CN114410803B - Primer and kit for rapidly detecting caenorhabditis elegans and application - Google Patents

Abstract

The invention discloses a primer and a kit for rapidly detecting a caenorhabditis elegans and application thereof, and belongs to the technical field of plant nematode molecule detection. The primers are specific primers Dp-482F and Dp-829R, and the nucleotide sequences are as follows: dp-4812 F:5'-GCTGCGTTGAAGAGAACTGGCAC-3', dp-829R:5'-CGGAAAAGCACCCAACCAGTACC-3', which can specifically detect the nematodes; the invention also constructs a method for detecting the caenorhabditis elegans by using the specific primer, wherein the detection threshold of the specific primer and the method is up to 10 pg/mu L of genomic DNA and 1/128 head nematode. Therefore, the primer disclosed by the invention has high sensitivity and high specificity, and has high application value in the aspects of early diagnosis, rapid detection, early warning and the like of the bulb nematodes.

Description

Primer and kit for rapidly detecting caenorhabditis elegans and application

Technical Field

The invention relates to the technical field of plant nematode molecular detection, in particular to a primer and a kit for rapidly detecting a caenorhabditis elegans and application thereof.

Background

The phomopsis (Latin name Ditylenchus dipsaci (Kuhn, 1987) Filijev), also known as a raised-stem nematode, is a destructive parasitic nematode, and has more than 500 host species, the main harmful site being stem tissue, and also has great harm to tuberous, bulb, corm, root-like stem and other sites. The damage of the nematodes can cause the yield reduction of a plurality of crops, and more serious, can cause the necrosis of plants. The 20 th year, the Nepal planting industry is almost destroyed by the Lepidoptera, and it is reported that the Lepidoptera can increase 15000 times in one growing season on the Nepal, and the whole bulb can be destroyed rapidly. In addition, the nematodes seriously damage the beets and multiply in large numbers in the host, gradually forming rot, leading to spoilage of the storage root factor. Small amounts of nematodes can also cause significant damage. Studies have shown that if there is a survival of 1 nematode per 500g of soil, the nematodes can cause reduced yield in plants such as onion. Once it is present in the soil, it can be propagated in large quantities, and eradication is very difficult.

In molecular detection of stem nematodes, wendt et al (1993) developed the technique of ITS-RFLP, which utilizes a variety of restriction enzymes to cleave ITS sequences, allowing accurate differentiation between potato rot stem nematodes and lepidobulb nematodes. In the previous research (winding fei et al, 2008), the applicant of the invention finds that the ITS of the potato rotting stem nematodes has obvious difference and can be divided into obvious 2 types, namely A type and B type, 2 pairs of specific primers are designed to detect A type and B type according to the ITS, wherein the specific primers of the A type lepidobulb nematodes are DDS1/DDS2, and the specific amplified fragment is 252bp; the specific primer of the B-type lepidobulb nematode is DDL1/DDL2, and the specific amplified fragment is 485bp; the method is characterized in that a nematode universal primer D3A/D3B is introduced as an internal standard, and a molecular technology and a method for specifically detecting different types of populations of the nematodes by one-step double PCR are researched. Marek et al (2010) developed specific primers DipU-F/DipU-R, des2-F/Des1-R capable of detecting both nematodes simultaneously based on the difference between D.destructor and D.dipbaci, wherein DipU-F/DipU-R is capable of specifically detecting 333bp fragment from D.dipbaci, and Des2-F/Des1-R is capable of specifically detecting 453bp fragment from potato rot stem nematodes. Liu et al (2007) designed a set of specific primers based on the ITS sequence of potato rot stem nematodes, which amplified a fragment of 346bp, but the samples tested included only rot stem nematodes. Esquiret al (2003) and Zouhar et al (2007) developed SCAR-PCR detection techniques for the nematodes, and amplified fragments were 242bp and 325bp, respectively.

In recent years, a large number of lepidobulb nematodes are captured from garlic, narcissus seed balls and tulip seed balls imported from countries such as the united states, canada, japan and spanish continuously at the customs port of China, but there is no report in China on the development of rapid detection primers.

Disclosure of Invention

The invention aims to provide a primer, a kit and application for rapidly detecting the lepidobulb nematodes, which are used for solving the problems of the prior art, specifically detecting the lepidobulb nematodes, and serving the rapid PCR early diagnosis, auxiliary identification and the like of the lepidobulb nematodes.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides a primer for rapidly detecting a bulb nematode, which is a specific primer Dp-482F and Dp-829R, and the nucleotide sequence of the primer is as follows:

Dp-482F:5’-GCTGCGTTGAAGAGAACTGGCAC-3’，

Dp-829R:5’-CGGAAAAGCACCCAACCAGTACC-3’。

the invention also provides a product for rapidly detecting the bulb nematodes, which comprises the primer.

Preferably, the product comprises a kit, a reagent.

The invention also provides a method for rapidly detecting the caenorhabditis elegans, which comprises the step of amplifying target gene fragments of a sample to be detected by using the primer.

Preferably, the amplified reaction system is: 10 XPCR Buffer 2.5. Mu.L, 10mM dNTP 2. Mu.L, taq enzyme 0.5. Mu.L, primers Dp-482F and Dp-829R each 1.0. Mu.L, DNA template 1. Mu.L, sterile distilled water was supplemented to 25. Mu.L.

Preferably, the amplification conditions are: 94 ℃ for 5min;94 ℃,30s,56 ℃,30s,72 ℃,1min,35 cycles; 72 ℃ for 10min; preserving at 4 ℃.

The invention also provides application of the primer in preparation of a reagent or a kit for detecting the caenorhabditis elegans.

The invention discloses the following technical effects:

the invention adopts the general primers rDNA1 and rDNA2 to amplify ITS sequences of the lepidocrocea, and designs and screens out a pair of specific primers Dp-482F and Dp-829R through comparison with ITS sequences of other stem nematodes and PCR detection, and develops a specific detection method of the lepidocrocea, thereby realizing the detection of the lepidocrocea. Specific primers Dp-482F and Dp-829R can be used for specifically detecting 7 different geographical species of caenorhabditis elegans, the amplified fragments are 327bp, and 13 species of other 7 species of caenorhabditis are amplified into fragments. In order to reduce the false negative result of detection, 28s of universal primers D2A and D3B are added during specific detection, and are used for detecting DNA, the universal primers D2A and D3B can amplify fragments with the length of about 780bp from all effective DNA, positive samples can simultaneously show 327bp specific fragments and 780bp fragments, and the fragments of 780bp are not the fragments of the bulb nematodes, so that the possibility of false detection is reduced. Meanwhile, the sensitivity detection of the specific primers shows that the detection threshold values of the specific primers and the detection method of the lepidobulb nematodes are 10 ng/mu L and 1/128 head nematodes respectively, and the specific primers and the detection method have high sensitivity. Therefore, the invention has extremely high specificity and sensitivity, and can rapidly carry out molecular diagnosis on the lepidobulb nematodes. The method can be applied to field sample detection and occurrence distribution monitoring and early warning of the bulb nematodes, and has important practical application value.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows the ITS sequence alignment and specific primer design of the invention for the lepidobulb nematodes and other closely related species;

FIG. 2 shows the amplification results of different primers of the present invention; m is a standard DNA molecular marker (DNA marker 2000); 1 to 10 are respectively the PCR amplification results of 10 groups of different primers; CK is a negative control;

FIG. 3 shows the results of specific detection of the lepidobulb nematodes of the present invention; m is a standard DNA molecular marker (DNA marker III); 1 to 7 are respectively different groups (the codes are 1 to 7) of rotting stem nematodes; 8-14 are respectively different groups of the bulb nematodes (the codes are 8-14); 15 is an african stem nematode (code 15); 16 is a d.weischeri population (code 16) 17 is a d.gagis population (code 18), 18 is 3 stem nematodes of unknown species ( code 17, 19, 20); CK is a negative control;

FIG. 4 shows the DNA sensitivity test results of the single-headed bulb nematodes with different dilution factors according to the invention; m is a standard DNA molecular marker (DNA marker III); 1 to 8 are respectively 1,1/2, 1/4, 1/8, 1/16, 1/32, 1/64 and 1/128 scale bulb nematodes; CK is a negative control.

FIG. 5 shows the results of sensitivity detection of genomic DNA from different concentrations of a caenorhabditis elegans according to the invention; m is a standard DNA molecular marker (DNA marker III); 1-8 are the genomic DNA of the nematodes of the lepidobulb (100. Mu.g/. Mu.L, 10. Mu.g/. Mu.L, 1. Mu.g/. Mu.L, 100 ng/. Mu.L, 10 ng/. Mu.L, 1 ng/. Mu.L, 10 pg/. Mu.L and 1 pg/. Mu.L); CK: negative control.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

The experiment of the invention selects the materials:

2 populations of lepidocrocea nematodes (No. 8 and 9) were collected from the laboratory from the United states and Canada, etc., the others were captured from imported goods by customs in various regions of the country, 7 rotting nematodes were collected from the domestic Mongolian Liaoning, henan Zheng, jilin cucurbit island, shandong, jiangsu copper mountain, united states and Canada, african nematodes, ditylenchus weishceri, ditylenchus gagis and other species unknown to the nematodes were collected from foreign countries by the laboratory staff (see Table 1). The DNA of the bulb nematodes is stored in the laboratory and can be issued to the public.

TABLE 1 code for sample population of nematodes and population sources

The main reagent comprises: taq DNA polymerase, DNA gel recovery kit, DNA marker and PMD18-T vector were purchased from TaKaRa, and primers were synthesized by Shanghai Biotechnology Co.

EXAMPLE 1 design and screening of specific PCR primers for Phosphales

1. Extraction of nematode DNA

Picking up a single-head nematode population to be tested, placing the nematode population into a PCR tube filled with 7mL of 10 XPCR buffer, 3mL of proteinase K solution (600 mg/mL) and 10mL of sterile water, quick-freezing for 1min in liquid nitrogen, quickly grinding ice with a sterilized glass rod, repeatedly quick-freezing for 1min in liquid nitrogen, grinding again with the glass rod, and then freezing at least 2h at-20 ℃. The PCR tube was then transferred to 65℃for 1.5h, incubated at 95℃for 10min and finally centrifuged at 12000rpm for 1min, and the supernatant was kept at-20℃for further use.

2. Amplification of ITS sequences from Phosphales

And (3) using the DNA of the lepidoptera as a template, and amplifying an IT S sequence of the lepidoptera by adopting a universal primer. The universal primers are as follows:

rDNA1(SEQ ID NO:4)：5’-TTGATTACGTCCCTGCCCTTT-3’；

rDNA2(SEQ ID NO:5)：5’-TTTCACTCGCCGTTACTAAGG-3’。

the PCR reaction system is as follows: 10 XPCR Buffer (Mg-containing) ²⁺ ) 2.5. Mu.L, 10mM dNTPs2. Mu.L, 1.0. Mu.L each of primer rDNA1 and rDNA2 (10. Mu. Mol/L), 0.5. Mu.L of Taq enzyme (5U/. Mu.L, tak ara), 1. Mu.L of template DNA, and 25. Mu.L of sterilized re-distilled water. Amplification was performed on an Eppendorf PCR amplification instrument.

The PCR amplification conditions were: 94 ℃ for 5min;94 ℃,30s,55 ℃,30s,72 ℃,2min,35 cycles; storing at 72deg.C for 10min and 4deg.C.

After PCR amplification, 5. Mu.L of the amplified product was taken, 1. Mu.L of a loading buffer was added to electrophoresis on a 1.0% agarose gel, 0.5 xTAE was used as an electrophoresis buffer, electrophoresis was performed at 100V for 1 hour, stained with EB, observed under a violet lamp and photographed.

The DNA fragments obtained by amplifying the universal primers rDNA1 and rDNA2 were recovered and purified using an agarose gel recovery kit, ligated to a PMD18-T Vector, transformed into E.coli for cloning, and sequenced by recombinant plasmid Committee Biotechnology (Shanghai) Inc. which identified the PCR as a positive clone (SEQ ID NO: 1).

TTGATTAGGTCCCTGCCCTTTGTACACACCGCCCGTCGCTGCCCGGGACTGAGCCATTTCGAGAAATTCGGGGATTGCCGATTAGCGGTCTTTCGGGATTGCTTTTTGGTGAGAACCAACTTAATCGCAGTGGCTTGAACCGGGCAAAAGTCGTAACAAGGTGGCTGTAGGTGAACCTGCTGCCGGATCATTATCGATCAACCAAAACACTAGGAATTGGACCTGGCTGGACCTTTTCCGTAGAATGAGGAATTCATTCTTACAGCCAATAGTCCAAGAGGGTGCCGTGATATTGGCACGATGCTCACTGGTGATGTCCCCACCGGTTTGCATGCTTATTCTTGGGCGAAAAAACGGCTCTGTTGGCTTCTATGGTTCTCTGAGCAGTTGTATGCCTACGTCCGTGGCTGCGTTGAAGAGAACTGGCACGTGGTCTTCGTGATCGCGAGAATCAATGAGTACCGGTTAGGTGCCGCCAACAAAAACCCCATTTTTGAACTTTTTTACAAGAAAACATTTCTAGTCTTATCGGTGGATCACTCGGTTCATAGATCGATGAAGAACGCAGCCAACTGCGATATATGGTGTGAACTGCAGATATTTTGAACACCAAGAATTCGAATGCACATTGCGCCACTGGATATCTATCCTTTGGCACATCTGGTTCAGGGTCGTAAATACCAAACGAAGGCTAATTCGTTGTTTATGACAAATTCATGGCGGTACTGGTTGGGTGCTTTTCCGTCAGTGTCATGTTTTTGTGAAGGGACTTGCCTACCGGATGATTTTGGCTGTTGATATACGTCTTTGCTAATCTAGACGGAATCGACTGGCTATTTCACTCTGGATGTACGTTGGCATCGATCTTCCGACCTGAGCTCAGTTGTGATTACCTGCTGAACTTAAGCATATCAGTAAGCAGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAAA

3. Specific primer design and screening

Based on BLAST alignment, rDNA-ITS sequences of multiple closely related species nematodes such as peanut stem nematodes, edible fungus stem nematodes, multi-leaf nematodes, D.askenasyi, african stem nematodes, D.gagis, D.weishi, etc. were downloaded from NCBI, and the sequencing results of the sequences and the ITS sequences of the lepidocrocus were analyzed by using MEGA 6.0 (see FIG. 1). According to the comparison result, 10 groups of primers are designed in the specific region of the bulb nematodes by adopting primer5.0 software. And respectively taking the DNA of the bulb nematodes as templates for PCR amplification detection. The PCR reaction system amplification system is the same as that of the amplification system of the ITS sequence of the 2-bulbus lepidocroci.

After PCR amplification, 5. Mu.L of the amplified product was taken, 1. Mu.L of the loading buffer was electrophoresed on a 1.0% agarose gel, 0.5 xTAE was used as an electrophoresis buffer, electrophoresis was performed at 100V for 1 hour, stained with EB, observed under a purple light lamp and photographed (see FIG. 2).

Based on the electrophoresis results, in which the amplification product of channel 2 of FIG. 2 was single, there were no other bands, and thus the set of primers was selected for the next detection. The upstream and downstream primers of the specific primers for the nematodes were designated Dp-482F and Dp-829R, respectively, and the sequences were characterized as follows:

Dp-482F(SEQ ID NO:2)：5’-GCTGCGTTGAAGAGAACTGGCAC-3’，

Dp-829R(SEQ ID NO:3)：5’-CGGAAAAGCACCCAACCAGTACC-3’。

example 2 specific and sensitive detection of PCR molecular detection method for Phosphaeria squamosa

1. Specific detection method for PCR (polymerase chain reaction) molecular detection method of caenorhabditis elegans

The specific primer Dp-482F/Dp-829R and the universal primer D2A/D3B designed by the invention are synthesized by Shanghai biological engineering Co., ltd, and the PCR reaction system is as follows: 2.5. Mu.L of 10 XPCR Buffer (Mg-containing) ²⁺ ) mu.L of 10mM dNTP (2.5 mM), 1.5. Mu.L of primer pair Dp-482F/Dp-829R (10. Mu. Mol/L), 0.5. Mu.L of Taq DNA polymerase (5U/. Mu.L), 1. Mu.L of template DNA, and sterilized ddH ₂ O was made up to 25. Mu.L. Clear water was used as negative control. PCR amplification was performed on an Eppendorf 5331 PCR amplification apparatus.

The PCR conditions were as follows: 94 ℃ for 5min;94 ℃,30s,56 ℃,30s,72 ℃,1min,35 cycles; storing at 72deg.C for 10min and 4deg.C.

After completion of the reaction, 5. Mu.L of the amplified product was added to 1. Mu.L of a 6 Xloading buffer, electrophoresed on a 1.5% agarose gel, electrophoresed for 30min at 130V using 0.5 XTAE as an electrophoresis buffer, stained with EB, observed in a gel imaging system and photographed. Meanwhile, rDNA-28S universal primers D2A and D3B are used for amplifying the DNA, the amplification system and the conditions are the same, and the amplified products are used for detecting the quality of the DNA after electrophoresis.

As shown in FIG. 3, the results show that 7 species of caenorhabditis elegans (lanes 8-14)) amplified by the specific primer Dp-482F/Dp-829R forms a stable band with a length of 327bp, and no amplified band appears in other 7 species of caenorhabditis elegans such as rotten caenorhabditis elegans and the like and the negative control (see the lower graph of FIG. 3). Whereas the universal primers D2A and D3B were used to stably amplify bands 780bp in length from all populations (see FIG. 3 top panel). The above results indicate that: the primer of the invention has high specificity for the bulb nematode Dp-482F/Dp-829R.

2. Sensitivity detection method for PCR (polymerase chain reaction) molecular detection method of caenorhabditis elegans

The DNA of single-stranded lepidocrocea was extracted, and diluted by a 2-fold dilution method to obtain 1,1/2, 1/4, 1/8, 1/16, 1/32, 1/64, and 1/128 lepidocrocea DNAs (lanes 1 to 8 in FIG. 4). 1 mu L of the DNA of the caenorhabditis elegans with different dilution factors is taken as a template, and the specific primer Dp-482F/Dp-829R is used for PCR amplification, and the amplification system and the conditions are the same as the specific detection method of the PCR molecular detection method of the caenorhabditis elegans, so as to detect the sensitivity of the specific primer. The result of PCR product electrophoresis is shown in FIG. 4.

Extracting the genome DNA of the caenorhabditis elegans, measuring the concentration of the genome DNA by using Nanodrop2000, diluting the genome DNA into 100 mug/mu L,10 mug/mu L,1 mug/mu L, 100 ng/mu L,10 ng/mu L,1 ng/mu L,10 pg/mu L and 1 pg/mu L by using sterile water, taking 1 mu L of caenorhabditis elegans DNA with different concentrations as a template, and carrying out PCR amplification by using a specific primer Dp-482F/Dp-829R, wherein the amplification system and conditions are the same as those of the specific primer PCR molecular detection method of the caenorhabditis elegans, and the sensitivity of the specific primer is tested. The result of PCR product electrophoresis is shown in FIG. 5.

As shown in fig. 4, the results indicate that: a327 bp clear band was amplified from 1 to 1/128 nematode DNA (lanes 1 to 8 in FIG. 4), and the negative control did not amplify the band (CK). As shown in fig. 5, the results indicate that: the detection threshold of the specific primer and the detection method for the lepidobulb nematodes is 10 pg/mu L (lanes 1-7 in FIG. 5), which indicates that the specific primer and the detection method have extremely high sensitivity.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Sequence listing

<110> institute of plant protection of national academy of agricultural sciences

Shaanxi Institute of biological agriculture

<120> primer, kit and application for rapidly detecting caenorhabditis elegans

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 967

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ttgattaggt ccctgccctt tgtacacacc gcccgtcgct gcccgggact gagccatttc 60

gagaaattcg gggattgccg attagcggtc tttcgggatt gctttttggt gagaaccaac 120

ttaatcgcag tggcttgaac cgggcaaaag tcgtaacaag gtggctgtag gtgaacctgc 180

tgccggatca ttatcgatca accaaaacac taggaattgg acctggctgg accttttccg 240

tagaatgagg aattcattct tacagccaat agtccaagag ggtgccgtga tattggcacg 300

atgctcactg gtgatgtccc caccggtttg catgcttatt cttgggcgaa aaaacggctc 360

tgttggcttc tatggttctc tgagcagttg tatgcctacg tccgtggctg cgttgaagag 420

aactggcacg tggtcttcgt gatcgcgaga atcaatgagt accggttagg tgccgccaac 480

aaaaacccca tttttgaact tttttacaag aaaacatttc tagtcttatc ggtggatcac 540

tcggttcata gatcgatgaa gaacgcagcc aactgcgata tatggtgtga actgcagata 600

ttttgaacac caagaattcg aatgcacatt gcgccactgg atatctatcc tttggcacat 660

ctggttcagg gtcgtaaata ccaaacgaag gctaattcgt tgtttatgac aaattcatgg 720

cggtactggt tgggtgcttt tccgtcagtg tcatgttttt gtgaagggac ttgcctaccg 780

gatgattttg gctgttgata tacgtctttg ctaatctaga cggaatcgac tggctatttc 840

actctggatg tacgttggca tcgatcttcc gacctgagct cagttgtgat tacctgctga 900

acttaagcat atcagtaagc agaggaaaag aaactaacaa ggattccctt agtaacggcg 960

agtgaaa 967

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gctgcgttga agagaactgg cac 23

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

cggaaaagca cccaaccagt acc 23

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ttgattacgt ccctgccctt t 21

<210> 5

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

tttcactcgc cgttactaag g 21

Claims (6)

1. The application of the primers in preparing a reagent or a kit for rapid PCR early diagnosis and auxiliary identification of the lepidocrocea and the non-lepidocrocea is characterized in that the primers are specific primers Dp-482F and Dp-829R, and the nucleotide sequences are as follows: dp-4812 F:5'-GCTGCGTTGAAGAGAACTGGCAC-3', dp-829R:5'-CGGAAAAGCACCCAACCAGTACC-3';

when the primer is used for identifying the lepidocrocea and the non-lepidocrocea, the amplification reaction system is as follows: 10 XPCR buffer 2.5. Mu.L, 10mM dNTP 2. Mu.L, taq enzyme 0.5. Mu.L, primers Dp-482F and Dp-829R each 1.0. Mu.L, DNA template 1. Mu.L, sterile distilled water to 25. Mu.L;

the amplification conditions were: 94 ℃ for 5min;94℃30s,56℃30s,72℃1min,35 cycles; storing at 72deg.C for 10min and 4deg.C.

2. A product for rapid detection of a caenorhabditis elegans comprising the primer of claim 1.

3. The product according to claim 2, characterized in that the product comprises a kit, a reagent.

4. A method for rapidly detecting a caenorhabditis elegans, comprising the step of amplifying a target gene fragment of a sample to be detected using the primer of claim 1.

5. The method according to claim 4, wherein the amplification reaction system comprises: 10 XPCR Buffer 2.5. Mu.L, 10mM dNTP 2. Mu.L, taq enzyme 0.5. Mu.L, primers Dp-482F and Dp-829R each 1.0. Mu.L, DNA template 1. Mu.L, sterile distilled water was supplemented to 25. Mu.L.

6. The method of claim 4, wherein the amplification conditions are: 94 ℃ for 5min;94℃30s,56℃30s,72℃1min,35 cycles; storing at 72deg.C for 10min and 4deg.C.

Images