PL233886B1 - Method and a kit for identification of Geocenamus longus nematode, forest plants pest, by the Real Time PCR based method - Google Patents

Abstract

The subject of the application is a method and kit for identifying the nematode Geocenamus longus, a pest of forest plants, using the Real Time PCR method. Thanks to specifically selected primers and probes, this solution enables precise identification of the indicated nematode species, regardless of the type of samples tested, their origin and purpose, and the stage of development.

Description

Description of the invention

The subject of the invention is a method and a kit for the identification of the nematode Geocenamus longus, a forest plant pest, by the Real Time PCR method.

Growing conifers in the ground is an important part of production, both in ornamental plant nurseries and in forest nurseries. Several groups of nematodes occur in these crops, including Geocenamus longus.

Identification of nematode species is based on the analysis of morphological and morphometric features, including the diagnosis of female coloration at various stages of development, cyst shape, length and shape of dagger tumors, length of invasive larvae, pattern on the perineal plate. However, this is a very laborious and time-consuming analysis. It requires a lot of knowledge and experience in working with biological material. Moreover, there is the possibility of overlapping dimensions of different species. The method based on the analysis of morphological and morphometric features cannot be used to identify adolescents in which morphological features are not yet developed.

Currently, techniques based on the analysis of nucleic acids, including the polymerase chain reaction (PCR), are increasingly used in nematological diagnostics. The basis of the PCR technique is the amplification of a DNA fragment (s) specific for a specific organism to a level that allows for its quick and simple detection using electrophoresis. This is achieved by using short single-stranded oligonucleotides (12-40 nucleotides), the so-called primers, specific for the amplified DNA fragment, and the enzyme - thermostable polymerase, which enables the amplification of the desired fragment in a cyclic, three-step reaction consisting of denaturation, primer binding and DNA synthesis. Typically, after about 30 reaction cycles, more than a million copies of the amplified DNA fragment are obtained, which can be identified by gel electrophoresis.

An improvement on the polymerase chain reaction is Real Time PCR, that is, a PCR reaction with the measurement of the amount of amplified fragment in each reaction cycle. To measure the amount of the amplified fragment, fluorochromes (fluorescent dyes) are used, e.g. SYBR Green I, SYT O9, Eva Green, SYBR Gold, the fluorescence of which is proportional to the amount of the amplified fragment. Identification of the resulting products is carried out by measuring the amount of fluorescence and analyzing the melting curve of the reaction products without electrophoresis. The sensitivity of Real Time PCR is much higher than that of traditional PCR, and the lack of electrophoresis shortens the analysis time. The disadvantage of Real Time PCR with fluorescent dyes (similar to traditional PCR) is the limited specificity of the reaction. In most cases, the PCR reaction occurs not only when the primer sequence is 100% identical to the template sequence but also when 1-2 nucleotides are non-identical. This property of traditional PCR and Real Time PCR with fluorescent dyes requires precise setting of the thermal parameters of the reaction. Moreover, fluorescent dyes bind to each double-stranded DNA fragment, also resulting from primer amplification (primer-primer, primer-dimer products), which also requires careful selection of the appropriate concentration of primers. An alternative to fluorescent dyes are fluorescently labeled DNA probes. These are short sections of DNA, complementary to the searched sequence, which, when attached to DNA during PCR reactions, emit fluorescence at a specific wavelength. Currently, several types of probes are known, e.g. TaqMan, FRET, molecular beacons, and scorpions. The specificity of Real Time PCR reactions with labeled probes is much higher than with fluorescent dyes. Unlike primers, a single nucleotide mismatch in the probe sequence usually leads to a lack of reaction or a very significant reduction in yield, which is easy to see when monitoring the course of the reaction or analyzing the results of the reaction.

So far, the most frequently used method of molecular identification of nematodes has been PCR. McCuiston J.L, Hudson L.C. Subbotin S.A., Davis E.L., Warfield C.Y Conventional and PCR Detection of Aphelenchoides fragariae in Diverse Ornamental Host Plant Species. J Nematol. Dec 2007; 39 (4): 343-355 developed primers for the identification of Aphelenchoides fragariae.

The method of restriction fragment length polymorphism PCR-RFLP (Restriction Fragments Length Polymorphism) using restriction enzymes that cut the DNA strand in a specific place for itself was used. Differences in the length of the cut DNA fragments indicate variability. Burgermeister W., Metge K., Braasch H., Buchbach E. 2005. ITS-RFLP patterns for differentiation of 26 Bursaphelenchus species (Nematoda: Parasitaphelenchidae) and observations on their distribu

PL 233 886 Β1ion. Russian Journal of Nematology, 13: 29-42 have developed a PCR-RFLP method to identify 44 species of Bursaphelenchus.

Real Time PCR (Cao AX, Liu XZ, Zhu SF, Lu BS. Deteection of the Pinewood Nematode, Bursaphelenchus xylophilus, Using a Real-Time Polymerase Chain Reaction Assay. Phytopathology. 2005 May; 95) identification has been successfully performed (5): 566-571; Ye W, Giblin-Davis RM. Molecular characterization and development of real-time PCR assay for pine-wood nematode Bursaphelenchus xylophilus (Nematoda: Parasitaphelenchidae). PLoS One. 2013 Nov 11; 8 (11) : e78804. doi: 10.1371 / journal.pone.0078804).

In the current state of the art, there is still a need to provide a tool for the detection of nematode species that have not been identified by genetic methods so far, as well as for an improved method of identifying those nematode species that are detected by known genetic techniques, but do not ensure high precision and do not exclude errors in the analysis.

The aim of the invention is to provide a method enabling the identification of the Geocenamus longus nematode with high sensitivity and specificity, as well as providing new nucleotide sequences of primers and probes, applicable in the method of detecting nematodes using the PCR technique, especially Real Time PCR, regardless of the type of test, their origin and purpose and stage. development. The above objectives have been achieved in the present invention.

The subject of the invention is a method of identifying the nematode Geocenamus longus in a soil sample, comprising the following steps:

(a) providing a soil sample containing nematodes for identification;

b) rinsing the nematodes from the soil;

c) DNA isolation;

d) performing a PCR reaction, in particular Real-Time PCR, using a pair of 3 'and 5' primers and a probe;

e) comparison of the amplification curve of the tested sample with the amplification curves of the blank sample and the negative control, where for the identification of one of the above species in the PCR reaction, especially Real-Time PCR, primers 3 'and 5' appropriate for a given species and the probe are used:

Type 5 'starter 3 'starter Probe Narwj Sequence Name Sequence Name Sequence Geocenamus longus Gon CTCCAAAGAAGGTG AAAGA Glonrv ATCGGTCTCGTAG TCATA Alga; TTGTCATCTGCTCTA TCTTGGAGTCG

The subject of the invention is also a kit for the identification of the Geocenamus longus nematode by PCR, especially Real-Time PCR, containing species-specific primers 3 'and 5' and a probe:

Type 5 'starter 3 'starter Probe Name Sequence Name Sequence Name Sequence Geocenamus longus Algae CTCCAAAGAAGGT GAAAGA Glonrv ftTCGGTCTCGTAG TCATA Glons TTGTCATCTGCTCTA TCTTGGAGTCG

The reaction mixture contains a buffer, thermostable Taq polymerase, magnesium ions, primers and a probe. The concentration of primers in the reaction mixture is 1-2 μM, probes 50-100 nM, magnesium ions 2-5 mM. The reaction is carried out at an annealing temperature of the primers of 55-60 ° C, in a volume of the reaction mixture of 10-20 µΙ, using 35 to 40 reaction cycles. Product identification is accomplished by comparing the amplification curves of the test sample with the amplification curves of the blank.

An example of the identification of Geocenamus longus is given below. In each case, the same isolation and amplification conditions were applied to the blank (deionized H2O free from nuclease) and the negative sample. The material for the negative sample was DNA of a nematode species belonging to the same genus as the tested species, a mixture of equal amounts of nematode DNA belonging to the same species as the tested species, or in the absence of species belonging to the same genus from the same family.

Example

Identification of the nematode Geocenamus lonsus.

PL 233 886 Β1

DNA was isolated using Macherey-Nagel's commercial NucleoSpin Tissue XS DNA isolation kits. The reaction used primers and probes with the following sequences:

Starter / probe Sequence Glonfv CTCCAAAGAAGGTGAAAGA Glonrv ATCGGTCTCGTAGTCATA Glons TGTCATCTGCTCTATCTTGGAGTCG

The Real Time PCR reaction was performed in a 20 μΙ mixture in a Qiagen RotorGene 6000 apparatus using reagents from the LuminoCt qPCR ReadyMix kit (Sigma-Aldrich) in the following amounts:

- Nuclease-free H2O up to a volume of 20 μΙ,

- 2 μ110.0 μΜ of each of the Glonfv and Glonrv primers,

- 1 μΙ 4.0 μΜ of the Glons probe labeled at the 5 'end with JOE dye, and the 3' end with HBQ1 quencher,

- 10 μΙ 2X LuminoCt qPCR ReadyMix (Sigma-Aldrich),

- 2 μΙ DNA.

The reaction mixture was placed in a 20 μΙ tube, placed in the rotor of a RotorGene 6000 thermal cycler, and the amplification reaction was performed for 40 cycles under the following conditions:

Stage Temperature | ° C] Time [s] Measurement of luminescence Prc-incubation 95 1S0 - Amplification denaturates a 95 thirty - connecting 55 thirty single synthesis 72 thirty - Cooling 40 ²⁰ '

DNA from the nematode Geocenamus tenuidens was a negative control.

The amplification curves obtained as a result of the performed analysis are presented in Fig. 1.

The solution according to the invention enables the detection of Geocenamus longus in soil within a few hours, including the stages of sample preparation, DNA isolation and Real-Time PCR reactions. The method according to the invention can be used to identify the above-mentioned species of nematodes irrespective of the type of test, their origin and destination, and the stage of development.

The proposed set of probes allows to identify the above-mentioned species of nematode in the Real Time PCR reaction, which is much more sensitive and faster than other PCR methods. The use of probes in the Real Tinie PCR reaction significantly increases the specificity of the reaction in relation to the Real Time PCR reaction with fluorescent dyes.

Starter / probe no. Name Sequence No. 1 Algae CTCCAAAGAAGGTGAAAGA No. 2 Glonrv ATCGGTCTCGTAGTCATA No. 3 Glons TGTCATCTGCTCTATCTTGGAGTCG

PL 233 886 B1

Claims (2)

Patent claims 1. Method for identifying nematodes (Geocenamus longus in a soil sample including the following steps): (a) providing a soil sample containing nematodes for identification; b) rinsing the nematodes from the soil; c) DNA isolation; d) performing PCR reactions, in particular Real-Time, PCR using a 3 'and 5' primer pair and, probes; e) comparing the amplification curve of the test sample with the amplification curves of the blank and negative controls. characterized in that for the identification of the species Geocenamus longus by PCR, especially Real-Time PCR, species-specific primers 5 '(No. 1) and 3' (No. 2) and probe No. 3 are used. 2. Kit for the identification of Geocenamus longus by the PCR method, especially Real-Time PCR, containing primers 5 '(No. 1) and 3' (No. 2) appropriate for a given species and probe No. 3.