PL230912B1 - Method and a kit for identification of nematodes, vegetable pests, by Real Time PCR based method - Google Patents

Abstract

A method and kit for identifying nematodes, vegetable pests, using the Real Time PCR method are disclosed. In particular, the invention relates to a method and kit for identifying nematodes including the species Helicotylenchus pseudorobustus, Heterodera carotae, Heterodera cruciferae, Heterodera humuli, Heterodera schachtii, Paratrichodorus minor, Paratylenchus bukowinensis and Paratylenchus nanus. Thanks to specifically selected primers and probes, the solution enables precise identification of selected nematode species regardless of the type of samples tested, their origin and purpose, and the stage of development.

Description

Description of the invention

The subject of the invention is a method and a kit for the identification of nematodes and vegetable pests by the Real Time PCR method. In particular, the invention relates to a method and a kit for the identification of nematodes selected from the group consisting of Helicotylenchus pseudorobustus species from the Hoplolaimidae family, Heterodera carotae, Heterodera cruciferae, Heterodera humuli and Heterodera schachtii from the Heteroderidae family, Paratrichodorus minor from the family of Trichodoridae, Paratrichodorus minor from the family of Parylenchodorusylenischidae. Tylenchulidae.

According to the latest classification, the Anguinidae family in Poland is represented by 34 species, Heteroderidae - 17 species, Meloidogynidae - 5 species, Pratylenchidae - 5 species, and 11 species have been found in the Trichodoridae family. Many of them are pests of arable crops. Infected plants have a damaged root system, and reduced water uptake leads to their dieback. The nematode species listed above are considered to be parasites or potential plant parasites. The ground part of the infected plant turns yellow and the tubers are smaller, covered with brown spots, which reduces their commercial value.

Identification of nematode species is based on the analysis of morphological and morphometric features, including the diagnosis of female coloration at various stages of development, cyst shape, length and shape of dagger tumors, length of invasive larvae, pattern on the perineal plate. However, this is a very laborious and time-consuming analysis. It requires a lot of knowledge and experience in working with biological material. Moreover, there is the possibility of overlapping dimensions of different species. The method based on the analysis of morphological and morphometric features cannot be used to identify adolescents in which morphological features are not yet developed.

Currently, techniques based on the analysis of nucleic acids, including the polymerase chain reaction (PCR), are increasingly used in nematological diagnostics. The basis of the PCR technique is the amplification of a DNA fragment (s) specific for a specific organism to a level that allows for its quick and simple detection using electrophoresis. This is achieved by using short single-stranded oligonucleotides (12-40 nucleotides), the so-called primers, specific for the amplified DNA fragment, and the enzyme - thermostable polymerase, which enables the amplification of the desired fragment in a cyclic, three-step reaction consisting of denaturation, primer binding and DNA synthesis. Typically, after about 30 reaction cycles, more than a million copies of the amplified DNA fragment are obtained, which can be identified by gel electrophoresis.

An improvement on the polymerase chain reaction is Real-Time PCR, that is, a PCR reaction with the measurement of the amount of amplified fragment in each reaction cycle. To measure the amount of the amplified fragment, fluorochromes (fluorescent dyes) are used, e.g. SYBR Green I, SYTO9, Eva Green, SYBR Gold, the fluorescence of which is proportional to the amount of the amplified fragment. Identification of the resulting products is carried out by measuring the amount of fluorescence and analyzing the melting curve of the reaction products without electrophoresis. The sensitivity of Real-Time PCR is much higher than that of traditional PCR, and the lack of electrophoresis shortens the analysis time. The disadvantage of Real-Time PCR with fluorescent dyes (similar to traditional PCR) is the limited specificity of the reaction. In most cases, the PCR reaction occurs not only when the primer sequence is 100% identical to the template sequence but also when 1-2 nucleotides are non-identical. This property of traditional PCR and Real Time PCR with fluorescent dyes requires precise setting of the thermal parameters of the reaction. Moreover, fluorescent dyes bind to each double-stranded DNA fragment, also resulting from primer amplification (primer-primer, primer-dimer products), which also requires careful selection of the appropriate concentration of primers. An alternative to fluorescent dyes are fluorescently labeled DNA probes. These are short sections of DNA, complementary to the searched sequence, which, when attached to DNA during PCR reactions, emit fluorescence at a specific wavelength. Currently, several types of probes are known, e.g. TaqMan, FRET, molecular beacons, and scorpions. The specificity of the Real-Time PCR reaction with labeled probes is much higher than with fluorescent dyes. Unlike primers, a single nucleotide mismatch in the probe sequence usually leads to no reaction or a very significant reduction in yield, which is easy to see when monitoring the course of the reaction or analyzing the results of the reaction.

PL 230 912 B1

Until now, the most frequently used method of molecular identification of nematodes was PCR-RFLP (Restriction Fragments Length Polymorphism). The restriction fragment length polymorphism method uses restriction enzymes that cut the DNA strand at a specific site for itself. Differences in the length of the cut DNA fragments indicate variability. Amiri S., Subbotin SA and Moens M., Identification of the beet cyst nematode Heterodera schachtii by PCR, European Journal of Plant Pathology (2002), 108: 497-506 analyzed a total of almost 60 cyst-forming nematodes using this method, which allowed them to select the appropriate restriction enzymes for the identification of H.schachtii, H.betae and H. trifolii. Subbotin SA, Waeyenberge L. and Moens M. used in their publication Identification of cyst forming nematodes of the genus Heterodera (Nematoda: Heteroderidae) based on the ribosomal DNA-RFLP, Nematology (2000), 2 (2): 153-164 until 26 different restriction enzymes: AluI, AvaI, BamHI, BglI, BsiZI, BsuRI, Bshl236I, Bspl43I, CfoI, Ddel, EcoRI, Hpall, Hindlll, Hinfl, KpnI, MvaI, Pstl, PvuII, PsalFI, SalispI, SfuI , TaqI, Tru9I and XbaI, thanks to which they identified 27 different species and types of nematodes in the sample, including H.carotae, H. cruciferae, Heterodera humuli and Heterodera schachtii.

The latest approach to molecular identification of nematodes is based on real-time polymerase chain reaction. Madani M., Subbotin SA and Moens M. in Quantitative detection of the potato cyst nematode, Globodera pallida, and the beet cyst nematode, Heterodera schachtii, using Real-Time PCR with SYBR green I dye, Molecular and Cellular Probes (2005), 19: 81-86 used specific primers and the fluorescent dye SYBR Green I to quickly identify species. They used a mix of primers described in previous publications - 0.1 pM of each primer: SH6Mod 5'-CGT GTT CTT ACG TTA CTT CAA-3 ' , SH4 5'-AGC ATG CGA AGG ATT GG-3 ', PITSp4 5'-ACA ACA GCA ATC GTC GAG-3' and Pal3 5'-ATG TTT GGG CTG GCA C-3 ', 12 pl dye and 4 pl DNA samples in a total final volume of 25 pl.

The identification of Helicotylenchus pseudorobustus by DNA sequencing has been described in the publications: Subbotin SA, Vovlas N., Yeates GW, Hallmann J., Kiewnick S., Chizhov VN, Manzanilla-López RH, Inserra RN, Castillo P. 2011. Diversity and phylogenetic relationships within the spiral nematodes of Helicotylenchus Steiner, 1945 (Tylenchida: Hoplolaimidae) as inferred from analysis of the D2-D3 expansion segments of 28S rRNA gene sequences. Nematology 13 (3): 333-345 and Subbotin SA, Vovlas N., Yeates GW, Hallmann J., Kiewnick S., Chizhov VN, Manzanilla-López RH, Inserra RN, Castillo P. 2015. Morphological and molecular characterization of Helicotylenchus pseudorobustus (Steiner, 1914) Golden, 1956 and related species (Tylenchida: Hoplolaimidae) with a phylogeny of the genus. Nematology 00: 1-26.

Identification of Paratylenchus bukowinensis by DNA sequencing is described in Subbotin S.A., Vovlas N., Crozzoli R., Sturhan D., Lamberti F., Moens M., Baldwin J.G. 2005. Phylogeny of Criconematina Siddiqi, 1980 (Nematoda: Tylenchida) based on morphology and D2-D3 expansion segments of the 28S-rRNA gene sequences with application of a secondary structure model. Nematology 7 (6): 927-944 a Paratrichodorus minor, Li X., Guo K., Zhang Y., Yan X., Zheng J. 2010. First Report of the Stubby Root Nematode, Paratrikhodorus minor in Mainland China. Plant Diseases 94 (3): 376 http://dx.doi.org/10.1094/PDIS-94-3-0376A. Identification of Paratylenchus nanus using the DNA sequencing technique has been described in the publications: Bae C.H., Szalanski A.L., Robbins R.T. 2009 Phylogenetic Analysis of the Hoplolaiminae Inferred from Combined D2 and D3 Expansion Segments of 28S rDNA. Journal of Nematology 41 (1): 28-34 and van den Berg E., Tiedt L.R., Subbotin S.A. 2014. Morphological and molecular characterization of several Paratylenchus Micoletzky, 1922 (Tylenchida: Paratylenchidae) species from South Africa and USA, together with some taxonomic notes. Nematology 16 (2014) 323-358.

In the state of the art, there is still a need to provide a tool enabling the detection of selected nematode species that are not genetically identified, as well as an improved method of identifying those nematode species that are detected by known genetic techniques, but do not ensure high precision and do not exclude errors in the analysis.

The object of the invention is to provide a method that allows the identification of nematode species with high sensitivity and specificity. It is also an object of the invention to provide a method for the identification of nematodes which have not been detected so far by methods of analyzing the genetic material of the species tested. It is also an object of the invention to provide new nucleotide sequences of primers and probes or a non-obvious selection of known sequences and probes, applicable in the method of detecting nematodes by PCR, especially Real-Time PCR, regardless of the type of test, their origin and purpose and stage of development.

PL 230 912 Β1

The above objectives have been achieved in the present invention.

The subject of the invention is a method of identifying nematodes in a soil sample selected from the group consisting of the species Helicotylenchus pseudorobustus, Heterodera carotae, Heterodera cruciferae, Heterodera humuli, Heterodera schachtii, Paratrichodorus minor, Paratylenchus bukowinensis and Paratylenchus nanus, including the following stages:

(a) providing a soil sample containing nematodes for identification;

b) rinsing the nematodes from the soil;

c) DNA isolation;

d) performing a PCR reaction, in particular Real-Time PCR, using a pair of 3 'and 5' primers and a probe;

e) comparison of the amplification curve of the tested sample with the amplification curves of the blank sample and the negative control, where the identification of one of the above species in the PCR reaction, especially Real-Time PCR, uses the species-specific 3 'and 5' primers and a probe selected from letters:

Type 5 'starter 3 'starter Probe Name Sequence Name Sequence Name Sequence HeiiiOlyffrndms pseudorobustus Hpsefv acggaccanggagtnag Hpserv ttgaccitciicuicaugc Hpse tltcgacgcccaiitgactcg Heterodera carotae Hcarfv ctsctgctggalcattac Hcarrv caaccgtagaggcgtaaa Hcar caiccatiagcgicagccagi Heterodera cruciferae Hcrufv cgccattggagtlatatc Hcrurv gcgattaniicatacagatca Hera cgaagcacatitagtcacaecga Faun heterodera? / Hhumfv glgcattacagacteacc Hhumrv cacacataccacsacua Hhum ccgaggacacalaaccacagl Heterodera schachtii Hsclifv aggcacataacacact & a Hsclirv ataocagcaapcacaaac Hsch ctgęgaacgaenccaccnEc Paratrichodorus minor Ρπιίηίν gctcgtctgątgtaaitag Pniinrv cttggtccgtgittcaag Pmin caccgiagaccuataagccaatc Para / yfenduts bufanvwensis Pbukfv cfggttgaggtgcattig Pbukrv giacgagcagaccaaaca Pbuk cugcggatcagcuctggac Paratylenchus ułiwts Pnanfv .cctcgtciggtgtaattag Pnanrv c t tg c tc c gtglt Icaag Pnan caccglagaccllalgagccautc

The subject of the invention is also a kit for the identification of nematodes selected from the group consisting of Helicotylenchus pseudorobustus, Heterodera carotae, Heterodera cruciferae, Heterodera humuli, Heterodera schachtii, Paratrichodorus minor, Paratylenchus bukowinensis and Paratylenchus nanus species, by PCR method, especially containing Real-Time 3 'and 5' primers and a probe selected from the list:

Type 5 'starter 3 'starter Probe Name Sequence Name Sequence Name Sequence Hciicołytcłichus pseudorobustus Hpsefv acggaccaaggagtitag Hpserv ngaccttcactttcaltgc Hpse Ittcgacgcccaatgactcg Heterodera carotae Hcarfy ctgctgciggatcauac Hcarrv caaccougaggcgiaaa Hcar catccanagcgtcagccagt flelerotlem cruciferae Hcrufy cgccattggagitaiatc Hcrtir? gcgaitaaacaiacagatca Hcru cgaagcacaiaagtcacaccga Heterodera Inunula Hhumfv glgcattacagaclgacc Hhumrv cacacagaccacgagttn Hhum cc gaggacacatiiaccucaBt Het e rade w & · & «chtii Hsc! Ifv aggcacataacacactga Hschrv giagcagcaageacaaac Hsch ctgssaacgacaccaccatc Paratrichodorus minor Pnnnfe gcicgicigąigtaaitag Pniinry cuggtccgtgittcaag Pmin caccgtagaccllalgagccaatc Paratylenchus bukowinensis Pbukfv ciggtigaggtgcattlg Pbukrv g t acgagcagaccaaaca Pbuk cttgcggatcnccttctggac Pclratylendnis nanus Pnanfv gctcgtciggtgfaattug Pnanrv cttggtccgtgtttcaag Pnan caccglagaccttatgagccaruc

The reaction mixture contains a buffer, thermostable Taq polymerase, magnesium ions, primers and a probe. The concentration of primers in the reaction mixture is 1-2 μM, probes 50-100 nM, magnesium ions 2-5 mM. The reaction is carried out at an annealing temperature of the primers of 55-60 ° C, in a volume of the reaction mixture of 10-20 µΙ, using 35 to 40 reaction cycles. Product identification is accomplished by comparing the amplification curves of the test sample with the amplification curves of the blank.

The sequence numbers of primers and probes correspond to the following sequence numbers:

Hpsefv (SEQ ID NO: 1), Hpserv (SEQ ID NO: 2), Hpse (SEQ ID NO: 3), Hcarfv (SEQ ID NO: 4), Hcarrv (SEQ ID NO: 5), Hcar (SEQ ID NO: 6), Hcrufv (SEQ ID NO: 7), Hcrurv (SEQ ID NO: 8), Hcru (SEQ ID NO: 9) Hhumfv (SEQ ID NO: 10), Hhumrv (SEQ ID NO: 11), Hhum (SEQ ID NO: 12), Hschfv (SEQ ID NO: 13), Hschrv (SEQ ID NO: 14), Hsch (SEQ ID NO: 15), Pminfv (SEQ ID NO: 16), Pminrv (SEQ ID NO: 17), Pmin (SEQ ID NO: 18), Pbukfv (SEQ ID NO: 19), Pbukrv (SEQ ID NO: 20), Pbuk (SEQ ID NO: 21), Pnanfv (SEQ ID NO: 22), Pnanrv ( SEQ ID NO: 23), Pnan (SEQ ID NO: 24).

PL 230 912 Β1

Fig. 1 shows the amplification curves for Helicotylenchus pseudorobustus.

Fig. 2 shows the amplification curves for the Heterodera carotae.

Fig. 3 shows the amplification curves for the Heterodera cruciferae.

Fig. 4 shows the amplification curves for the Heterodera humuli.

Fig. 5 shows the amplification curves for the Heterodera schachtii.

Fig. 6 shows the amplification curves for Paratrichodorus minor.

Fig. 7 shows the amplification curves for Paratylenchus bukowinensis.

Fig. 8 shows the amplification curves for Paratylenchus nanus.

Examples of identifying each of the nematode species included in the set are given below. In each case, the same isolation and amplification conditions were applied to the blank (deionized H2O free from nuclease) and the negative sample. The material for the negative sample was DNA of a nematode species belonging to the same genus as the tested species, a mixture of equal amounts of nematode DNA belonging to the same species as the tested species, or in the absence of species belonging to the same genus, a species from the same family.

Example 1

Identification of the nematode Helicotylenchus pseudorobustus.

DNA was isolated using Macherey-Nagel's commercial NucleoSpin Tissue XS DNA isolation kits. The reaction used primers and probes with the following sequences:

Starter / probe Sequence Hpsefv acggacca aggaglt lag Hpserv agaccticactttcatigc Hpse tttcgacgcccaatgactcg

The Real-Time PCR reaction was performed in a 20 μΙ mixture in a Qiagen RotorGene 6000 apparatus using reagents from the LuminoCt qPCR ReadyMix kit (SigmaAldrich) in the following amounts:

- Nuclease-free H2O up to a volume of 20 μΙ,

- 2 μ110.0 μΜ of each of the Hpsefv and Hpserv primers,

- 1 μΙ 4.0 μΜ of the Hpse probe labeled at the 5 'end with JOE dye, and the 3' end with HBQ1 quencher,

- 10 μΙ 2X LuminoCt qPCR ReadyMix (Sigma-Aldrich),

- 2 μΙ DNA.

The reaction mixture was placed in a 20 μΙ tube, placed in the rotor of a RotorGene 6000 thermal cycler, and the amplification reaction was performed for 40 cycles under the following conditions:

Stage Temperature [° C] Time [s] Fluorescence measurement Pre-incubation 95 and 80 - Amplification denaturation 95 thirty - connecting 55 thirty single synthesis 72 thirty - Cooling 40 twenty -

DNA of the nematodes Helicotylenchus exallus, Helicotylenchus varicaudatus and Helicotylenchus vulgaris was a negative control.

The amplification curves obtained as a result of the performed analysis are presented in Fig. 1.

PL 230 912 Β1

Example 2

Identification of the nematodes of the species Heterodera carotae.

The isolation and amplification conditions were as set out in Example 1. The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Hcarfv clgctgctggatcattac Hcarrv caaccglagaggcgtaaa Hcar catccattagcgtcagccagt

DNA from the nematodes Heterodera aver> ae, Heterodera goettingiana and Heterodera humuli were used as negative controls.

The amplification curves obtained from the performed analysis are shown in Fig. 2. Example 3

Identification of the nematodes of the species Heterodera cruciferae.

The isolation and amplification conditions were as set out in Example 1. The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Hcrufv cgccattggagttatatc Hcrurv gcgaitaaacaiacagalca Hcru cgaagcacataaglcacaccga

DNA from the nematodes Heterodera aver> ae, Heterodera goettingiana and Heterodera humuli were used as negative controls.

The amplification curves obtained from the performed analysis are shown in Fig. 3. Example 4

Identification of the nematodes of the species Heterodera humuli.

The isolation and amplification conditions were as set out in Example 1. The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Hhumfv gtgc attacagaclgac c Hhumrv cacacagac cacgagt la Hhum ccgaggacacataaccacagt

DNA from the nematodes Heterodera avenae, Heterodera cruciferae and Heterodera goettingiana were used as negative controls.

The amplification curves obtained from the performed analysis are shown in Fig. 4. Example 5

Identification of the nematodes of the species Heterodera schachtii.

The isolation and amplification conditions were as set out in Example 1.

PL 230 912 Β1

The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Hschfv aggcacalaacacactga Hschrv glagcagcaagcacaaac Hsch ctgggaacgacaccaccatc

DNA from the nematodes Heterodera avenae, Heterodera goettingiana and Heterodera humuli were used as negative controls.

The amplification curves obtained from the performed analysis are shown in Fig. 5. Example 6

Identification of nematodes of the species Paratrichodorus minor.

The isolation and amplification conditions were as set out in Example 1.

The following primers and probes were used in the Real-Time PCR reaction:

Slarter / probe Sequence Pminfv gctcgtctggtgtaattag Pminrv cttggtccgtgtttcaag Pmin caccgtagaccttatgagccaatc

DNA from Paratrichodorus teres and Paratrichodorus pachydermus was a negative control.

The amplification curves obtained from the performed analysis are shown in Fig. 6. Example 7

Identification of the nematodes of the species Paratylenchus bukowinensis.

The isolation and amplification conditions were as set out in Example 1.

The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Pbukfv ctggttgaggtgcatttg Pbukrv gtacgagcagaccaaaca Pbuk cttgcggatcagcttctggac

DNA of Paratylenchus nanus, Paratylenchus projectus and Paratylenchus straeleni were used as a negative control.

The amplification curves obtained from the performed analysis are shown in Fig. 7. Example 8

Identification of Paratylenchus nanus nematodes.

The isolation and amplification conditions were as set out in Example 1. The following primers and probes were used in the Real-Time PCR reaction:

Starter / probe Sequence Pnanfv gctcgtctggtgtaattag Pnanrv cttggtccgtgtttcaag Pnan caccgtagaccttatgagccaatc

The negative control was DNA of Paratylenchus bukowinensis, Paratylenchus projectus and Paratylenchus straeleni.

PL 230 912 Β1

The amplification curves obtained from the performed analysis are shown in Fig. 8.

The solution according to the invention allows the detection of nematodes in soil within a few hours, including the stages of sample preparation, DNA isolation and Real-Time PCR. The method according to the invention can be used to identify the above-mentioned species of nematodes irrespective of the type of test, their origin and destination, and the stage of development.

The proposed set of probes allows to identify the above-mentioned species of nematodes in the Real-Time PCR reaction, which is much more sensitive and faster than other PCR methods. The use of probes in the Real-Time PCR reaction significantly increases the specificity of the reaction in relation to the Real-Time PCR reaction with fluorescent dyes.

Claims (2)

Patent claims 1. The method of identification of the nematode species Helicotylenchus pseudorobustus from the family Hoplolaimidae, Heterodera carotae, Heterodera cruciferae, Heterodera humuli and Heterodera schachtii from the family Heteroderidae, Paratrichodorus minor from the family Trichodoridae, Paratylenchus bukowinensis and Paratylenchulidae from the Tylylenchulidae family: (a) providing a soil sample containing nematodes for identification; b) rinsing the nematodes from the soil; c) DNA isolation; d) performing a Real-Time PCR reaction using a pair of 3 'and 5' primers and a probe; e) comparison of the amplification curve of the tested sample with the amplification curves of the blank sample and the negative control, with the identification of one of the above species in the Real-Time PCR reaction, using the species-specific 3 'and 5' primers and probes selected from the list: Type 5 'starter 3 'starter Probe Name Sequence Name Sequence Name Sequence Helicotyfenchus pseudorobustus Hpsefv acggaccaaggagtttag Hpserv agaccttcactttcattgc Hpse tttcgacgcccaatgactcg Heterodera carotae Hcarfv ctgctgctggatcattac Hcarrv caaccgtagaggcgtaaa Hcar catccattagcgtcagccagt Heterodera cruciferae Hcrufv cgccattggagttatatc Hcrurv gcgattaaacatacagatca Hcru cgaagcacataagtcacaccga Heterodera humuli Hhumfv gtgcattacagactgacc Hhumrv cacacagsccacgagtta Hhum ccgaggacacataaccacagt Heterodera schachtii Hschhr aggcacataacacactga Hschnr gtagcagcaagcacaaac Hsch ctgggaacgacaccaccatc Paratrichodorus minor Pminfv gctcgtctggtgtaattag Pminrv cttggtccgtgtttcaag Pmin caccgtagaccttatgagccaatc Paratylenchus bukowinensis Pbukfv ctggttgaggtgcatttg Pbukrv gtacgagcagaccaaaca Pbuk cttgcggatcagcttctggac Paratylenchus nanus Pnanfv gctcgtctggtgtaattag Pnanrv cttggtccgtgtttcaag Pnan caccgtagaccttatgagccaatc PL 230 912 Β1 2. Kit for the identification of the species of nematodes Helicotylenchus pseudorobustus from the Hoplolaimidae, Heterodera carotae, Heterodera cruciferae, Heterodera humuli and Heterodera schachtii species from the Heteroderidae family, Paratrichodorus minor from the Trichodoridae family, Paratylenchus bukowinenusisis and Paratylenchulidae from the Tylenchulidae family by the real Tylenchus family for a given species, starters 3 'and 5' and probes selected from the list: Type 5 'starter 3 'starter Probe Name Sequence Name Sequence Name Sequence Helicotylenchus pseudorobustus Hpsefv acggaccaaggagtttag Hpserv agaccttcactttcattgc Hpse tttcgacgcccaatgactcg Heterodera carotae Hcarfv ctgctgctggatcattac Hcarrv caaecgtagaggcgtaaa Hcar catccattagcgtcagccagt Heterodera cruciferae Hcrufv cgccattggagttatatc Hcrurv gcgattaaacatacagatca Hcru cgaagcacataagtcacaccga Heterodera humuli Hhumfv gtgcattacagactgacc Hhumrv cacacagaccacgagtta Hhum ccgaggacacataaccacagt Heterodera schachtii Hschfv aggcacataacacactga Hschrv gtagcagcaagcacaaac Hsch ctgggaacgacaccaccatc Paratrichodorus minor Pminfy gctcgtctggtgtaattag Pminrv cttggtccgtgtttcaag Pmin caccgtagaccttatgagccaatc Paratylenchus bukowinensis Pbukfv ctggttgaggtgcatttg Pbukru gtacgagcagaccaaaca Pbuk cttgcggatcagcttctggac Paratylenchus nanus Pnanfv gctcgtctggtgtaattag Pnanrv cttggtccgtgtttcaag Pnan caccgtagaccttatgagccaatc Drawings