PL232393B1 - Method and a kit for identification of Paratrichodorus pachydermus nematode, plant pest, by the Real Time PCR based method - Google Patents

Abstract

The subject of the application is a method and kit for identifying the nematode Paratrichodorus pachydermus, a plant pest, using the Real Time PCR method. Thanks to specifically selected primers and probes, this solution enables precise identification of the indicated nematode species regardless of the type of samples tested, their origin and purpose, and the stage of development.

Description

Description of the invention

The subject of the invention is a method and a kit for identifying the Paratrichodorus pachydermus nematode, a plant pest by Real Time PCR.

According to the latest classification, 11 species have been identified in the family Trichodoridae. Many of them are pests of arable crops. Infected plants have a damaged root system, and reduced water uptake leads to their dieback. Identification of nematode species is based on the analysis of morphological and morphometric features, including the diagnosis of female coloration at various stages of development, cyst shape, length and shape of dagger tumors, length of invasive larvae, pattern on the perineal plate. However, this is a very laborious and time-consuming analysis. It requires a lot of knowledge and experience in working with biological material. Moreover, there is the possibility of overlapping dimensions of different species. The method based on the analysis of morphological and morphometric features cannot be used to identify adolescents in which morphological features are not yet developed.

Currently, techniques based on the analysis of nucleic acids, including the polymerase chain reaction (PCR), are increasingly used in nematological diagnostics. The basis of the PCR technique is the amplification of a DNA fragment (s) specific for a specific organism to a level that allows for its quick and simple detection using electrophoresis. This is achieved by using short single-stranded oligonucleotides (12-40 nucleotides), the so-called primers, specific for the amplified DNA fragment, and the enzyme - thermostable polymerase, which enables the amplification of the desired fragment in a cyclic, three-step reaction consisting of denaturation, primer binding and DNA synthesis. Typically, after about 30 reaction cycles, more than a million copies of the amplified DNA fragment are obtained, which can be identified by gel electrophoresis.

An improvement on the polymerase chain reaction is Real Time PCR, that is, a PCR reaction with the measurement of the amount of amplified fragment in each reaction cycle. To measure the amount of the amplified fragment, fluorochromes (fluorescent dyes) are used, e.g. SYBR Green I, SYT09, Eva Green, SYBR Gold, the fluorescence of which is proportional to the amount of the amplified fragment. Identification of the resulting products is carried out by measuring the amount of fluorescence and analyzing the melting curve of the reaction products without electrophoresis. The sensitivity of Real Time PCR is much higher than that of traditional PCR, and the lack of electrophoresis shortens the analysis time. The disadvantage of Real Time PCR with fluorescent dyes (similar to traditional PCR) is the limited specificity of the reaction. In most cases, the PCR reaction occurs not only when the primer sequence is 100% identical to the template sequence but also when 1-2 nucleotides are non-identical. This property of traditional PCR-i Real Time PCR with fluorescent dyes requires precise setting of the thermal parameters of the reaction. Moreover, fluorescent dyes bind to each double-stranded DNA fragment, also resulting from primer amplification (primer-primer, primer-dimer products), which also requires careful selection of the appropriate concentration of primers. An alternative to fluorescent dyes are fluorescently labeled DNA probes. These are short sections of DNA, complementary to the searched sequence, which, when attached to DNA during PCR reactions, emit fluorescence at a specific wavelength. Currently, several types of probes are known, e.g. TaqMan, FR ET, molecular beacons, or scorpions. The specificity of the Real Time PCR reaction with labeled probes is much higher than with fluorescent dyes. Unlike primers, a single nucleotide mismatch in the probe sequence usually leads to no reaction or a very significant reduction in yield, which is easy to see when monitoring the course of the reaction or analyzing the results of the reaction.

Until now, the most frequently used method of molecular identification of nematodes was PCR-RFLP (Restriction Fragments Length Polymorphism). The restriction fragment length polymorphism method uses restriction enzymes that cut the DNA strand at a specific site. Differences in the length of the cut DNA fragments indicate variability. Amiri S, Subbotin S A and Moens M, Identification of the beet cyst nematode Heterodera schachtii by PCR, European Journal of Plant Pathology (2002), 108: 497-506 analyzed a total of almost 60 nematode cyst-forming populations with this method. Subbotin SA, Waeyenberge L. and Moens M. used in their publication Identification of cyst forming nematodes of the genus Heterodera (Nematoda: Heteroderidae) based on the ribosomal DNA-RFLP, Nematology (2000), 2 (2): 153-164 until 26 different restriction enzymes: Alul, Aval, BamHI, Bgll, BsiZI, BsuRI, Bsh12361, Bsp143I, Cfol, DdeI, EcoRI, Hpall, HindiII, Hinfl, KpnI, Mval, Pstl, PvuII, Psal, SalI, SM, Sspl,

PL 232 393 Β1

ScrFI, Taql, Tru9l and Xbal, which allowed them to isolate 27 foot species and types of nematodes in the sample. Moreover, PCR-RFLP studies of the nematode population were carried out by Garcia D., Garcia G., Montero Z., Salazar L, Brenes A. and Gómez-Alpizar L. in the work Morphological and molecular Identification of potato cyst-forming nematode Globodera pallida in soil samples from Costa Rica, Revista Latinoamericana de la Papa (2009), 15 (1): 38-45. Subbotin SA, Halford PD and Perry Roland N. in their 1999 publication Identification of populations of potato cyst nematodes from. Russia using protein electrophoresis, rDNA-RFLPs and RAPDs, Russian Journal of Nematology (1999), 7 (1): 57 -63 additionally used the RAPD method - Randomly Amplified Polymorphic, DNA (method of random amplification of polymorphic DNA). This method uses only one short (about 10-20 nucleotides) primer, runs at a lower temperature (about 35 ° C), but at the same time requires an increased number of cycles compared to standard PCR - as much as 40-50. As a result of electrophoretic analysis, bands of various lengths are obtained, the arrangement of which is characteristic for an individual and is something like a fingerprint. The PCR-RAPD method was also used by Adam MAM, Phillips MS and Blok VC in the work describing molecular methods of tumor identification - Molecular diagnostic key for Identification of single juveniles of seven common and economically important species of root-knot nematode (Meloidogyne spp.), Plant Pathology (2007), 56: 190-197.

The latest approach to molecular identification of nematodes is based on real-time polymerase chain reaction. Madani M., Subbotin SA and Moens M. in Quantitative detection of the potato cyst nematode, Globodera pallida, and the beet cyst nematode, Heterodera schachtii, using Real-Time PCR with SYBR green I dye, Molecular and Cellular Probes (2005), 19: 81-86 used specific primers and the fluorescent dye SYBR Green I to quickly identify species. They used a mix of primers described in previous publications - 0.1 pM of each primer: SH6Mod 5'-CGT GTT CTT ACG TTA CTT CAA-3 ' , SH4 5'-AGC ATG CGA AGG ATT GG-3 'PITSp4 5'-ACA ACA GCA ATC GTC GAG-3' and Pal3 5'-ATG TTT GGG CTG GCA C-3 '12 dye and 4 pl of sample DNA in total final volume of 25 pl.

Primers and restriction enzymes for the identification of 23 species of nematodes using the PCR-RFLP method, belonging to the genera Nanidorus, Paratrichodorus and Trichodorus, including for the identification of Paratrichodorus pachydermus, were described by Kumari S and Subbotin SA in the publication Molecular characterization and diagnostics of stubby root and virus vector nematodes of the. family Trichodoridae (Nematoda: Triplonchida) using ribosomal RNAgenes. 2012. Plant Pathology 61 (6): 1021-1031.

In the current state of the art, there is still a need to provide a tool for the detection of nematode species that have not been identified by genetic methods so far, as well as for an improved method of identifying those nematode species that are detected by known genetic techniques, but do not ensure high precision and do not exclude errors in the analysis.

The aim of the invention is to provide a method enabling the identification of Paratrichodorus pachydermus with high sensitivity and specificity, as well as providing new nucleotide sequences of primers and probes, applicable in the method of nematode detection by PCR, especially Real Time PCR, regardless of the type of samples tested, their origin, purpose and stage. development. The above objectives have been achieved in the present invention.

The subject of the invention is a method of identifying the nematode Paratrichodorus pachydermus in a soil sample, comprising the following steps:

(a) providing a soil sample containing nematodes for identification;

b) rinsing the nematodes from the soil;

c) DNA isolation;

d) performing a PCR reaction, in particular Real-Time PCR, using a pair of 3 'and 5' primers and a probe;

e) comparison of the amplification curve of the tested sample with the amplification curves of the blank sample and the negative control, whereby the identification of the nematode of the species Paratrichodorus pachydermus in the PCR reaction, especially Real-Time PCR, with the use of primers 3 'and 5' and the probe appropriate for a given species:

Type ) Name 5 'starter 3 'starter Probe Sequence Name ! Sequence Name j Sequence Paratriehodarus | pachydermus ! j Ppafr CGTTGTTGĆTGTĆ GGATA Ppam CACCAAAGAACT j GAGGTTTA Ppas _ ĆGTTATCTCTGAGCTG j ATCGACC

PL 232 393 Β1

The subject of the invention is also a kit for the identification of Paratrichodorus pachydermus, by PCR, especially Real-Time PCR, containing species-specific primers 3 'and 5' and a probe:

Type 5 'starter 3 'starter Probe Name Sequence Name j Sequence Nave Sequence Parairtchodorus pachydermus Ppafv GGTTGTTGCTGTC GGATA Pparr CACCAAAGAACT l GAGGTTTA Ppas CGTTATCTCTGACCTG ATCGACC

The reaction mixture contains a buffer, thermostable Taq polymerase, magnesium ions, primers and a probe. The concentration of primers in the reaction mixture is 1-2 μM, probes 50-100 nM, magnesium ions 2-5 mM. The reaction is carried out at an annealing temperature of primers of 55-60 ° C, in a volume of the reaction mixture of 1-20 μΙ, using 35 to 40 reaction cycles. Product identification is accomplished by comparing the amplification curves of the test sample with the amplification curves of the blank.

Fig. 1 Shows the amplification curves for Paratrichodorus pachydermus.

An example of the identification of Paratrichodorus pachydermus is given below. In each case, the same isolation and amplification conditions were applied to the blank (deionized H2O free from nuclease) and the negative sample. The material for the negative sample was DNA of a nematode species belonging to the same genus as the test.

Example

Identification of the Paratrichodorus pachydermus nematodes

DNA was isolated using Macherey-Nagel's commercial NucleoSpin Tissue XS DNA isolation kits. The reaction used primers and probes with the following sequences:

Starter / probe Sequence Ppafv GGTTGTTGCTGTCGGATA Pparrv CACCAAAGAACTGAGGTTTA Ppas CGTTATCTCTGAGCTGATCGACC

The Real Time PCR reaction was performed in a 20 μΙ mixture in a Qiagen RotorGene 6000 apparatus using reagents from the LuminoCt qPCR ReadyMix kit (Sigma-Aldrich) in the following amounts:

- Nuclease-free H2O up to a volume of 20 μΙ,

- 2 μ110.0 μΜ of each of Ppafv and Pparv primers,

- 1 μΙ 4.0 μΜ of the Ppas probe labeled at the 5 'end with JOE dye, and the 3' end with HBQ1 quencher,

- 10 μΙ 2X LuminoCt qPCR ReadyMix (Sigma-Aldrich),

- 2 μΙ DNA.

The reaction mixture was placed in a 20 μΙ tube, placed in the rotor of a RotorGene 6000 thermal cycler, and the amplification reaction was performed for 40 cycles under the following conditions:

Stage Temperature [ ^D Cj Time | s] Measurement of lluorescence Pre-incubation 95 180 - And denaturaeja 95 thirty - Amplication attaching 55 thirty single synthesis 72 thirty - Cooling 40 twenty

DNA of Paratrichodorus teres was the negative control.

The amplification curves obtained as a result of the performed analysis are presented in Fig. 1.

PL 232 393 Β1

The solution according to the invention allows the detection of Paratrichodorus pachydermus in soil within a few hours, including the stages of sample preparation, DNA isolation and Real-Time PCR. The method according to the invention can be used to identify the above-mentioned nematode species regardless of the type of test, its origin and destination, and the stage of development.

The proposed set of probes enables the identification of the above-mentioned species of nematodes in the Real Time PCR reaction, which is much more sensitive and faster than other PCR methods. The use of probes in the Real Time PCR reaction significantly increases the specificity of the reaction in relation to the Real Time PCR reaction with fluorescent dyes.

Primer and probe sequence listing

Starter / probe No. Name Sequence No. 1 Ppafv GG TTGTTGC TGTCGGATA No. 2 Pparrv CACCAAAGAACTGAGGTTIA No. 3 Ppas CGTTATCTCTGAGCTGATCGACC

Patent claims

Claims (2)

1. A method of identifying the nematode Paratrichodorus pachydermus in a soil sample, comprising the following steps: (a) providing a soil sample containing nematodes for identification; b) rinsing the nematodes from the soil; c) DNA isolation; d) performing a PCR reaction, in particular Real-Time PCR, using a pair of 3 'and 5' primers and a probe; e) comparison of the amplification curve of the test sample with the amplification curves of the blank sample and the negative control, characterized in that for the identification of the nematode of the species Paratrichodorus pachydermus in PCR, especially Real-Time PCR, primers appropriate for a given species are used 5 '(No. 1) and 3 '(no.2) and probe no.3. 2. Kit for the identification of Paratrichodorus pachydermus by PCR, especially Real -Time PCR, containing species-specific primers 5 '(No. 1) and 3' (No. 2) and probe No. 3.