PL230915B1 - Method and a kit for identification of nematodes, root crop pests, by Real Time PCR based method - Google Patents

Abstract

Both a method and a kit for identifying nematodes, root crop pests, using the Real Time PCR method are disclosed. In particular, the invention relates to a method and kit for identifying nematodes including the species Ditylenchus destructor, Naccobus aberrans, Paratrichodorus teres, Trichodorus primitivus, Trichodorus similis, and Trichodorus viruliferus. Thanks to specifically selected primers and probes, the solution enables precise identification of selected nematode species regardless of the type of samples tested, their origin and purpose, and the stage of development.

Description

Description of the invention

The subject of the invention is a method and a kit for the identification of nematodes and pests of root crops by the Real Time PCR method. In particular, the invention relates to a method and a kit for the identification of nematodes selected from the group consisting of Ditylenchus destructor from the family Anguinidae, Naccobus aberrans from the family Pratylenchidae and Paratrichodorus teres, Trichodorus primitivus, Trichodorus similis and Trichodorus viruliferus from the family Trichodoridae.

According to the latest classification, the Anguinidae family in Poland is represented by 34 species, Heteroderidae - 17 species, Meloidogynidae - 5 species, Pratylenchidae - 5 species, and 11 species have been found in the Trichodoridae family. Many of them are pests of arable crops. Infected plants have a damaged root system, and reduced water uptake leads to their dieback. The nematode species listed above are considered to be parasites or potential parasites in root crops. The above-ground part of the infected plant turns yellow and the tubers are smaller, covered with brown and spots, which reduces their commercial value. Nacobbus aberrans is on the European and Mediterranean Plant Protection Organization, EPPO quarantine list.

Identification of nematode species is based on the analysis of morphological and morphometric features, including the diagnosis of female coloration at various stages of development, cyst shape, length and shape of dagger tumors, length of invasive larvae, pattern on the perineal plate. However, this is a very laborious and time-consuming analysis. It requires a lot of knowledge and experience in working with biological material. Moreover, there is the possibility of overlapping dimensions of different species. The method based on the analysis of morphological and morphometric features cannot be used to identify adolescents in which morphological features are not yet developed.

Currently, techniques based on the analysis of nucleic acids, including the polymerase chain reaction (PCR), are increasingly used in nematological diagnostics. The basis of the PCR technique is the amplification of a DNA fragment (s) specific for a specific organism to a level that allows for its quick and simple detection using electrophoresis. This is achieved by using short single-stranded oligonucleotides (12-40 nucleotides), the so-called primers, specific for the amplified DNA fragment, and the enzyme - thermostable polymerase, which enables the amplification of the desired fragment in a cyclic, three-step reaction consisting of denaturation, primer binding and DNA synthesis. Typically, after about 30 reaction cycles, more than a million copies of the amplified DNA fragment are obtained, which can be identified by gel electrophoresis.

An improvement on the polymerase chain reaction is Real-Time PCR, that is, a PCR reaction with the measurement of the amount of amplified fragment in each reaction cycle. To measure the amount of the amplified fragment, fluorochromes (fluorescent dyes) are used, e.g. SYBR Green I, SYTO9, Eva Green, SYBR Gold, the fluorescence of which is proportional to the amount of the amplified fragment. And the identification of the resulting products is carried out by measuring the amount of fluorescence and analyzing the melting curve of the reaction products without electrophoresis. The sensitivity of Real -Time PCR is much higher than that of traditional PCR, and the lack of electrophoresis shortens the analysis time. The disadvantage of Real-Time PCR with fluorescent dyes (similar to traditional PCR) is the limited specificity of the reaction. In most cases, the PCR reaction occurs not only when the primer sequence is 100% identical to the template sequence, but also when 1-2 nucleotides are not identical. This property of traditional PCR and Real Time PCR with fluorescent dyes requires precise setting of the thermal parameters of the reaction. Moreover, fluorescent dyes bind to each double-stranded DNA fragment, also resulting from primer amplification (primer-primer, primer-dimer products), which also requires careful selection of the appropriate concentration of primers. An alternative to fluorescent dyes are fluorescently labeled DNA probes. These are short sections of DNA, complementary to the searched sequence, which, when attached to DNA during PCR reactions, emit fluorescence at a specific wavelength. Currently, several types of probes are known, e.g. TaqMan, FRET, molecular beacons, and scorpions. The specificity of Real -Time PCR reactions with labeled probes is much higher than with fluorescent dyes. Unlike primers, a single nucleotide mismatch in the probe sequence usually leads to no reaction or a very significant reduction in yield, which is easy to see when monitoring the course of the reaction or analyzing the results of the reaction.

Until now, the most frequently used method of molecular identification of nematodes was PCR-RFLP (Restriction Fragments Length Polymorphism). Restriction fragment length polymorphism method

PL 230 915 B1 uses restriction enzymes that cut the strand of DNA at a specific site for itself. Differences in the length of the cut DNA fragments indicate variability. Amiri S., Subbotin S. A. and Moens M., Identification of the beet cyst nematode Heterodera schachtii by PCR, European Journal of Plant Pathology (2002), 108: 497-506 analyzed a total of nearly 60 cyst-forming nematode populations with this method. Subbotin SA, Waeyenberge Li and Moens M. used in their publication Identification of cyst forming nematodes of the genus Heterodera (Nematoda: Heteroderidae) based on the ribosomal DNA-RFLP, Nematology (2000), 2 (2): 153-164 to 26 different restriction enzymes: AluI, AvaI, BamHI, BglI, BsiZI, BsuRI, Bshl236I, Bspl43I, CfoI, Ddel, EcoRI, Hpall, Hindlll, Hinfl, KpnI, MvaI, Pstl, PvuII, Psal, Sali, Sali, SfuI, TaqI, Tru9I and XbaI, thanks to which they distinguished 27 different species and types of nematodes in the sample. In addition, PCR-RFLP studies of the nematode population were carried out by Garcia D., Garcia G., Montero Z., Salazar L., Brenes A. and Gómez-Alpizar L. in the work Morphological and molecular identification of potato cyst-forming nematode Globodera pallida in soil samples from Costa Rica, Revista Latinoamericana de la Papa (2009), 15 (1): 38-45. Subbotin SA, Halford PD and Perry Roland N. in their 1999 publication Identification of populations of potato cyst nematodes from Russia using protein electrophoresis, rDNA-RFLPs and RAPDs, Russian Journal of Nematology (1999), 7 (1): 57- 63 additionally used the RAPD method - Randomly Amplified Polymorphic DNA (method of random amplification of polymorphic DNA). This method uses only one short (about 10-20 nucleotides) primer, runs at a lower temperature (about 35 ° C), but at the same time requires an increased number of cycles compared to standard PCR - as much as 40-50. As a result of electrophoretic analysis, bands of various lengths are obtained, the arrangement of which is characteristic for an individual and is something like a fingerprint. The PCR-RAPD method was also used by Adam MAM, Phillips MS and Blok VC in the work describing molecular methods of tumor identification - Molecular diagnostic key for identification of single juveniles of seven common and economically important species of root-knot nematode (Meloidogyne spp.), Plant Pathology (2007), 56: 190-197.

In the literature, there is a known method of identifying nematodes harmful to root crops from soil based on the multiplex PCR reaction - Pylypenko LA, Uehara T., Phillips MS, Sigareva DD, Blok VC Identification of Globodera rostochiensis and G. pallida in the Ukraine by PCR, European Journal of Plant Pathology (2005), 111: 39-46. Primers: PITSr3 5'-AGC GCA GAC ATG CCG CAA-3 ', PITSp4 5'-ACA ACA GCA ATC GTC GAG-3' and 5'-CGT AAC AAG GTA GCT GTA G-3 'distinguished Globoder rostochiensis and G. pallida. In another work, Amiri S., Subbotin S. A. and Moens M. An efficient method for identification of the Heterodera schachtii sensu stricto group using PCR with specific primers, Nematol. medit. (2001), 29: 241-246, with a mixture of two universal primers: D3A 5'-GAC CCG TCT TGA AAC ACG GA-3 'and D3B 5'-TCG GAA GGA ACC AGC TAC TA-3' and two specific primers : TW81 5'-GTT TCC GTA GGT GAA CCT GC-3 'and SGR1 5'-GTA CAT GAT CCC ACG AAG C-3' identified nematodes based on the 28S region of the gene.

The latest approach to molecular identification of nematodes is based on real-time polymerase chain reaction. Madani M., Subbotin SA and Moens M. in Quantitative detection of the potato cyst nematode, Globodera pallida, and the beet cyst nematode, Heterodera schachtii, using Real-Time PCR with SYBR green I dye, Molecular and Cellular Probes (2005), 19: 81-86 used specific primers and the fluorescent dye SYBR Green I to quickly identify species. They used a mix of primers described in previous publications - 0.1 pM of each primer: SH6Mod 5'-CGT GTT CTT ACG TTA CTT CAA-3 ' , SH4 5'-AGC ATG CGA AGG ATT GG-3 ', PITSp4 5'-ACA ACA GCA ATC GTC GAG-3' and Pal3 5'-ATG TTT GGG CTG GCA C-3 ', 12 pl dye and 4 pl DNA samples in a total final volume of 25 pl.

An alternative to the fluorescent dye is the TaqMan probe used successfully to identify Globodera rostochiensis and Globodera artemisiae - Nowaczyk K., Dobosz R., Kornobis S., Obrepalska-Steplowska A., TaqMan REAL-Time PCR-based approach for differentiation between Globodera rostochiensis ( golden nematode) and Globodera artemisiae species, Parasitol Res (2008), 103: 577-581. The classical PCR method, primer sequences and reaction conditions enabling the detection of Ditylenchus destructor are described in the publications: Subbotin SA, Madani M., Krall E., Sturhan D., Moens M. 2005. Molecular diagnosis, taxonomy, and phylogeny of the stem nematode Ditylenchus dipsaci species complex based on the sequences of the internal transcribed spacer-rDNA. Phytopathology 95, 1308-1315; Marek M., Zouhar M., Rysanek P., Havranek P. 2005. Analysis of ITS sequences of nuclear rDNA and development of a PCR-based assay for the rapid identification of the stem nematode Ditylenchus dipsaci (Nematoda: Anguinidae) in plant tissues . Helminthologia 42, 49-56 and

PL 230 915 Β1

Kerkoud M., Esquibet M., Plantard O., ΑνπΙΙοη M., Guimier C., Franek M. et al. 2007. Identification of Ditylenchus species associated with Fabaceae seeds based on a specific polymerase Chain reaction of ribosomal DNA-ITS regions. European Journal of Plant Pathology 118, 323-332.

Primers and restriction enzymes for the identification of 23 species of nematodes by PCR-RFLP belonging to the genera Nanidorus, Paratrichodorus and Trichodorus, including for the identification of Paratrichodorus teres, Trichodorus primitivus, Trichodorus similis, and Trichodorus viruliferus species were described by Kumaria S. and Subbotin S.A. in Molecular characterization and diagnostics of stubby root and virus vector nematodes of the family Trichodoridae (Nematoda: Triplonchida) using ribosomal RNA genes. 2012. Plant Pathology. Doi: 10.1111 / j. 1365-3059.2012.02598.x while Maafi TZ, Subbotin S., and Moens M. described PCR primers and conditions for the identification of Naccobus aberrans in Molecular Identification of cyst nematodes (Heteroderidae) from Iran and the phylogeny based on ITS1-rDNA sequences . 2003. Nematology 5: 99-111.

In the state of the art, there is still a need to provide a tool enabling the detection of selected nematode species that are not genetically identified, as well as an improved method of identifying those nematode species that are detected by known genetic techniques, but do not ensure high precision and do not exclude errors in the analysis.

The object of the invention is to provide a method that allows the identification of nematode species with high sensitivity and specificity. The aim of the invention is also to provide a method for the identification of nematodes which have not been detected so far by methods of analyzing the genetic material of the species tested. It is also an object of the invention to provide new nucleotide sequences of primers and probes or a non-obvious selection of known sequences and probes, applicable in the method of detecting nematodes by PCR, especially Real-Time PCR, regardless of the type of test, their origin and purpose and stage of development.

The above objectives have been achieved in the present invention.

The subject of the invention is a method of identifying nematodes in a soil sample selected from the group consisting of the species Ditylenchus destructor, Naccobus aberrans, Paratrichodorus teres, Trichodorus primitivus, Trichodorus similis, and Trichodorus viruliferus, including the following steps:

(a) providing a soil sample containing nematodes for identification;

b) rinsing the nematodes from the soil;

c) DNA isolation;

d) performing a PCR reaction, in particular Real-Time PCR, using a pair of 3 'and 5' primers and a probe;

e) comparison of the amplification curve of the test sample with the amplification curves of the blank sample and the negative control, and for the identification of one of the above species in the PCR reaction, especially

Real-Time PCR uses 3 'and 5' primers appropriate for a given species and a probe selected from the list:

Type 5 'starter 3 'starter Probe Name Sequence Name Sequence Name Sequence Dityienchits destrucłor Ddefv gtgacattcttcRgrgta Dderv aagcctttactttcatlgc Dde ccaatgactcgcacactcgtta Nacobbtts aberrans Nabfv caacca & atacaciguc Nabrv caggtcgaaattcaaatatg On B ctatccaacgcattcaacaacaacat Pa ra f rieb from ort ts tere s Ριυπ'ν gactgtagtcttcggarttg Pterrv cagagattcaatcgaccaa Pter eCEtstcctgltaccgagttg Trichodorus primitivits Tprimfv cccttgaactaggactgg Tpriinrv tcagccaaaagauagcac Tprim ccagtggaacgcatcatsacc Trichodorus similis Tsitnfv gactgtaggtutcggac Tsimrv gacaccatagaccttcag Tsim acttaccgt ełcctgtcc e a Trichodorus virulifenis Tvirfv ccgtgctttcatttagtc Tvirrv gacaccatagaccttcag Tvir ccactcattaaccgtacagccaa

The subject of the invention is also a kit for the identification of nematodes selected from the group consisting of the species Ditylenchus destructor, Naccobus aberrans, Paratrichodorus teres, Trichodorus primitivus, Trichodorus similis, and Trichodorus viruliferus, by the PCR method, especially Real-Time PCR, containing species-specific 3 'and primers 5 'and a probe selected from the list:

Type 5 'starter 3 'starter Probe Name Sequence Name Sequence Name Sequence Ditylenchus destructor Ddefv gigacattctTcggrgta Dderv aagcctttactttcattgc Dde ccaatgactcgcacactcgtta Nacf / bbiłs aberrans Nabfv caaccagatacactgttc Nabrv caggtcgaaattcaaatatg On B ctatccaacgcattcaacaacaacat Paratrichodorus teres Ptcrfv gaetgtagtcttcggatttg Ptcrrv cagagattcaatcgaccaa Pter ccgtgtcetgttaccga gttg Trichodorus primilivus Tprimfv cccttgaactaggactgg Tprimrv tcagccaaaagaaagcae Tprim ccaglg & aacgcatcatgacc Trichodorus similis Tsimfv gactgtaggtttlcggac Tsimrv gacaccatagaccttcag Tsim acttaccatgtcctgtccga Trichodorus viruiifems Tvirfv ccgtgctttcatttagtc Tvirrv gacaccatagaccttcag Tvir ccactcattaaccgtacagccaa

PL 230 915 Β1

The reaction mixture contains a buffer, thermostable Taq polymerase, magnesium ions, primers and a probe. The concentration of primers in the reaction mixture is 1-2 μM, probes 50-100 nM, magnesium ions 2-5 mM. The reaction is carried out at an annealing temperature of the primers of 55-60 ° C, in a volume of the reaction mixture of 10-20 µΙ, using 35 to 40 reaction cycles. Product identification is accomplished by comparing the amplification curves of the test sample with the amplification curves of the blank.

The names of the primer and probe sequences correspond to the following sequence numbers: Ddefv (SEQ ID NO: 1), Dderv (SEQ ID NO: 2), Dde (SEQ ID NO: 3), Nabfv (SEQ ID NO: 4), Nabrv (SEQ ID NO: 5), Neb (SEQ ID NO: 6), Pterfv (SEQ ID NO: 7), Pterrv (SEQ ID NO: 8), Pter (SEQ ID NO: 9) Tprimfv (SEQ ID NO: 10), Tprimrv (SEQ ID NO: 11), Tprim (SEQ ID NO: 12), Tsimfv (SEQ ID NO: 13), Tsimrv (SEQ ID NO: 14), Tsim (SEQ ID NO: 15), Tvirfv (SEQ ID NO: 16), Tvirrv (SEQ ID NO: 17), Tvir (SEQ ID NO: 18).

Fig. 1 shows the amplification curves for Ditylenchus destructor.

Fig. 2 shows the amplification curves for Naccobus aberrans.

Fig. 3 shows the amplification curves for Paratrichodorus teres.

Fig. 4 shows the amplification curves for Trichodorus primitivus.

Fig. 5 shows the amplification curves for Trichodorus similis.

Fig. 6 shows the amplification curves for Trichodorus viruliferus.

Examples of identifying each of the nematode species included in the set are given below. In each case, the same isolation and amplification conditions were applied to the blank (deionized H2O free from nuclease) and the negative sample. The material for the negative sample was DNA of a nematode species belonging to the same genus as the tested species, a mixture of equal amounts of nematode DNA belonging to the same species as the tested species, or in the absence of species belonging to the same genus, a species from the same family.

Example 1

Identification of the nematodes of the species Ditylenchus destructor.

DNA was isolated using Macherey-Nagel's commercial NucleoSpin Tissue XS DNA isolation kits. The reaction used primers and probes with the following sequences:

Starter / probe Sequence Ddefv gtgacattcttcggtgta Dderv aagcctttactttcattgc Dde ccaatgactcgcacactcgtta

The Real-Time PCR reaction was performed in a 20 μΙ mixture in a Qiagen RotorGene 6000 apparatus using reagents from the LuminoCt qPCR ReadyMix kit (Sigma-Aldrich) in the following amounts:

- Nuclease-free H2O up to a volume of 20 μΙ,

- 2 μ110.0 μΜ of each of the Ddefv and Dderv primers,

- 1 μΙ 4.0 μΜ Dde probe labeled at the 5 'end with JOE dye, and the 3' end with HBQ1 quencher,

- 10 μΙ 2X LuminoCt qPCR ReadyMix (Sigma-Aldrich),

- 2 μΙ DNA.

The reaction mixture was placed in a 20 μΙ tube, placed in the rotor of a RotorGene 6000 thermal cycler, and the amplification reaction was performed for 40 cycles under the following conditions:

Stage Temperature [° C] Time [s] Fluorescence measurement Pre-incubation 95 180 Amplification denaturation 95 thirty - connecting 55 thirty single synthesis 72 thirty - Cooling 40 twenty -

PL 230 915 Β1

DNA of the nematode Ditylenchus dipsaci was a negative control.

The amplification curves obtained from the performed analysis are shown in Fig. 1. Example 2

Identification of the nematodes Naccobus aberrans.

The isolation and amplification conditions were as set out in Example 1.

The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Nabfv caaccagatacactgttc Nabrv caggtcgaaattcaaatatg On B clalccaacgcattcaacaacaacat

The negative control was DNA of Rotylenchus buxophilus, Rotylenchus capitatus and Rotylenchus uniformis.

The amplification curves obtained from the performed analysis are shown in Fig. 2. Example 3

Identification of the nematodes of the species Paratrichodorus teres.

The isolation and amplification conditions were as set out in Example 1.

The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Pterfv gactgtagtcttcggaltlg Pterrv cagagattcaatcgaccaa Pter ccgtgtcctgttaccgagttg

DNA of the nematodes Paratrichodorus pachydermus, Trichodorus primitivus and Trichodorus sparsus was a negative control.

The amplification curves obtained from the performed analysis are shown in Fig. 3. Example 4

Identification of the nematodes of the species Trichodorus primitiyus.

The isolation and amplification conditions were as set out in Example 1.

The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Tprimfv ccctlgaactaggaetgg Tprimrv tcagccaaaagaaagcac Tprim ccagtggaacgcatcatgacc

DNA from the nematodes Trichodorus sparsus and Trichodorus viruliferus was a negative control. The amplification curves obtained from the performed analysis are shown in Fig. 4. Example 5

Identification of the nematodes of the species Trichodorus similis.

The isolation and amplification conditions were as set out in Example 1.

The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Tsimfv gactgtaggtttlcggac Tsimrv gacaccatagaccttcag Tsim acttaccgtgtcctgtccga

PL 230 915 Β1

DNA from the nematodes Heterodera schachtii, Paratrichodorus teres, and Trichodorus viruliferus were used as negative controls.

The amplification curves obtained from the performed analysis are shown in Fig. 5. Example 6

Identification of nematodes of the species Trichodorus yiruliferus.

The isolation and amplification conditions were as set out in Example 1.

The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Tvirfv ccgtgctttcatttagtc Tvirrv gacaccatagaccttcag Tvir ccactcattaaccgtacagccaa

DNA from the nematodes Trichodorus primitivus and Trichodorus sparsus was a negative control.

The amplification curves obtained from the performed analysis are shown in Fig. 6.

The solution according to the invention allows the detection of nematodes in soil within a few hours, including the stages of sample preparation, DNA isolation and Real-Time PCR. The method according to the invention can be used to identify the above-mentioned species of nematodes irrespective of the type of test, their origin and destination, and the stage of development.

The proposed set of probes enables the identification of the above-mentioned species of nematodes in the Real-Time PCR reaction, which is much more sensitive and faster than other PCR methods. The use of probes in the Real-Time PCR reaction significantly increases the specificity of the reaction in relation to the Real-Time PCR reaction with fluorescent dyes.

Claims (2)

Patent claims 1.Meaning of the identification of the nematode species Ditylenchus destructor, Naccobus aberrans, Paratrichodorus teres, Trichodorus primitivus, Trichodorus similis, and Trichodorus viruliferus, in a soil sample, including the following steps: (a) providing a soil sample containing nematodes for identification; b) rinsing the nematodes from the soil; c) DNA isolation; d) performing a Real-Time PCR reaction using a pair of 3 'and 5' primers and a probe; e) comparison of the amplification curve of the tested sample with the amplification curves of the blank sample and the negative control, with the identification of one of the above species in the Real-Time PCR reaction, using the species-specific 3 'and 5' primers and probes selected from the list: Type 5 'starter 3 'starter Probe Name Sequence Name Sequence Name Sequence Ditylenchus destructor Ddefv gtgacattcttcggtgta Dderv aagcctttactttcattgc Dde ccaatgactcgcacactcgtta Nacobbus aberrans Nabfv caaccagatacactgttc Nabrv caggtcgaaattcaaatatg On B ctatccaacgcattcaacaacaacat Paratrichodorus teres Pterl \ gactgtagtcttcggatttg Pterrv cagagattcaatcgaccaa Pter ccgtgtcctgttaccgagttg Trichodorus primitwus Tprimfv cccttgaactaggactgg Tprimrv tcagccaaaagaaagcac Tprim ccagtggaacgcatcatgacc Trichodorus sfinifis Tsimfv gactgtaggttttcggac Tsimrv gacaccatagaccttcag Tsim acttaccgtgtcctgtccga Trichodorus viruliferus Tvirfv ccgtgctttcatttagtc Tvirrv gacaccatagaccttcag Tvir ccactcattaaccgtacagccaa 2. Kit for the identification of the nematode species Ditylenchus destructor, Naccobus aberrans, Paratrichodorus teres, Trichodorus primitivus, Trichodorus similis, and Trichodorus viruliferus, using the Real-Time PCR method, containing species-specific starters 3 'and 5' and probes selected from the list: Type 5 'starter 3 'starter Probe Name Sequence Name Sequence Name Sequence Ditylenchus destructor Ddeft ' gtgacattcttcggtgta Dderv aagcctttactttcattgc Dde ccaatgactcgcacactcgtta Nacobbus aberrans Nabfv caaccagatacactgttc Nabrv caggtcgaaattcaaatatg On B ctatccaacgcattcaacaacaacat Paratrichodorus teres Pterfy gactgtagtcttcggatttg Ptcrrv cagagattcaatcgaccaa Pter ccgtgtcctgtlaccgagltg Trichodorus primitwus Tprimfy cccttgaactaggactgg Tprimrv tcagccaaaagaaagcac Tprim ccagtggaacgcatcatgacc Trichodorus similis Tsimfy gactgtaggttttcggac Tsimrv gacaccatagaccttcag Tsim a c tt ac c g tgtc ctgtc ega Trichodorus viridiferus Tvirfv ccgtgctttcatttagtc Tvirrv gacaccatagaccttcag Tvir ccactcattaaccgtacagccaa