PL231509B1

PL231509B1 - Method and a kit for identification of Paraphelenchus tritici nematode, mushroom pests, by the Real Time PCR based method

Info

Publication number: PL231509B1
Application number: PL415498A
Authority: PL
Inventors: Wiesław BOGDANOWICZ; Wiesław Bogdanowicz; Aneta Chalańska; Katarzyna KOWALEWSKA; Katarzyna Kowalewska; Tadeusz MALEWSKI; Tadeusz Malewski; Robert TURLEJ; Robert Turlej; Katarzyna WIŚNIEWSKA; Katarzyna Wiśniewska
Original assignee: Muzeum I Inst Zoologii Polskiej Akademii Nauk
Priority date: 2015-12-23
Filing date: 2015-12-23
Publication date: 2019-03-29
Also published as: PL415498A1

Abstract

Przedmiotem zgłoszenia jest sposób i zestaw do identyfikacji nicienia Paraphelenchus tritici szkodnika grzybów, metodą Real Time PCR. Dzięki specyficznie dobranym starterom i sondom, rozwiązanie to umożliwia precyzyjną identyfikację wskazanego gatunku nicienia, niezależnie od rodzaju prób badanych, ich pochodzenia i przeznaczenia oraz stadium rozwoju.The subject of the application is a method and kit for identifying the fungus pest nematode Paraphelenchus tritici using the Real Time PCR method. Thanks to specifically selected primers and probes, this solution enables precise identification of the indicated nematode species, regardless of the type of samples tested, their origin and purpose, and the stage of development.

Description

Opis wynalazkuDescription of the invention

Przedmiotem wynalazku jest sposób i zestaw do identyfikacji nicienia Paraphelenchus tritici, szkodników grzybów, metodą Real Time PCR.The subject of the invention is a method and a kit for the identification of Paraphelenchus tritici nematodes, fungal pests, by Real Time PCR.

Nicienie pasożytnicze żerujące na grzybni są wyposażone w specjalny aparat gębowy, którym wysysają sok komórkowy z grzybni pieczarek, co prowadzi do jej obumierania. Straty widoczne są zwykle dopiero w dalszych rzutach, lecz jeśli podłoże było bardzo zainfekowane w czasie rozrostu grzybni, to mogą one pojawić się wcześniej. W razie występowania nicieni pasożytniczych jedynym sposobem ich eliminacji jest gotowanie podłoża na półkach po zakończeniu uprawy i uprzątnięcie wszelkich jego resztek z pieczarkami, a drewniane półki należy ponownie impregnować. Groźnymi dla uprawy grzybów są Aphelenchus avenae, Aphelenchoides composticola i Paraphelenchus tritici oraz inne nicienie należące do Aphelenchoides.Parasitic nematodes feeding on the mycelium are equipped with a special mouthpiece that sucks the cell sap from the mushroom mycelium, which leads to its death. Losses are usually not seen until later flushes, but if the substrate was heavily infected during mycelial growth, it may appear earlier. In the case of parasitic nematodes, the only way to eliminate them is to boil the substrate on the shelves after the end of cultivation and clean up any remains of it with mushrooms, and the wooden shelves should be re-impregnated. Aphelenchus avenae, Aphelenchoides composticola, Paraphelenchus tritici and other Aphelenchoides nematodes are dangerous for mushroom cultivation.

Identyfikacja gatunków nicieni oparta jest na analizie cech morfologicznych i morfometrycznych, w tym diagnozowane są m.in.: zabarwienie samicy na poszczególnych etapach rozwojowych, kształt cysty, długość i kształt guzów sztyletu, długość larwy inwazyjnej, wzór na płytce perinealnej. Jest to jednak analiza bardzo pracochłonna i czasochłonna. Wymaga dużo wiedzy i doświadc zenia w pracy z materiałem biologicznym. Ponadto, istnieje możliwość nachodzenia na siebie wymiarów różnych gatunków. Metody opartej na analizie cech morfologicznych i morfometrycznych nie można zastosować do identyfikacji młodocianych osobników, u których cechy morfologiczne nie są jeszcze wykształcone.Identification of nematode species is based on the analysis of morphological and morphometric features, including the diagnosis of female coloration at various stages of development, cyst shape, length and shape of dagger tumors, length of invasive larvae, pattern on the perineal plate. However, this is a very laborious and time-consuming analysis. It requires a lot of knowledge and experience in working with biological material. Moreover, there is the possibility of overlapping dimensions of different species. The method based on the analysis of morphological and morphometric features cannot be used to identify adolescents in which morphological features are not yet developed.

Obecnie w diagnostyce nematologicznej coraz częściej stosowane są techniki oparte na analizie kwasów nukleinowych, w tym wykorzystujące łańcuchową reakcję polimerazy (PCR). Podstawą techniki PCR jest powielenie fragmentu/ów DNA, specyficznego dla określonego organizmu, do poziomu umożliwiającego jego szybką i prostą detekcję przy użyciu elektroforezy. Uzyskuje się to stosując krótkie jednoniciowe oligonukleotydy (12-40 nukleotydów), tzw. startery, specyficzne dla powielanego fragmentu DNA oraz enzym - termostabilną polimerazę, która umożliwia powielenie żądanego fragmentu w cyklicznej, trzyetapowej reakcji, złożonej z denaturacji, wiązania starterów oraz syntezy DNA. Zazwyczaj po około 30 cyklach reakcji uzyskuje się ponad milion kopii powielanego fragmentu DNA, co pozwala zidentyfikować go techniką elektroforezy żelowej.Currently, techniques based on the analysis of nucleic acids, including the polymerase chain reaction (PCR), are increasingly used in nematological diagnostics. The basis of the PCR technique is the amplification of a DNA fragment (s) specific for a specific organism to a level that allows for its quick and simple detection using electrophoresis. This is achieved by using short single-stranded oligonucleotides (12-40 nucleotides), the so-called primers, specific for the amplified DNA fragment, and the enzyme - thermostable polymerase, which enables the amplification of the desired fragment in a cyclic, three-step reaction consisting of denaturation, primer binding and DNA synthesis. Typically, after about 30 reaction cycles, more than a million copies of the amplified DNA fragment are obtained, which can be identified by gel electrophoresis.

Udoskonaleniem łańcuchowej reakcji polimerazy jest Real Time PCR, to jest rekcji PCR z pomiarem ilości powielonego fragmentu w każdym cyklu reakcji. Do pomiaru ilości powielonego fragmentu wykorzystuje się fluorochromy (barwniki fluorescencyjne), np.: SYBR Green 1, SYTO9, Eva Green, SYBR Gold, których fluorescencja jest proporcjonalna do ilości powielonego fragmentu. Identyfikację powstałych produktów przeprowadza się poprzez pomiar wielkości fluorescencji oraz analizę krzywej topnienia produktów reakcji bez elektroforezy. Czułość reakcji Real Time PCR jest znacznie większa niż tradycyjnego PCR, a brak elektroforezy skraca czas analizy. Wadą Real Time PCR z barwnikami fluorescencyjnymi (podobnie jak tradycyjnego PCR) jest ograniczona specyficzność reakcji. W większości przypadków reakcja PCR zachodzi nie tylko w przypadku 100% identyczności sekwencji starterów do sekwencji matrycy lecz również gdy 1-2 nukleotydy są nieidentyczne. Ta właściwość tradycyjnego PCR i Real Time PCR z barwnikami fluorescencyjnymi wymaga precyzyjnego ustawienia parametrów termicznych reakcji. Ponadto, barwniki fluorescencyjne wiążą się z każdym dwuniciowym fragmentem DNA, powstałym również w wyniku amplifikacji starterów (produkty primer-primer, primer-dimer), co wymaga również starannego doboru odpowiedniego stężenia starterów. Alternatywą dla barwników fluorescencyjnych są sondy DNA znakowane fluorescencyjnie. Są to krótkie odcinki DNA, komplementarne do poszukiwanej sekwencji, które po przyłączeniu do DNA podczas reakcji PCR emitują fluorescencję o określonej długości fali. Obecnie znanych jest kilka rodzajów sond, np.: TaqMan, FRET, molecular beacons, czy scorpions. Specyficzność reakcji Real Time PCR ze znakowanymi sondami jest znacznie wyższa niż z barwnikami fluorescencyjnymi. W odróżnieniu od starterów niedopasowanie jednego nukleotydu w sekwencji sondy prowadzi przeważnie do braku reakcji lub bardzo istotnego zmniejszenia wydajności, co jest łatwe do stwierdzenia podczas monitorowania przebiegu reakcji lub analizy wyników reakcji.An improvement on the polymerase chain reaction is Real Time PCR, that is, a PCR reaction with the measurement of the amount of amplified fragment in each reaction cycle. To measure the amount of the amplified fragment, fluorochromes (fluorescent dyes) are used, e.g. SYBR Green 1, SYTO9, Eva Green, SYBR Gold, the fluorescence of which is proportional to the amount of the amplified fragment. Identification of the resulting products is carried out by measuring the amount of fluorescence and analyzing the melting curve of the reaction products without electrophoresis. The sensitivity of Real Time PCR is much higher than that of traditional PCR, and the lack of electrophoresis shortens the analysis time. The disadvantage of Real Time PCR with fluorescent dyes (similar to traditional PCR) is the limited specificity of the reaction. In most cases, the PCR reaction occurs not only when the primer sequence is 100% identical to the template sequence but also when 1-2 nucleotides are non-identical. This property of traditional PCR and Real Time PCR with fluorescent dyes requires precise setting of the thermal parameters of the reaction. Moreover, fluorescent dyes bind to each double-stranded DNA fragment, also resulting from primer amplification (primer-primer, primer-dimer products), which also requires careful selection of the appropriate concentration of primers. An alternative to fluorescent dyes are fluorescently labeled DNA probes. These are short sections of DNA, complementary to the searched sequence, which, when attached to DNA during PCR reactions, emit fluorescence at a specific wavelength. Currently, several types of probes are known, e.g. TaqMan, FRET, molecular beacons, and scorpions. The specificity of the Real Time PCR reaction with labeled probes is much higher than with fluorescent dyes. Unlike primers, a single nucleotide mismatch in the probe sequence usually leads to no reaction or a very significant reduction in yield, which is easy to see when monitoring the course of the reaction or analyzing the results of the reaction.

Identyfikacja gatunków należących do rodzaju Aphelenchoides (A.besseyi, A.fragariae, A.ritzemabosi, A.subtenuis) metodą real time PCR została opisana w pracy Rybarczyk-Mydłowska K, Mooyman P, van Megen H, van den Elsen S, Vervoort M, Veenhuizen P, van Doom J, Dees R, Karssen G, Bakker J, Helder J. 2012 Small Subunit Ribosomal DNA-Based Phylogenetic Analysis of Foliar Nematodes (Aphelenchoides spp.) and Their Quantitative Detection in Complex DNA Backgrounds. Nematology 102(12): 1153-1160, natomiast do identyfikacji Paraphelenchus tritici dotychczas stosowano tylkoIdentification of species belonging to the genus Aphelenchoides (A.besseyi, A.fragariae, A.ritzemabosi, A.subtenuis) using the real time PCR method was described in the work by Rybarczyk-Mydłowska K, Mooyman P, van Megen H, van den Elsen S, Vervoort M , Veenhuizen P, van Doom J, Dees R, Karssen G, Bakker J, Helder J. 2012 Small Subunit Ribosomal DNA-Based Phylogenetic Analysis of Foliar Nematodes (Aphelenchoides spp.) And Their Quantitative Detection in Complex DNA Backgrounds. Nematology 102 (12): 1153-1160, while for the identification of Paraphelenchus tritici only

PL 231 509 Β1 tradycyjne metody morfologiczne i morfometryczne. Identyfikacja tych gatunków za pomocą PCR została zaproponowana przez autorów po raz pierwszy.PL 231 509 Β1 traditional morphological and morphometric methods. Identification of these species by PCR was proposed by the authors for the first time.

W stanie techniki istnieje nadal potrzeba dostarczenia narzędzia umożliwiającego detekcję wybranych gatunków nicieni nie identyfikowanych metodami genetycznymi, jak również dostarczenia udoskonalonego sposobu identyfikacji tych gatunków nicieni, które są wykrywane znanymi technikami genetycznymi natomiast nie zapewniają wysokiej precyzyjności i nie wykluczają błędów w analizie.In the state of the art, there is still a need to provide a tool enabling the detection of selected nematode species that are not genetically identified, as well as an improved method of identifying those nematode species that are detected by known genetic techniques, but do not ensure high precision and do not exclude errors in the analysis.

Celem wynalazku jest dostarczenie sposobu umożliwiającego identyfikację gatunków nicieni z dużą czułością i specyficznością. Celem wynalazku jest również dostarczenie sposobu identyfikacji nicieni, które nie były dotychczas wykrywane metodami analizy materiału genetycznego badanych gatunków. Celem wynalazku jest również dostarczenie nowych sekwencji nukleotydowych starterów i sond bądź nieoczywistego wyboru znanych sekwencji i sond, mających zastosowanie w sposobie wykrywanie nicieni techniką PCR, zwłaszcza Real-Time PCR, niezależnie od rodzaju prób badanych, ich pochodzenia i przeznaczenia oraz stadium rozwoju.The object of the invention is to provide a method that allows the identification of nematode species with high sensitivity and specificity. The aim of the invention is also to provide a method for the identification of nematodes which have not been detected so far by methods of analyzing the genetic material of the species tested. It is also an object of the invention to provide new nucleotide sequences of primers and probes or a non-obvious selection of known sequences and probes, applicable in the method of detecting nematodes by PCR, especially Real-Time PCR, regardless of the type of test, their origin and purpose, and the stage of development.

Powyższe cele zrealizowano w niniejszym wynalazku.The above objectives have been achieved in the present invention.

Przedmiotem wynalazku jest sposób identyfikacji nicienia Paraphelenchus tritici, obejmujący następujące etapy:The invention relates to a method for identifying the nematode Paraphelenchus tritici, comprising the following steps:

a) dostarczenie próbki gleby zawierające nicienie do identyfikacji;(a) providing a soil sample containing nematodes for identification;

b) wypłukanie nicieni z gleby;b) rinsing the nematodes from the soil;

c) izolację DNA;c) DNA isolation;

d) przeprowadzenie reakcji PCR, zwłaszcza Real-Time PCR, z zastosowaniem pary starterów 3’ i 5’ oraz sondy;d) performing a PCR reaction, in particular Real-Time PCR, using a pair of 3 'and 5' primers and a probe;

e) porównanie krzywej amplifikacji badanej próby z krzywymi amplifikacji próby zerowej oraz kontroli negatywnej, przy czym do identyfikacji jednego z powyższych gatunków w reakcji PCR, zwłaszcza, Real-Time PCR stosuje się właściwe dla danego gatunku startery 3’ i 5’ oraz sondę:e) comparison of the amplification curve of the tested sample with the amplification curves of the blank sample and the negative control, where for the identification of one of the above species in the PCR reaction, especially Real-Time PCR, primers 3 'and 5' appropriate for a given species and the probe are used:

Gatunek Type 5’ starter 5 'starter }* starter } * starter Sonda Probe Nazwa Name Sekwencja Sequence Nazwa Name Sekwencja Sequence Nazwa Name Sekwencja Sequence Paraphefenchus tritici Paraphefenchus tritici Ptrifk· Ptrifk gtgcatttgcgagta ATG gtgcatttgcgagta ATG Ptrirv Ptrirv CAACCAGGTTTCT CCAAA CAACCAGGTTTCT CCAAA Ptris Ptris CGCACATCAGATGACCTA ACCACA CGCACATCAGATGACCTA ACCACA

Przedmiotem wynalazku jest również zestaw do identyfikacji nicieni wybranych z grupy obejmującej gatunki Paraphelenchus tritici, metodą PCR, zwłaszcza Real-Time PCR, zawierający właściwe dla danego gatunku startery 3’ i 5’ oraz sondę:The subject of the invention is also a kit for the identification of nematodes selected from the group consisting of Paraphelenchus tritici species by PCR, especially Real-Time PCR, containing species-specific 3 'and 5' primers and a probe:

Gatunek Type 5’ starter 5 'starter 3 ’ starter 3 'starter Sonda Probe Nazwa Name Sekwencja Sequence Nazwa Name Sekwencja Sequence Nazwa Name Sekwencja Sequence Paraphelenchus tritici Paraphelenchus tritici Ptrifr Ptrifr GTGCATTTGCGAGTA ATG GTGCATTTGCGAGTA ATG Ptrin Ptrin CAACCAGGTTTCT CCAAA CAACCAGGTTTCT CCAAA Ptris Ptris CGCACATCAGATGACCTA ACCACA CGCACATCAGATGACCTA ACCACA

Mieszanina reakcyjna zawiera bufor, termostabilnąTaq polimerazę, jony magnezu, startery i sondę. Stężenie starterów w mieszaninie reakcyjnej wynosi 1-2 μΜ, sondy 50-100 nM, jonów magnezu 2-5 mM. Reakcję prowadzi się przy temperaturze przyłączania starterów 55-60°C, w objętości mieszaniny reakcyjnej 10-20 μΙ, przy zastosowaniu od 35 do 40 cykli reakcji. Identyfikacji produktów dokonuje się poprzez porównanie krzywych amplifikacji badanej próby z krzywymi amplifikacji próby zerowej.The reaction mixture contains a buffer, a thermostable Taq polymerase, magnesium ions, primers and a probe. The concentration of primers in the reaction mixture is 1-2 μM, probes 50-100 nM, magnesium ions 2-5 mM. The reaction is carried out at an annealing temperature of the primers of 55-60 ° C, in a volume of the reaction mixture of 10-20 µΙ, using 35 to 40 reaction cycles. Product identification is accomplished by comparing the amplification curves of the test sample with the amplification curves of the blank.

Poniżej podano przykład identyfikacji Paraphelenchus tritici. Każdorazowo identycznym warunkom izolacji i amplifikacji poddawano próbę zerową (dejonizowana H2O wolna od nukleaz) oraz próbę ujemną. Materiałem dla próby ujemnej było DNA gatunku nicienia należącego do tego samego rodzaju co badany, mieszanina równych ilości DNA nicieni należących do tego samego gatunku co badany gatunek lub w przypadku braku gatunków należących do tego samego rodzaju z tej samej rodziny.An example of the identification of a Paraphelenchus tritici is given below. In each case, the same isolation and amplification conditions were applied to the blank (deionized H2O free from nuclease) and the negative sample. The material for the negative sample was DNA of a nematode species belonging to the same genus as the tested species, a mixture of equal amounts of nematode DNA belonging to the same species as the tested species, or in the absence of species belonging to the same genus from the same family.

PrzykładExample

Identyfikacja nicienia Paraphelenchus tritici.Identification of the nematode Paraphelenchus tritici.

DNA izolowano przy użyciu komercyjnych zestawów do izolacji DNA NucleoSpin Tissue XS firmy Macherey-Nagel. W reakcji użyto starterów i sondy o następujących sekwencjach:DNA was isolated using Macherey-Nagel's commercial NucleoSpin Tissue XS DNA isolation kits. The reaction used primers and probes with the following sequences:

PL 231 509 Β1PL 231 509 Β1

Starter/sonda Starter / probe Sekwencja Sequence Ptrifv Ptrifv GTGCATTTGCGAGTAATG GTGCATTTGCGAGTAATG Ptrirv Ptrirv CAACCAGGTTTCTCCAAA CAACCAGGTTTCTCCAAA Ptris Ptris CGCACATCAGATGACCTAACCACA CGCACATCAGATGACCTAACCACA

Reakcję Real Time PCR przeprowadzano w mieszaninie o objętości 20 μΙ w aparacie RotorGene 6000 firmy Qiagen przy użyciu odczynników z zestawu LuminoCt qPCR ReadyMix (Sigma-Aldrich) w następujących ilościach:The Real Time PCR reaction was performed in a 20 μΙ mixture in a Qiagen RotorGene 6000 apparatus using reagents from the LuminoCt qPCR ReadyMix kit (Sigma-Aldrich) in the following amounts:

- H2O wolna od nukleaz do objętości 20 μΙ,- Nuclease-free H2O up to a volume of 20 μΙ,

- 2 μ110,0 μΜ każdego ze starterów Ptrifv i Ptrirv- 2 μ110.0 μΜ of each of the Ptrifv and Ptrirv primers

- 1 μΙ 4,0 μΜ sondy Ptris znakowanej na końcu 5' barwnikiem JOE, a 3'-końcu wygaszaczem HBQ1,- 1 μΙ 4.0 μΜ of the Ptris probe labeled at the 5 'end with JOE dye, and at the 3' end with HBQ1 quencher,

- 10 μΙ 2X LuminoCt qPCR ReadyMix (Sigma-Aldrich),- 10 μΙ 2X LuminoCt qPCR ReadyMix (Sigma-Aldrich),

- 2 μΙ DNA.- 2 μΙ DNA.

Mieszaninę reakcyjną umieszczano w probówce o objętości 20 μΙ, umieszczono w rotorze termocyklera RotorGene 6000 i przeprowadzano reakcję amplifikach w 40 cyklach w następujących warunkach:The reaction mixture was placed in a 20 μΙ tube, placed in the rotor of a RotorGene 6000 thermal cycler, and reacted in amplifiers for 40 cycles under the following conditions:

Etap Stage Temperatura j^oC|Temperature j ^o C | Cz.as jsj Cz.as jsj Pomiar fluorescencji Fluorescence measurement Pre-inkubacja Pre-incubation 95 95 180 180 - - itenaiuracja. itenaiuration. 95 95 50 50 Ampliiikacja Amplification przyłączanie connecting 55 55 50 50 pojedynczy single synteza synthesis 72 72 JO JO - - Chłodzenie Cooling 40 40 20 twenty - -

Kontrolę negatywną stanowiło DNA nicieni Aim/Mc/eut run /oem/opnnVOmw.Aim / Mc / eut run / oem / opnnVOmw nematode DNA was used as a negative control.

Krzywe amplifikacji uzyskane w wyniku przeprowadzonej analizy przedstawiono na Fig. 1.The amplification curves obtained as a result of the performed analysis are presented in Fig. 1.

Rozwiązanie według wynalazku pozwala na wykrycie Paraphelenchus tritici w przeciągu kilku godzin, uwzględniając w tym etapy przygotowania prób, izolacji DNA oraz reakcji Real-Time PCR. Metodę według wynalazku, można zastosować do identyfikacji wyżej wymienionych gatunków nicieni niezależnie od rodzaju prób badanych, ich pochodzenia i przeznaczenia oraz stadium rozwoju.The solution according to the invention allows the detection of Paraphelenchus tritici within a few hours, including the stages of sample preparation, DNA isolation and Real-Time PCR reactions. The method according to the invention can be used to identify the above-mentioned species of nematodes irrespective of the type of test, their origin and destination, and the stage of development.

Proponowany zestaw sond pozwala identyfikować wyżej wymienione gatunki nicienie w reakcji Real-Time PCR, która jest znacznie czulsza i szybsza od innych metod PCR. Zastosowanie w reakcji Real-Time PCR sond znacznie zwiększa specyficzność reakcji w stosunku do reakcji Real Time PCR z barwnikami fluorescencyjnymi.The proposed set of probes allows to identify the above-mentioned species of nematodes in the Real-Time PCR reaction, which is much more sensitive and faster than other PCR methods. The use of probes in the Real-Time PCR reaction significantly increases the specificity of the reaction in relation to the Real Time PCR reaction with fluorescent dyes.

Claims

Patent claims

1. The method of identifying a Paraphelenchus tritici nematode comprises the following steps;

a) providing a soil sample containing nematodes for identification;

b) rinsing the nematodes from the soil;

c) DNA isolation;

d) performing PCR, especially Real-Time PCR, using a 3 'and 5' startet pair and probe;

e) comparison of the amplification curve of the tested sample with the amplification curves of the blank sample and the negative control, characterized in that for the identification of the species Paraphelenchus tritici in PCR, especially Real-Time PCR, primers appropriate for a given species are used 5 '(No. 1) and 3 '(No.2) and probe No.3.

2. Kit for the identification of Paraphelenchus tritici by PCR, especially Real-Time PCR, containing species-specific primers 5 '(No. 1) and 3' (No. 2) and probe No. 3.