PL233837B1 - Method and a kit for identification of nematodes, papilionaceous plant growing pests, by Real Time PCR based method - Google Patents

Abstract

Both a method and a kit for identifying nematodes, pests of legume crops, using the Real Time PCR method are disclosed. In particular, the invention relates to a method and a kit for identifying nematodes including the species Ditylenchus dipsaci, Heterodera trifolii, Meloidogyne hapla, Paratylenchus projectus. Thanks to specifically selected primers and probes, the solution enables precise identification of selected nematode species regardless of the type of samples tested, their origin and purpose, and the stage of development.

Description

The subject of the invention is a method and a kit for the identification of nematodes, pests of legume crops by Real Time PCR, in particular the invention relates to a method and kit for the identification of nematodes selected from the group consisting of Ditylenchus dipsaci species from the Anguinidae family, Heterodera trifolii from the Heteroderidae family, Meloidogyne hapla from of the Meloidogynidae family, Paratylenchus projectus of the Tylenchulidae family.

The virulent destroyer (Ditylenchus dipsaci) causes the plants to dry out. It feeds on legumes, cereals, carrots and onions. Number of generations per year: 4-6. The development of one generation takes 19-30 days. The eggs are laid inside the plants. The invasive larva hibernates in plant debris. In spring, it penetrates through the underground parts of plants (stems, tubers, bulbs). Nematodes of the genus Meloidogyne are plant parasites of economic importance, in the cultivation of which they can cause enormous losses. To date, 15 species of Meloidogyne have been found in Europe (Karssen G., Block RJ, van Aelst AC, van den Beld I., Kox LFF, Korthals G., Molendijk L., Zijstra C., van Hoof R., Cook R. 2004. Description of Meloidogyne minor n. Sp. (Nematoda: Meloidogynine), a root - knot nematode associated with yellow patch disease in golf courses. Nematology 6 (1): 59-72). Eight of them were found in Poland (Karssen G., Brzeski MW 1998. Meloidogyne Goldi, 1892. pp. 242-263. In: Nematodes of Tylenchina in Poland and Temperate Europe (MW Brzeski, ed.) Museum and Institute of Zoology of the Polish Academy of Sciences , Warsaw). M. hapla is widespread in Poland and is a pest of dicotyledonous crops (Głąba B. 1990. Occurrence of the northern tuber in potato, beetroot and conical plantations in Gdańsk voivodship. Zesz. Probl. Post. Nauk Rol. 391: 39-51).

Identification of nematode species is based on the analysis of morphological and morphometric features, including the diagnosis of female coloration at various stages of development, cyst shape, length and shape of dagger tumors, length of invasive larvae, pattern on the perineal plate. However, this is a very laborious and time-consuming analysis. It requires a lot of knowledge and experience in working with biological material. Moreover, there is the possibility of overlapping dimensions of different species. The method based on the analysis of morphological and morphometric features cannot be used to identify adolescents in which morphological features are not yet developed.

Currently, techniques based on the analysis of nucleic acids, including the polymerase chain reaction (PCR), are increasingly used in nematological diagnostics. The basis of the PCR technique is the amplification of a DNA fragment (s) specific for a specific organism to a level that allows for its quick and simple detection using electrophoresis. This is achieved by using short single-stranded oligonucleotides (12-40 nucleotides), the so-called primers, specific for the amplified DNA fragment, and the enzyme - thermostable polymerase, which enables the amplification of the desired fragment in a cyclic, three-step reaction consisting of denaturation, primer binding and DNA synthesis. Typically, after about 30 reaction cycles, more than a million copies of the amplified DNA fragment are obtained, which can be identified by gel electrophoresis.

An improvement on the polymerase chain reaction is Real Time PCR, that is, a PCR reaction with the measurement of the amount of amplified fragment in each reaction cycle. To measure the amount of the amplified fragment, fluorochromes (fluorescent dyes) are used, e.g. SYBR Green I, SYTO9, Eva Green, SYBR Gold, the fluorescence of which is proportional to the amount of the amplified fragment. Identification of the resulting products is carried out by measuring the amount of fluorescence and analyzing the melting curve of the reaction products without electrophoresis. The sensitivity of Real Time PCR is much higher than that of traditional PCR, and the lack of electrophoresis shortens the analysis time. The disadvantage of Real Time PCR with fluorescent dyes (similar to traditional PCR) is the limited specificity of the reaction. In most cases, the PCR reaction occurs not only when the primer sequence is 100% identical to the template sequence, but also when 1-2 nucleotides are not identical. This property of traditional PCR and Real Time PCR with fluorescent dyes requires precise setting of the thermal parameters of the reaction. Moreover, fluorescent dyes bind to each double-stranded DNA fragment, also resulting from primer amplification (primer-primer, primer-dimer products), which also requires careful selection of the appropriate concentration of primers.

An alternative to fluorescent dyes are fluorescently labeled DNA probes. These are short sections of DNA, complementary to the searched sequence, which, when attached to DNA during PCR reactions, emit fluorescence at a specific wavelength. Currently, several types of probes are known, e.g. TaqMan, FRET, molecular beacons or scorpions. The specificity of the Real Time PCR reaction with labeled probes is much higher than with fluorescent dyes. In contrast to

In the case of primers, a mismatch of one nucleotide in the probe sequence usually leads to a lack of reaction or a very significant reduction in yield, which is easily detected when monitoring the course of the reaction or analyzing the reaction results.

Until now, the most frequently used method of molecular identification of nematodes was PCR-RFLP (Restriction Fragments Length Polymorphism). The restriction fragment length polymorphism method uses restriction enzymes that cut the DNA strand at a specific site for itself. Differences in the length of the cut DNA fragments indicate variability. In the works of Wendt K.R., Vrain T.C. & Webster J.M. (1993). Separation of three species of Ditylenchus and some host races of D. dipsaci by restriction fragment length polymorphism. Journal of Nematology 25, 555-563 and Marek M., Zouhar M., Rysanek P. & Havranek P. (2005). Analysis of ITS sequences of nuclear rDNA and development of a PCR-based assay for the rapid identification of the stem nematode Ditylenchus dipsaci (Nematoda: Anguinidae) in plant tissues. Helminthology 42, 49-56, primers and restriction enzymes for identification of Ditylenchus dipsaci have been described. Subbotin SA, Waeyenberge L. and Moens M. used in their publication Identification of cyst forming nematodes of the genus Heterodera (Nematoda: Heteroderidae) based on the ribosomal DNA-RFLP, Nematology (2000), 2 (2): 153-164 until 26 different restriction enzymes: Alul, Aval, BamHI, BglI, BsiZI, BsuRI, Bsh1236I, Bsp143I, CfoI, DdeI, EcoRI, HpaII, HindIII, HinfI, KpnI, MvaI, PstI, PvuII, PsaI, SalI, SfuI, SspI, SspI , TaqI, Tru9I and Xbal, thanks to which they distinguished 27 different species and types of nematodes in the sample, including the Heterodera trifolii. Similarly, Amiri S., Subbotin S.A. and Moens M., Identification of the beet cyst nematode Heterodera schachtii by PCR, European Journal of Plant Pathology (2002), 108: 497-506 analyzed a total of nearly 60 nematode cyst-forming populations with this method and also found suitable restriction enzymes for the identification of the trifolium Heterodera . Wishart J., Phillips M.S., Blok V.C., Ribosomal Intergenic Spacer: A Polymerase Chain Reaction Diagnostic for Meloidogyne chitwoodi, M. fallax, and M. hopla, Phytopathology. 2002 Aug; 92 (8): 884-92 developed primers for the identification of M. hapla.

In 2014, Berg E., Tiedt L.R. Subbotin S.A. 2014 Morphological and molecular characterization of several Paratylenchus Micoletzky, 1922 (Tylenchida: Paratylenchidae) species from South Africa and USA, together with some taxonomic notes. Nematology 16: 323-358 described primers for identifying five Paratylenchus species (P. aquaticus, P. dianthus, P. hamatus, P. nanus and P. straeleni). Identification of P. projectus, however, is carried out on the basis of morphological features (Brzeski M., Hanel L. Paratylenchinae: evaluation of diagnostic morpho-biometrical characters of females in the genus Paratylenchus Micoletzky, 1922 (Nematoda: Tylenchulidae). Nematology 2: 253-261 ).

In the state of the art, there is still a need to provide a tool enabling the detection of selected nematode species that are not genetically identified, as well as an improved method of identifying those nematode species that are detected by known genetic techniques, but do not ensure high precision and do not exclude errors in analysis.

The object of the invention is to provide a method that allows the identification of nematode species with high sensitivity and specificity. The aim of the invention is also to provide a method for the identification of nematodes which have not been detected so far by methods of analyzing the genetic material of the species tested. It is also an object of the invention to provide new nucleotide sequences of primers and probes or a non-obvious selection of known sequences and probes, applicable in the method of detecting nematodes by PCR, especially Real-Time PCR, regardless of the type of test, their origin and purpose and stage of development.

The above objectives have been achieved in the present invention.

The subject of the invention is a method of identifying nematodes in a soil sample selected from the group consisting of the species Ditylenchus dipsaci, Heterodera trifolii, Meloidogyne hapla, Paratylenchus projectus, comprising the following steps:

1) providing a soil sample containing nematodes for identification;

2) rinsing the nematodes from the soil;

3) DNA isolation;

4) performing PCR reactions, especially Real-Time PCR, using a pair of 3 'and 5' primers and a probe;

5) comparison of the amplification curve of the tested sample with the amplification curves of the blank sample and the negative control, where the identification of one of the above species in the PCR reaction, especially Real-Time PCR, uses the species-specific 3 'and 5' primers and a probe selected from the list :

PL 233 837 Β1

Type Name 5 'starter Sequence Name 3 'starter Sequence Name Probe Sequence Ditylenchus dipsaci Heterodera trifolii Meloidogyne hapla Paratylenchus projectus Ddipfy Htrifv Mhafv Pprfy ctaggagtgtggcttacg acggaccaaggagtttag cggaccaaggagtttatc cttggatacctgtggtaa Ddipry Htrirv Mharv Pprfy ccacaggcagtaacagtc ccagggatcacacatcag gcacatcagactctaaaga atgcgatcagcttagtta Ddip Htri Mhas Ppr atccaccgcagagcaagaag agccttcactttcattacgcctttg tcatttactttcatttcgcttctaggt caccgaagttgttccttgcg

The subject of the invention is also a kit for the identification of nematodes selected from the group consisting of the species Ditylenchus dipsaci, Heterodera trifolii, Meloidogyne hapla, Paratylenchus projectus, by PCR, especially Real-Time PCR, containing species-specific 3 'and 5' primers and a probe selected from the list :

Type Name 5 * starter Sequence Name 3 'starter Sequence Name Sequence probe Ditylenchus dipsaci Heterodera trifolii Meloidogyne hapla Paratylenchus projectus Ddipfv Htrifv Mhafv Pprfv ctaggagtgtggcttacg acggaccaaggagtttag cggaccaaggagtttatc cttggatacctgtggtaa Ddiprv Htrirv Mharv Pprrv ccacaggcagtaacagtc ccagggatcacacatcag gcacatcagactctaaaga atgcgatcagcttagtta Ddip Htri Mhas Ppr atccaccgcagagcaagaag agccttcactttcattacgcctttg tcatttactttcatttcgcttctaggt caccgaagttgttccttgcg

The reaction mixture contains a buffer, thermostable Taq polymerase, magnesium ions, primers and a probe. The concentration of primers in the reaction mixture is 1-2 μM, probes 50-100 nM, magnesium ions 2-5 mM. The reaction is carried out at an annealing temperature of the primers of 55-60 ° C, in a volume of the reaction mixture of 10-20 µΙ, using 35 to 40 reaction cycles. Product identification is accomplished by comparing the amplification curves of the test sample with the amplification curves of the blank.

The names of the primer and probe sequences correspond to the following sequence numbers: Ddipfv (SEQ ID NO: 1), Ddiprv (SEQ ID NO: 2), Ddip (SEQ ID NO: 3), Htrifv (SEQ ID NO: 4), Htrirv (SEQ ID NO: 5), Htri (SEQ ID NO: 6), Mhafv (SEQ ID NO: 7), Mharv (SEQ ID NO: 8), Mhas (SEQ ID NO: 9), Pprfv (SEQ ID NO: 10), Pprrv (SEQ ID NO: 11), Ppr (SEQ ID NO: 12).

Fig. 1 shows the amplification curves for the Paratylenchus projectus.

Fig. 2 shows the amplification curves for the Heterodera of the trifolia.

Fig. 3 shows the amplification curves for the Meloidogyne hapla.

Fig. 4 shows the amplification curves for Ditylenchus dipsaci.

Examples of identifying each of the nematode species included in the set are given below. Each time, identical isolation and amplification conditions were applied to the blank (deionized H ₂ O free from nuclease) and the negative sample. The material for the negative sample was DNA of a nematode species belonging to the same genus as the tested species, a mixture of equal amounts of nematode DNA belonging to the same species as the tested species, or in the absence of species belonging to the same genus, a species from the same family.

Example 1

Identification of the nematodes of the species Paratylenchus projectus

DNA was isolated using Macherey-Nagel's commercial NucleoSpin Tissue XS DNA isolation kits. The reaction used primers and probes with the following sequences:

Starter / probe Sequence Pprfv CTTGGATACCTGTGGTAA Pprrv ATGCGATCAGCTTAGTTA Ppr CACCGAAGTTGTTCCTTGCG

The Real Time PCR reaction was performed in a 20 μΙ mixture in a Qiagen RotorGene 6000 apparatus using reagents from the LuminoCt qPCR Ready Mix kit (Sigma-Aldrich) in the following amounts:

- Nuclease-free H2O up to a volume of 20 μΙ,

- 2 μ110.0 μΜ of each of the Pprfv and Pprrv primers,

PL 233 837 Β1

- 1 μΙ 4.0 μΜ Ppr probe labeled at the 5 'end with JOE dye, and at the 3' end with HBQ1 quencher

- 10 μΙ 2X LuminoCt qPCR ReadyMix (Sigma-Aldrich),

- 2 μΙ DNA.

The reaction mixture was placed in a 20 μΙ tube, placed in the rotor of a RotorGene 6000 thermal cycler, and the amplification reaction was performed for 40 cycles under the following conditions:

Stage Temperature [° C] Time [s] Fluorescence measurement Pre-incubation 95 180 - Amplification dc right here 95 thirty - connecting 55 thirty single synthesis 72 thirty - Cooling 40 twenty -

The above isolation and amplification conditions were applied to the blank (deionized nuclease-free H 2 O), the negative control (Meloidogyne hapla DNA), and the positive control (DNA Paratylenchus projectus).

Tested samples:

• trial 1. 2 μΙ DNA of each nematode species: D. dipsaci, H. trifolii, M. hapla and P. projectus were added to the reaction.

• sample 2. 2 μΙ of DNA obtained from a mixture of equal volumes of D. dipsaci, H. trifolii, M. hapla and P. projectus DNA was added to the reaction.

• sample 3. 2 μΙ of DNA obtained from a mixture of equal volumes of D. dipsaci, H. trifolii, M. hapla and 0.2 μΙ P. projectus DNA was added to the reaction.

The amplification curves obtained from the performed analysis are presented in Fig. 1. Example 2

Identification of the nematodes of the species Heterodera trifolii

The isolation and amplification conditions were as set out in Example 1. The following primers and probes were used in the Real-Time POR reaction:

Starter / probe Sequence Htrifv acggaccaaggagtttag Htrirv ccagggatcacacatcag Htri agccttcactttcattacgcctttg

The negative control was a mixture of equal volumes of DNA solutions: Heterodera avenae, Heterodera humuli, Heterodera schachtii.

The amplification curves obtained from the performed analysis are shown in Fig. 2.

Example 3

Identification of the Meloidogyne hapla species

The isolation and amplification conditions were as set out in Example 1. The following primers and probes were used in the Real-Time POR reaction:

Starter / probe Sequence Mhafv cggaccaaggagtttatc Mharv gcacatcagactctaaaga Mhas tcatttactttcatttcgcttctaggt

The negative control was DNA of the nematode Aphelenchoides ritzemabosi, Longidorus elongatus, Mesocriconema xenoplax.

PL 233 837 Β1

Tested samples:

• trial 1. 2 μΙ DNA of each nematode species: Aphelenchoides ritzemabosi, Longidorus elongatus, Mesocriconema xenoplax and Meloidogyne hapla were added to the reaction.

• trial 2. 2 μΙ of DNA obtained from a mixture of equal volumes of DNA of Aphelenchoides ritzemabosi, Longidorus elongatus, Mesocriconema xenoplax and Meloidogyne hapla was added to the reaction.

• trial 3. 2 μΙ of DNA obtained from a mixture of equal volumes of DNA of Aphelenchoides ritzemabosi, Longidorus elongatus, Mesocriconema xenoplax and 0.2 μΙ Meloidogyne hapla were added to the reaction.

The amplification curves obtained from the performed analysis are shown in Fig. 3. Example 4

Identification of the nematodes of the species Ditylenchus dipsaci

The isolation and amplification conditions were as set out in Example 1. The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Ddipfv ctaggagtgtggcttacg Ddiprv ccacaggcagtaacagtc Ddip atccaccgcagagcaagaag

The negative control was DNA Ditylenchus destructor.

The amplification curves obtained from the performed analysis are presented in Fig. 4.

The solution according to the invention allows the detection of nematodes in soil within a few hours, including the stages of sample preparation, DNA isolation and Real-Time PCR. The method according to the invention can be used to identify the abovementioned species of nematodes irrespective of the type of test, their origin and destination, and the stage of development.

The proposed set of probes enables the identification of the above-mentioned species of nematodes in the Real Time PCR reaction, which is much more sensitive and faster than other PCR methods. The use of probes in the Real Time PCR reaction significantly increases the specificity of the reaction in relation to the Real Time PCR reaction with fluorescent dyes.

Patent claims

Claims (2)

1. A method of identifying the nematode species Ditylenchus dipsaci, Heterodera trifolii, Meloidogyne hapla and Paratylenchus projectus in a soil sample, comprising the following steps: (a) providing a soil sample containing nematodes for identification; b) rinsing the nematodes from the soil; c) DNA isolation; d) performing a Real-Time PCR reaction using a 3 'and 5' primer pair and probe; e) comparison of the amplification curve of the tested sample with the amplification curves of the blank sample and the negative control, with the identification of one of the above species in Real-Time PCR using species-specific 3 'and 5' primers and probes selected from the list: Type Natwa 5 'starter Sequence 3'starter Probe Sequence Name Sequence Name Ditylenchus dipsaci Ddiph / ctaggagtgtggcttacg Ddipre ccacaggcagtaacagtc Ddip atccaccgcagagcaaga ag Heterodera of the trifolia Htrifv acggaccaaggagtttag Htrirv ccagggatcacacatcag Htri agccttcactttcattacgcctttg MeJo / dogyne hapla Mhafv cgeaccaageagtttatc Mharv gcacatcagactctaaaga Mhas tcatttactttcatttcgcttctaggt Paratylenchus projectus Pprfv cttggatacctgtggtaa Pprfv atgcgatcagcttagtta Ppr caccgaagttgttcrttgcg PL 233 837 Β1 2. Kit for the identification of the nematode species Ditylenchus dipsaci, Heterodera trifolii, Meloidogyne hapla and Paratylenchus projectus by Real-Time PCR, containing species-specific primers 3 'and 5' and probes selected from the list: Type Name 5'starter Sequence 3'starter Probes » Sequence Name Sequence Name Orty / encftus dipsaci Ddipfu ctaggagtgtggcuacg Dd iprv ccacaggLdgtdacagtc Udip atccaccgcagagcaagaag Heterodera of the trifolia Htrifu acggaecaaggagtttag Htrirv ccagggatcacacatcag Htri agccttcartttcattacgcctttg Meloidogyne hopla Mhafv cggaccaaggagtttatc Mharv gcacatcagactctaaaga tcatttactttcatttcgcttctaggt Paratylenchus projectus Pprfv cttggatacctgtggtaa Pprfv atgcgatcagcttagtta Ppr caccgaagttgttccttgcg