PL233894B1 - Method and a kit for identification of Merlinius microdorus nematode, pest of grains and grasses, by Real Time PCR based method - Google Patents

Abstract

The subject of the application is a method and kit for identifying the nematode Merlinius microdorus, a pest of cereals and grass, using the Real Time PCR method. Thanks to specifically selected primers and probes, this solution enables precise identification of the indicated nematode species regardless of the type of samples tested, their origin and purpose, and the stage of development.

Description

Description of the invention

The subject of the invention is a method and a kit for the identification of Merlinius microdorus, a pest of cereals and grasses, by the Real Time PCR method.

Identification of nematode species is based on the analysis of morphological and morphometric features, including the diagnosis of female coloration at various stages of development, cyst shape, length and shape of dagger tumors, length of invasive larvae, pattern on the perineal plate. However, this is a very laborious and time-consuming analysis. It requires a lot of knowledge and experience in working with biological material. Moreover, there is the possibility of overlapping dimensions of different species. The method based on the analysis of morphological and morphometric features cannot be used to identify adolescents in which morphological features are not yet developed.

Currently, techniques based on the analysis of nucleic acids, including the polymerase chain reaction (PCR), are increasingly used in nematological diagnostics. The basis of the PCR technique is the amplification of DNA fragments specific for a specific organism to a level that allows for its quick and simple detection using electrophoresis. This is achieved by using short single-stranded oligonucleotides (12-40 nucleotides), the so-called primers, specific for the amplified DNA fragment, and the enzyme - thermostable polymerase, which enables the amplification of the desired fragment in a cyclic, three-step reaction consisting of denaturation, primer binding and DNA synthesis. Typically, after about 30 reaction cycles, more than a million copies of the amplified DNA fragment are obtained, which can be identified by gel electrophoresis.

An improvement on the polymerase chain reaction is Real Time PCR, that is, a PCR reaction with the measurement of the amount of amplified fragment in each reaction cycle. To measure the amount of the amplified fragment, fluorochromes (fluorescent dyes) are used, e.g. SYBR Green I, SYTO9, Eva Green, SYBR Gold, the fluorescence of which is proportional to the amount of the amplified fragment. Identification of the resulting products is carried out by measuring the amount of fluorescence and analyzing the melting curve of the reaction products without electrophoresis. The sensitivity of Real Time PCR is much higher than that of traditional PCR, and the lack of electrophoresis shortens the analysis time. The disadvantage of Real Time PCR with fluorescent dyes (similar to traditional PCR) is the limited specificity of the reaction. In most cases, the PCR reaction occurs not only when the primer sequence is 100% identical to the template sequence but also when 1-2 nucleotides are non-identical. This property of traditional PCR and Real Time PCR with fluorescent dyes requires precise setting of the thermal parameters of the reaction. Moreover, fluorescent dyes bind to each double-stranded DNA fragment, also resulting from primer amplification (primer-primer, primer-dimer products), which also requires careful selection of the appropriate concentration of primers.

An alternative to fluorescent dyes are fluorescently labeled DNA probes. These are short sections of DNA, complementary to the searched sequence, which, when attached to DNA during PCR reactions, emit fluorescence at a specific wavelength. Currently, several types of probes are known, e.g. TaqMan, FRET, molecular beacons, and scorpions. The specificity of the Real Time PCR reaction with labeled probes is much higher than with fluorescent dyes. Unlike primers, a single nucleotide mismatch in the probe sequence usually leads to no reaction or a very significant reduction in yield, which is easy to see when monitoring the course of the reaction or analyzing the results of the reaction.

Until now, the most frequently used method of molecular identification of nematodes was PCR-RFLP (Restriction Fragments Length Polymorphism). The restriction fragment length polymorphism method uses restriction enzymes that cut the DNA strand at a specific site for itself. Differences in the length of the cut DNA fragments indicate variability. Powers T O, Szalanski AL, Mullin PG, Harris TS, Bertoldi T and Griesbach JA. Identification of Seed Gall Nematodes of Agronomic and Regulatory Concern with PCR-RFLP of ITS11. Journal of Nematology 33 (4): 191-194. 2001 analyzed 18 populations belonging to the genus Anguina with this method. They used seven restriction enzymes Alu J, Bsr I, Eco RI, Hae III, Hha I, Hinf I, and Taq I for identification, thanks to which they were able to identify the species.

Cbjvh Umarao. Sharma Amita, Rao S.B. in his 2009 publication RAPD-PCR Analysis of Genetic Similarity Between Males and Females of Anguina tritici. Indian Journal of Nematology, 2009 39 (1): 90-97 used the RAPD method - Randomly Amplified Polymorphic DNA (a method of random amplification of polymorphic DNA).

PL 233 894 Β1

This method uses only one short (about 10-20 nucleotides) primer, runs at a lower temperature (about 35 ° C), but at the same time requires an increased number of cycles compared to standard PCR - as much as 40-50. As a result of electrophoretic analysis, bands of various lengths are obtained, the arrangement of which is characteristic for an individual and is something like a fingerprint.

In the works of Wendt KR, Vrain TC & Webster JM (1993). Separation of three species of Ditylenchus and some host races of D. dipsaci by restriction fragment length polymorphism. Journal of Nematology 25, 555-563 and Marek M, Zouhar M, Rysanek P & Havranek P (2005). Analysis of ITS sequences of nuclear rDNA and development of a PCR-based assay for the rapid identification of the stem nematode Ditylenchus dipsaci (Nematoda: Anguinidae) in plant tissues. Helminthology 42, 49-56, primers and restriction enzymes for identification of Ditylenchus dipsaci have been described.

Molecular methods of identifying Merlinius microdorus have not been described so far. The aim of the invention is to provide a molecular method for the identification of Merlinius microdorus with high sensitivity and specificity, and to provide new nucleotide sequences of primers and probes, applicable in the method of detecting nematodes by PCR, especially Real Time PCR, regardless of the type of samples tested, their origin and purpose and stage. development. The above objectives have been achieved in the present invention.

The invention relates to a method of identifying Merlinius microdorus in a soil sample, comprising the following steps;

(a) providing a soil sample containing nematodes for identification;

b) rinsing the nematodes from the soil;

c) DNA isolation;

d) performing a PCR reaction, in particular Real Time PCR, using a pair of 3 'and 5' primers and a probe;

e) comparison of the amplification curve of the tested sample with the amplification curves of the blank sample and the negative control, where for the identification of Merlinim microdorus in PCR, especially Real-Time PCR, primers 3 'and 5' appropriate for a given species and a probe are used:

Type Name 5 'starter Sequence Name 3 'starter Sequence Name Probe Sequence Merlinius microdorus Mermift GCGAGTCATTGAG TGGAA Mermirv CATCGCAAGCGAT TAGGA Merniis CCTTACGGAGCTGAT ATGCGAC

The subject of the invention is also a kit for identification of Merlinius microdorus by PCR. especially Real-Time PCR, containing species-specific primers 3 'and 5' and the probe:

Type Name 5 'starter Sequence Name 3 'starter Sequence Name Probe Sequence Merlinius microdorus MermiN GCGAGTCATTGAG TGGAA Mint CATCGCAAGCGAT TAGGA Mermis CCTTACGGAGCTG AT ATGCGAC

The reaction mixture contains a buffer, thermostable Taq polymerase, magnesium ions, primers and a probe. The concentration of primers in the reaction mixture is 1-2 μM, probes 50-100 nM, magnesium ions 2-5 mM. The reaction is carried out at an annealing temperature of the primers of 55-60 ° C, in a volume of the reaction mixture of 10-20 µΙ, using 35 to 40 reaction cycles. The products are identified by comparing the amplification curves of the test sample with the amplification curves of the blank. Fig. 1 shows the amplification cam for Merlinius microdorus.

An example of the identification of Merlinius microdorus is given below. In each case, the same isolation and amplification conditions were applied to the blank (deionized H2O free from nuclease) and the negative sample. The material for the negative sample was DNA of a nematode species belonging to the same genus as the test.

PL 233 894 Β1

Example

Identification of the nematode Merlinius microdorus

DNA was isolated using Macherey-Nagel's commercial NucleoSpin Tissue XS DNA isolation kits. The reaction used primers and probes with the following sequences:

Starter / probe Sequence Mermifv GCGAGTCATTGAGTGGAA Mermirv CATCGCAAGCGATTAGGA Mermis CCTTACGGAGCTGATATGCGAC

The Real Time PCR reaction was performed in a 20 μΙ mixture in a Qiagen RotorGene 6000 apparatus using reagents from the LuminoCt qPCR ReadyMix kit (Sigma-Aldrich) in the following amounts:

- Nuclease-free H2O up to a volume of 20 μΙ,

- 2 μ110.0 μΜ of each of the Mermifv and Mermirv primers,

- 1 μΙ 4.0 μΜ of the Mermis probe labeled at the 5 'end with JOE dye, and the 3' end with HBQ1 quencher,

- 10 μΙ 2X LuminoCt qPCR ReadyMix (Sigma-Aldrich),

- 2 μΙ DNA.

The reaction mixture was placed in a 20 μΙ tube, placed in the rotor of a RotorGene 6000 thermal cycler, and the amplification reaction was performed for 40 cycles under the following conditions:

Stage Temperature [° C] Time [s] Fluorescence measurement Pre-incubation 95 180 - Amplification denaturation 95 thirty - connecting 55 thirty single synthesis 72 thirty - Cooling 40 twenty

Merlinius brevidens DNA (2 μΙ DNA) was a negative control.

The amplification curves obtained as a result of the performed analysis are presented in Fig. 1

The solution according to the invention allows the detection of nematodes in soil within a few hours, including the stages of sample preparation, DNA isolation and Real-Time PCR. The method according to the invention can be used to identify the above-mentioned nematode species regardless of the type of test, its origin and destination, and the stage of development.

The proposed kit allows the identification of the above-mentioned species of nematode in the Real Time PCR reaction, which is much more sensitive and faster than other PCR methods. The use of probes in the Real Time PCR reaction significantly increases the specificity of the reaction in relation to the Real Time PCR reaction and fluorescent dyes.

Primer and probe sequence listing

Starter / probe No. Name No. 1 Mermifv No. 2 Mermirv No. 3 Mermis

Sequence

GCGAGTCATTGAGTGGAA

CATCGCAAGCGATTAGGA

CCTTACGGAGCTGATATGCGAC

PL 233 894 Β1

Claims (2)

Patent claims 1. A method of identifying the nematode Merlinius microdorus in a soil sample, including the following steps: (a) providing a soil sample containing nematodes for identification; b) rinsing the nematodes from the soil; c) DNA isolation; d) performing a PCR reaction, especially Real-Time PCR, using a pair of 3 'and 5' primers and probes; e) comparison of the amplification curve of the test sample with the amplification curves of the blank sample and the negative control, characterized by that for the identification of the species Merlinius microdorus in PCR, especially Real-Time PCR, primers appropriate for a given species are used 5 '(No. 1) and 3 '(No.2) and probe No.3. 2. Kit for the identification of Merlinius microdorus by PCR, especially Real-Time PCR, containing species-specific primers 5 '(No. 1) and 3' (No. 2) and probe No. 3.