schachtii, using Real-Time PCR with SYBR green I dye, Molecular and Cellular Probes (2005), 19: 81-86 used specific primers and the fluorescent dye SYBR Green I to quickly identify species. They used a mix of primers described in previous publications -0.1 μΜ of each primer: SH6Mod 5'-CGT GTT CTT ACG TTA CTT CAA-3 ' , SH4 5'-AGC ATG CGA AGG ATT GG-3% PITSp4 5'-ACA ACA GCA ATC GTC GAG-3 'and Pal3 5'-ATG TTT GGG CTG GCA C-3', 12 μΙ dye and 4 μΙ sample DNA in a total final volume of 25 μΙ.

The aim of the invention is to provide a method for the identification of Heterodera goettingiana with high sensitivity and specificity, and to provide new nucleotide sequences of primers and probes, applicable in the method of detecting nematodes by PCR, especially Real Time PCR, regardless of the type of test, their origin and purpose and stage of development. The above objectives have been achieved in the present invention.

The present invention relates to a method of identifying the nematode Heterodera goettingiana in a soil sample, comprising the following steps:

(a) providing a soil sample containing nematodes for identification;

b) rinsing the nematodes from the soil;

c) DNA isolation;

d) performing a PCR reaction, in particular Real-Time PCR, using a pair of 3 'and 5' primers and a probe;

e) comparison of the amplification curve of the tested sample with the amplification curves of the blank sample and the negative control, where for species identification in PCR, especially Real-Time PCR, primers 3 'and 5' and a probe appropriate for a given species are used:

Type 5 'starter 3 'starter Probe Name Sequence Name Sequence Name Sequence Heterodera goellinRuifia Hetgofv GGGTGTATGTGTG TGATG Hetgorc CGAGAACATGCA ATGAGA Hetgos CCGAACTAACTGCTG GTACG

The subject of the invention is also a kit for the identification of Heterodera goettingian by the PĆR method, especially Real Time PCR, containing species-specific primers 3 'and 5' and a probe:

Type 5 'starter 3 'starter Probe Name Sequence Name Sequence Name Sequence Heterodera goettingiana Hetgofv GGGTGTATGTGTG TGATG Hetgorv CGAGAACATGCA ATGAGA Hctgos CCGAACTAACTGCTG GTACG

The reaction mixture contains a buffer, a thermostable Taq polymerase, magnesium ions, primers and a probe. The concentration of primers in the reaction mixture is 1-2 μM, probes 50-100 nM, magnesium ions 2-5 mM. The reaction is carried out at an annealing temperature of the primers of 55-60 ° C, in a volume of the reaction mixture of 10-20 µΙ, using 35 to 40 reaction cycles. Product identification is accomplished by comparing the amplification curves of the test sample with the amplification curves of the blank.

An example of the identification of a Heteroder goettingian is given below. In each case, the same isolation and amplification conditions were applied to the blank (deionized H2O free from nuclease) and the negative sample. The material for the negative sample was DNA of a nematode species belonging to the same genus as the test.

PL 233 893 Β1

Example

Identification of the nematode of the species Heterodera goettingiana

DNA was isolated using Macherey-Nagel's commercial NucleoSpin Tissue XS DNA isolation kits. The reaction used primers and probes with the following sequences:

Starter / probe Sequence Hetgofv GGGTGTATGTGTGTGATG Hetgorv CGAGAACATGCAATGAGA Hetgos CCGAACTAACTGCTGGTACG

The Real Time PCR reaction was performed in a 20 μΙ mixture in a Qiagen RotorGene 6000 apparatus using reagents from the LuminoCt qPCR ReadyMix kit (Sigma-Aldrich) in the following amounts:

- Nuclease-free H2O up to a volume of 20 μΙ,

- 2 μ110.0 μΜ of each of the Hetgofv and Hetgorv primers,

- 1 μΙ 4.0 μΜ of the Hetgos probe labeled at the 5 'end with JOE dye, and the 3' end with HBQ1 quencher,

- 10 μΙ 2X LuminoCt qPCR ReadyMix (Sigma-Aldrich),

- 2μϋΝΑ.

The reaction mixture was placed in a 20 μΙ tube, placed in the rotor of a RotorGene 6000 thermal cycler, and the amplification reaction was performed for 40 cycles under the following conditions:

Stage Temperature [° C] Time [s] Fluorescence measurement Pre-incubation 95 180 - Amplification denaturation 95 thirty - connecting 55 thirty single synthesis 72 thirty - Cooling 40 twenty

DNA from the nematode Heterodera schachtii was a negative control.

The amplification curves obtained as a result of the performed analysis are presented in Fig. 1.

The solution according to the invention allows the detection of the nematode Heterodera goettingiana in soil within a few hours, including the stages of sample preparation, DNA isolation and Real-Time PCR. The method according to the invention can be used to identify the above-mentioned species regardless of the type of test samples, their origin and destination, and the stage of development.

The proposed set of primers and probes allows the identification of the above-mentioned species of nematode in the Real Time PCR reaction, which is much more sensitive and faster than other PCR methods. The use of a probe in the Real Time PCR reaction significantly increases the specificity of the reaction in relation to the Real Time PCR reaction with fluorescent dyes.

Primer and probe sequence listing

Starter / probe no. Name Sequence

No. Hetgoft · GGGTGTATGTGTGTGATG No. 2 Hctgorv CGAGAACATGCAATGAGA No. 3 Hetgos CCGAACTAACTGCTGGTACG

PL 233 893 B1

Claims (2)

Patent claims 1. A method of identifying the nematode Heterodera goettingiana in a soil sample comprising the following steps: (a) providing a soil sample containing nematodes for identification b) rinsing the nematodes from the soil; c) DNA isolation; d) performing a PCR reaction, in particular Real-Time PCR, using a pair of 3 'and 5' primers and a probe; e) comparison of the amplification curve of the test sample with the amplification curves of the blank sample and the negative control, characterized in that for the identification of the species Heterodera goettingiana in PCR, especially Real-Time PCR, primers appropriate for a given species are used 5 '(No. 1) and 3 '(No.2) and probe No.3. 2. Set for the identification of the nematode Heterodera goettingiana, by PCR, especially Real-Time PCR, containing primers 5 '(No. 1) and 3' (No. 2) appropriate for a given species and probe No. 3.