KR20150102744A - Woorimatori produced by using Korean native pure line duck and producing method thereof - Google Patents

Abstract

The present invention relates to a method for producing Woorimatori and the Woorimatori produced by the aforesaid method, which are characterized by including the following steps of: (a1) collecting native ducks from a first area; (a2) securing a group of dark brown native ducks by separating the collected native ducks from the first area in accordance with native duck separating criteria; (a3) securing the Woorimatori species ducks originated from the first area including the step of securing the species ducks of A system by hybridizing the secured dark brown native ducks in Step (a2); (b1) collecting the native ducks from a second area apart from the first area, in which no natural hybridizing can be taken place between the native ducks; (b2) securing a group of dark brown native ducks by separating the collected native ducks from the second area in accordance with the native duck separating criteria; (b3) securing the Woorimatori species ducks originated from the second area including the step of securing the species ducks of B system by hybridizing the secured dark brown native ducks in Step (b2); and (c) hybridizing the species ducks of the A system and the species ducks of the B system. The Woorimatori of the present invention may have a higher crude protein content and higher water holding capacity compared to common meat ducks. In addition, the Woorimatori has a delicate flavor, chewy flesh, and especially, a higher content of an arachidonic acid, which is one of essential fatty acids.

Description

[0001] The present invention relates to a method for producing duck duck,

The present invention relates to a new variety of native ducks produced by cross-breeding, and a method for producing the same, using the obedience of certain native ducks. Specifically, in order to develop domestic seeds with unique flavor and characteristics, we will collect seeds from all over the country, and make native duck genetic resources as a base group to enhance the degree of pureness, establish a system, And the method of producing it.

In recent years, Korean consumers have become increasingly demanding for their palatability, along with the improvement of income levels. Therefore, duck meat is known to be a healthy fatty acid, monounsaturated fatty acid content of meat, pork, chicken and other meat products more than twice, especially essential fatty acids such as linolenic acid and arachidonic acid in the blood to reduce the role of cholesterol . It also has alkaline properties to prevent acidification of body fluids, prevents skin aging, and is rich in vitamins and other minerals. As a healthy meat product, the annual consumption of duck meat per person has more than tripled in the past 10 years (Ministry of Food, Agriculture, Forestry and Livestock, 2013). However, more than 90% of ducks depend on imports, compared to the fast-growing duck meat consumption. In the sense of establishing seed sovereignty, it is urgently necessary to develop and distribute native varieties in Korea (FAO, 2007).

Most of the duck varieties distributed in Korea are breeding Peking species from ducks imported from Cherry Valley of England and Grimaud of France (Kim Hak-gyu et al., 2012). The Peking species has a pure white and yellow beak, while the native duck is a cultivar cultivated with Mallard ducks, so it is characterized by the appearance of a mallard duck, with females having a deep brown color and males with bronze heads (Livestock Research Institute, 1999).

The National Livestock Academy of Rural Development has collected and preserved native ducks from domestic private households since 1994 to prevent the loss of native ducks. After 1998, the ducks which are producing octopus were captured and further collected, In this way, a system of producing oaklan was established.

In 2008, a group of poultry mallards were divided into two groups, namely, the yogurans and the white molluscs. In 2009, the mating system for domestic ducks was studied to prepare for the diversification and functioning of duck consumption patterns. Since 2011, we have been developing seeds of domestic native seeds with additional flavor and characteristics and increased cultivation. New species with increased weight and taste Domestic seeds can produce new income sources of farm households and produce duck products that are distinguished from foreign species, thereby securing marketability and competitiveness.

Growth rates, survival rates, and the number of laying hens tend to be superior to those of their parents' breed or lineage, which is called heterosis. Generally, breeding hybrids are used as a paternal system when hybridization is used. Hybrid breeding pairs are used as maternal systems because they have good ability of spawning as well as spawning ability. Research has been carried out on the production of domestic practical ducks with improved meat quality and improved growth through hybrid densities using domestic duck purebreds developed in Korea.

In the meantime, there have been no studies that have confirmed the genetic information of native ducks. In particular, there is little research on the development of markers that can be used to identify individuals and identify varieties. Jin et al. (2014) investigated the markers capable of discriminating among the varieties of ducks, white buffalo ducks, and domestic ducks in wild ducks, and found that the mtDNA COI (Cytochrome c oxidase I) gene or D -loop control region, but it is difficult to distinguish between ducks and ducks and ducks.

Microsatellite (MS) markers in the DNA markers that can distinguish the breeds accurately have a repeating structure of 2 to 5 bp short nucleotide sequence and are widely distributed on the genome and are more mutated than other gene markers. (Cheng and Crittenden, 1994; Blott et al., 1999; Lim et al., 2009; Seo et al., 2013) have been widely used for the production of pigs and chickens.

Therefore, this study is meaningful for the identification and identification of native ducks and the identification of MS markers that can be used to classify cultivars with practical ducks and to utilize them for establishment and breeding strategies of native duck varieties.

Accordingly, the present invention has been made to solve the above-mentioned problems, and to produce a native Korean duck duck which is excellent in economy and productivity and superior in taste and quality than alien species.

In addition, we will establish a mass production system by establishing the production system of domestic dumplings,

In the present invention, a systematic composition of domestic native ducks and hybridization of the established lines are proposed to suggest the development of Korean duck ducks and new duck seeds.

Through the present invention, MS markers which can be used for the classification of the domestic ducks and the ducks of the practical ducks are searched for in the establishment and breeding strategies of native ducks.

In order to solve the above-mentioned problems, the present invention provides a method for producing a new variety of Korean dumpling ducks by crossing species ducks having different strains.

Specifically, the method for producing or developing the Korean dumpling of the present invention

(a1) collecting native ducks in a first area;

(a2) sorting the native ducks collected in the first area according to a native duck selection criterion described later to secure a group of black-brown native ducks; And

(a3) a step of crossing the black brown native duck obtained in the step (a2) to establish a species duck of line A, securing a duck duck duck originating from a first area, and

(b1) collecting native ducks in a second area which is remote from the first area and in which native mating can not occur between native ducks;

(b2) sorting native ducks collected in the second area according to a native duck selection criterion to be described later to secure a group of black-brown native ducks; And

(b3) a step of crossing the black brown native duck obtained in the step (b2) to establish the species B duck, and securing the duck native duck originating from the second region,

(c) crossing the A species duck and the B species duck.

In the method for producing the duck duck, the ducks of the system A selected from native ducks collected in the first region and the ducks of the first region are spontaneously mated with the ducks far away from the first region And crossing the established species D of the selected lineage among the native ducks collected in the area where it is not possible.

Preferably, the selection criteria for establishing the longitudinal ducks of the A line and the B line are blackish brown (black, white, black, and black and white, Is at least 1000 g, more preferably at least 1,100 g, even more preferably at least 1,200 g.

The second area may be an area of a radius of 30 km outside the first area. Preferably, the first area may be a long area and the second area may be a Hampyung area.

That is to say, the present invention was made through the following process.

First,

First, it was necessary to collect a large number of seedlings collected from several farms. In addition, the introduction of generations of genetic resources has restricted the rapid rise in proximity of the population.

Second,

In order to establish a group that meets the development purpose, we planned (classification - standardization, mass). In the natural hybridization state, . In the classification criteria, the search for genetic phenomena has been enhanced to improve the accuracy, and sufficient consideration has been given to the weight to prevent the ability of the major economic traits to be excluded.

Third,

From the broad base group, various varieties were obtained, and the lineage and the line of mother lines were separated from each other in the same variety, and the hybridization effect was maximized and the uniformity was increased in practical duck production. Short - term tests were carried out to shorten generation intervals and perform accurate assessment of performance. This study was conducted to investigate the taste of domestic ducks during the ability test.

Fourth,

We have selected crossbred combinations with excellent binding ability through the intergenerational crossing test and developed the maintenance, propagation and propagation method of the crossbred from the determined crossbreeding combination.

Domestic native ducks are mallards (Anasplatyrhynchos) belonging to the geese, which are native to wild ducks for use in duck farming.

The Korean dumplings produced through the above method are purebreds or hybrids as domestic practical ducks. "My Duck Duck" is produced by 2, 3 and 4 circle hybridization of bell ducks. In other words, it is produced by obedience of domestic ducks or crossbreeding.

As used herein, the term "Pure Line (PL) " refers to a conventional breed that has maintained pure lineage without mixing with other varieties.

"Grandparent Stock (GPS)" is a binary hybrid of pure duck and pure duck, which means a duck generation for production of bell duck (PS).

"Parent Stock (PS)" refers to a genus of ducks for producing practical ducks (CDs) from 2 to 4 hybrid varieties of pure, duck, and pure duck.

"Commercial Duck (CD)" is produced by mating between a pure duck, a duck duck and a duck duck. It means a duck, a spawning duck and a combined duck which are raised in a general farmhouse. It is a concept that includes our taste ducks.

According to another embodiment of the present invention, the present invention provides a duck duck produced by the method for producing duck duck.

The above-mentioned mussels are cross-bred from females of the black-brown native species Duck A lineage and females of the B lineage system, which are collected locally distant to such a degree that natural crossing can not occur; Or black-brown native species Duck A females and B male females.

For the purpose of the present invention, the Korean mussel can be produced by crossing a male of a black-brown native species Duck A system between 21 and 80 wks after hatching and a female of a black-brown native duck B system between 24 and 80 wks after hatching . In addition, for the purpose of the present invention, the Korean mussel is produced by mating females of the black-brown native species Duck A from 24 to 80 wks after hatching and males of the black-brown native duck B system between 21 and 80 wks after hatching .

The present invention of the present invention is to provide a method for producing the duck meat of the present invention. The content of polyunsaturated fatty acids in breast meat is high, and the content of arachidonic acid, which is an essential fatty acid, is high.

In the above-mentioned Korean dumpling, the content of arachidonic acid is 6 wt% or more (preferably 6 to 10 wt%) based on the total weight of the fatty acids in the total fatty acids contained in the breast meat, . ≪ / RTI >

Also, according to the present invention, the watery ducks have high water holding capacity (%) of more than 40% on the basis of chest meat and have characteristics comparable to those of general ducks.

The present invention is directed to a practical duck produced by using a species-fixed duck in the National Livestock Academy.

In the present invention, the above-mentioned black brown domestic ducks are homogenized through development of seeds among ducks raised in Korea from the past. Among the domestic black-brown, dark brown, gray brown, gray and white domestic species, use. The characteristics of native ducks are weak, hungry, and vigorous. The external dendritic features of the native ducks are oval-shaped, smooth and well-balanced. The weight of the native duck is about 2.5 to 3.5 kg, and the egg weight is about 71 to 93 g, which is about 86 g on average.

The term " native duck " in the present specification means a case of receiving at least 70 points according to the criteria and procedure for native livestock according to Article 2-2, Paragraph 2 of the Enforcement Rule of the Ministry of Food, Agriculture, Forestry and Livestock.

The appearance criteria of the native ducks for each line are shown in Tables 1 and 2 below.

In addition, Korean native Duck (Woorimatori), which is a native Korean duck, has excellent growth and spawning ability. The shape of the body is oval and smooth, and the head and the beak are generally well balanced. The beak is wide and medium in length and has yellow, black and bronze colors. The head is slightly small, and the head of the male is bronze colored at the breeding season, black and brown at the non-commercial season, and the head of the female is black and brown. The eyes are round and the color is black and brown. Necks are moderately shifted from head to toe. Male ducks may have a white band at the border of head and neck. Neck color is brown. The feathers of the wings are brown on the outside, white on the inside, and often have a blue stripe on the wing and a white line on both sides of the wing. The back is well transited from the neck to the tail, and the color is brown and black. The color of the tail is generally black and brown, and the tip of the tail is curled up. The trunk is smooth and round, and the skin is light gray or light dark brown. The chest is wide open, well developed oval, dark brown and grayish white. Four toes are yellow and black, and there are webbing between toes. The ear is next to the eye and is not easy to look at. The properties are gentle, have excellent quality of meat and meat quality.

The Minister of Agriculture, Forestry, and Fisheries of the Ministry of Agriculture, Forestry and Fisheries for the efficient management of agricultural genetic resources has the authority to preserve and preserve agricultural genetic resources in accordance with the Law Concerning the Preservation and Management of Agricultural Genetic Resources (Act No. 200917.27, Article 18 has been entrusted to the Director of the Rural Development Agency. (2) The applicant who wishes to receive a pre-sale by the method and procedure of the pre-sale application shall submit the application form of the pre-sale form of the annexed Form No. 1 to the Rural Development Administration In order to receive the above varieties, it is necessary to obtain permission from the head of the Rural Development Administration.

On the other hand, in order to receive patents on animals, animal embryos must be deposited in research institutes approved by the government. Most embryos deposited with the depository should be stored for a long period of time, so they must undergo a viability test before embryos are frozen and stored. The purpose of freezing the embryos is to preserve certain animal lines for a long period of time, to thaw them if necessary, and then transplant them into the surrogate mother. The basic principle of embryo freezing is to remove the water (cell water) components present in the cells by using a cryoprotectant and osmotic phenomenon, to inhibit the formation of ice crystals in the cell and to find survival after fusion. However, in the case of avian eggs, the embryo is in egg form, and the eggs of the outermost eggs are shell-free for protection of the eggs. Therefore, since it is impossible to deposit the embryo of the present invention, the present invention enables reproducibility in the production of the duck duck using the varietal fixed obedience.

According to another embodiment of the present invention, the present invention relates to a method for selecting and amplifying a supersatellite locus combination capable of distinguishing between domestic ducks and pseudo-ducks, And identifying a standardized genotype by analyzing the size of the duck and native ducks, and a marker composition and kit for identification.

(A) obtaining a nucleic acid sample to be analyzed; (b) amplifying with multiplex PCR using primers specific for native ducks and duck ducks; (c) detecting an allele of the amplified product of step (b) and determining a genotype; And (d) preparing a distribution of the number and frequency of alleles using the allele genotype of the locus of the super-satellites of the native ducks and the wild ducks.

The selection of the supersatellite loci was made by considering the comprehensive amplification conditions (annealing temperature of the primer, product size, labeling fluorescent material), mixing the primers according to the concentration to prepare the reaction solution for the amplification reaction, The satellite loci are amplified by Multiplex PCR method. The amplified product was isolated using an automatic DNA sequencer, and the distribution and size of the alleles of each locus were analyzed. Based on these analysis data, genetic markers were selected for the identification of the individual of the taste duck , We provide a way to identify the individual of the taste duck.

The number of alleles of the supersatellite locus for selecting the supersatellite locus is preferably at least 3, more preferably at least 4, and most preferably at least 5 alleles.

Preparation of primers using the supersatellite locus of the present invention should be performed in consideration of multiplex PCR conditions such as annealing temperature and amplification product size.

According to one embodiment of the present invention, in order to select an individual of the taste duck, the locus of each super-satellite locus composed of CAUD111, AMU68, APH04, APH08, CAUD005, AMU3, CAUD069, CAUD086, APH20, CAUD066, APH24, CAUD040 and CAUD048 A specific binding set can be used.

The nucleotide sequence of the nucleotide sequence of the nucleotide sequence in which some of the nucleotide sequences of the primers are replaced with other nucleotides and / or the positions and orientations of the nucleotide sequences are changed may also be included in the scope of the primer according to the present invention.

According to an embodiment of the present invention, it is also possible to provide a kit for identifying an individual of the taste bud containing the marker composition as an active ingredient.

The amplified product after PCR was electrophoresed using ABI-3730 DNA automatic nucleotide sequencer (Applied Biosysytems, USA) to be classified by size and fluorescent substance, and PCR was performed using GeneMapper version 4.0 (Applied Biosystem, USA) Data can be collected by classifying by product size and type of marker.

Alleles of each microsatellite markers were determined by analysis group and individual using microsatellite toolkit software (Park, 2000) The expected heterozygosity and observed heterozygosity

heterozygosity, allele frequency, number of alleles at each locus, and number of alleles per breed population.

The method of the present invention for analyzing the Mycorrhizae can be used to construct a standardized integrated database of alleles using a supersatellite gene and can be used to distinguish our taste ducks. In particular, the MS markers of the present invention can exhibit excellent individual discrimination.

According to another embodiment of the present invention, there is provided a primer set specifically binding to each super-satellite locus consisting of CAUD111, AMU68, APH04, APH08, CAUD005, AMU3, CAUD069, CAUD086, APH20, CAUD066, APH24, CAUD040, And a marker composition capable of identifying an individual of our taste duck.

In another embodiment of the present invention, there is provided a kit for identifying a taste buds comprising the marker composition.

The mozzarella according to the present invention is excellent in economical efficiency and productivity, and is superior in flavor and taste to alien species in terms of taste and quality.

In addition, the mass production system can be established by establishing the production system of the domestic duck duck weed duck.

In the present invention, the low-acid growth of the common native duck is improved, and the taste and flavor are excellent.

In addition, the present invention has a higher crude protein and water-holding capacity than that of a common duck, and has a soft texture and a chewy texture. Furthermore, the breast meat of the Korean dumpling has a high content of polyunsaturated fatty acids and a high content of arachidonic acid, which is an essential fatty acid.

In general, Korean native ducks are superior in taste and meat quality to foreign introduced varieties. However, since they are light in weight and have fewer layings, they are economically disadvantageous to be used as meat ducks. Therefore, Ducks can be provided.

The microsatellite marker composition of the present invention can clearly distinguish the genetic difference between the taste buds of the present invention and thereby improve the individual discrimination ability.

Figure 1 is a schematic representation of the method of producing duck duck.
FIG. 2 shows a result of a schematic drawing using 24 marker genotypes. 2, it was confirmed that the microsatellite markers of the present invention can be used to distinguish between the Korean duck ducks and the practical ducks. KND means native duck duck, and CD means practical duck.
Figure 3 is a PI, PI _half between genotype _{- sibs} And PI _sibs Lt; / RTI >

Hereinafter, embodiments of the present invention will be described in detail to facilitate understanding of the present invention. However, the embodiments according to the present invention can be modified into various other forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the invention are provided to more fully describe the present invention to those skilled in the art.

1. Development of native duck

Domestic ducks are also called traditional ducks. The ducks that have been raised since then have been hybridized with migratory birds and are adapted to the climate of our country. The dominant species of native ducks are mainly poultry mallards that resemble mallards but do not fly well. The present inventors recognized the importance of the native seeds and started collecting native duck seeds which have been maintained throughout the country. The inventors established a basic group based on the features of black brown duck duck appearance while hatching 10,000 collected seeds. Based on these seeds, we created a family of small groups in which relationships are formed within a single line, by selecting individuals whose appearance and ability test are relatively excellent or expressing phenotype fixedly.

This process was repeated several generations to breed a specific strain with a fixed purity. For the generation of purebred genera, about 1,500 male ducks and 1,500 male ducks were selected, and about 30% of them were selected. In the selected line, 20 subgroups were constructed to prevent the increase in the degree of crossing when crossing . Selection was made on the basis of the test results of individual traits of major traits such as appearance and weight, and appearance selection was made according to the characteristics of Tables 1 and 2 for each line in accordance with the hatching, Respectively. The results of this study were as follows: 1) The ability to improve and select the ability was tested for 210 days by the initial generation test, and the major traits by hatching, breeding, Lineage, and individual, and maintained the generation through lineage management, selection, and isolation.

2. Our taste duck  Production method and distribution system

After the hatching, male domesticated species between 21 and 80 weeks old are crossed with domesticated domestic domesticated duck female to produce domestic domesticated ducklings. This native Korean duck duck improved the production ability by improving the low duck ability of the existing domestic duck. The domestic native duck duck produced in this way has economic efficiency because it has improved economic ability and it can be used within 8 weeks for tang, , About 56 days for rearing period, it can be used as duck for bakery, smoked, roasted and fried dumplings of 2.8 kg or more. As a result, a production form of duck-practical duck that can be industrialized is achieved, and our duck duck can be produced.

3. Our taste duck  How to breed

The weed duck chicks produced in the present invention are transferred to a broiler farm and maintained at a temperature of about 32 ° C (± 2 ° C) for the first week. When the cabbage is dried at room temperature in the initial high temperature, the appetite declines, growth stagnation, and mortality are maintained, thus maintaining proper humidity of about 60 ~ 70%. Excessive marsupiality in the house causes delays in growth and mortality, so we have to adjust the breeding density according to the season. Since water is essential for physiological mechanisms such as duck temperature control, metabolism and respiration, the water dispenser is installed within a 2 m radius. The first gathering of vitamins, etc., was diluted with water and the feed was boiled for 2 hours and then fed.

Because our duck duck is used for meat, it is a principle to maintain the nutrient content of the duck forage. It is desirable to increase the feed nutrient content because the growth is rapid, and the feed nutrient content as shown in Table 3 is appropriate. Table 3 below shows the nutrient content of the Korean dumpling diets by breeding stages.

nutrient Weekly 0 to 3 3 to 8 ME (kcal / kg) 2,900 3,000 CP (%) 22.0 18.0 Lee Sin (%) 0.90 0.73 Methionine + cystine (%) 0.70 0.60

ME: Metabolism energy

CP: Crude protein

A range of ± 10% of the above nutrient content is preferred.

Because the duck ducks are native breeds for egg production, they should be managed in accordance with the ducks and managed to induce spawning throughout their lives.

Nutrient content of Korean duck duck species duck

nutrient Weekly 0 to 4 4 to 20 After 20 weeks ME (kcal / kg) 2,900 2,900 2,900 CP (%) 22 16 15 calcium (%) 0.65 0.60 3.0 sign (%) 0.40 0.30 0.28

A range of ± 10% of the above nutrient content is preferred.

Example  One: Our taste duck Appearance characteristics  And Ability of the child , Duck meat characteristics

Korean duck ducks were produced by crossing male black and brown Korean native breeding ducks and female black and brown Korean native breeding ducks.

It is also possible to cross a male of a black-brown native duck A strain between 21 and 80 weeks of age after hatching and a female of a black-brown native duck B line between 24 and 80 weeks after hatching, or between the above- A female of the system A and a male of the black-brown native duck B strain between the ages of 21 and 80 weeks after hatching are produced by mating (Fig. 1).

1) Appearance characteristics

Our taste ducks are homogeneous in appearance because their genetic traits are based on obedience. There are differences in appearance depending on the obedience used, and mainly blackish brown or grayish brown color is expressed. The dichromatic yellow color is yellow or black, and it can be easily distinguished from the white appearance of the general duck duck.

2) Development

If the growth rate of native duck duck is fast, it takes a long time to reach the shipment weight, and it is economical because the amount of feed required for the gland is small. It is considered to be very efficient because it can be used as white duck, roasted and smoked duck with 2.8kg when the raising period is about 56 days, and it is economically advantageous because of high availability of feed. Table 5 shows the gross weight gain for each mating combination of duck duck. Average weight of each dumpling by weight (unit: g)

Mating combination Weekly 0 2 4 6 8 AA * 52.3 ± 0.65 ^ab 613.8 ± 11.9 1,626 ± 11.1 ^ab 2,441 ± 22.4 ^bc 2,762 ± 30.5 ^b AB 50.1 ± 0.88 ^b 633.1 + - 7.77 1,575 ± 16.3 ^b 2,376 ± 15.1 ^c 2,807 ± 40.3 ^ab BB 52.0 ± 1.05 ^ab 632.7 ± 2.49 1,644 ± 7.82 ^a 2,573 ± 9.51 ^a 2,949 ± 42.5 ^a BA 53.7 ± 0.12 ^a 621.0 + - 16.1 1,621 ± 22.5 ^ab 2,474 ± 48.2 ^b 2,830 ± 55.1 ^ab Average 52.1 ± 0.51 ^A 625.2 ± 5.22 ^B 1,617 ± 10.1 ^C 2,466 ± 24.5 ^D 2,837 ± 27.8 ^E

AA: A (female) x A (male), BB: B x B, AB: A x B, BA: B x A

3) Feeding rate

It is very important to select ducks that have low feed requirement for growth because the ratio of feed cost to domestic duck production cost is about 70%. The feed conversion ratios between the mating combinations of Korean dumplings were lower than those of AB and BA matings. Feed conversion ratio

Mating combination Weekly Average
(0 to 8 weeks old) 0 to 2 2 to 4 4 to 6 6 to 8 AA 1.20 ± 0.03 1.92 ± 0.05 3.47 ± 0.02 10.6 ± 0.37 3.26 ± 0.05 AB 1.13 + 0.03 1.86 ± 0.02 3.34 0.11 8.01 + - 0.66 3.07 ± 0.01 BB 1.15 ± 0.01 1.90 + 0.04 3.25 ± 0.06 9.75 + 1.42 3.15 ± 0.11 BA 1.20 ± 0.03 1.74 ± 0.08 3.21 ± 0.19 9.12 + -0.61 3.01 ± 0.11 Average 1.17 ± 0.01 1.86 + 0.03 3.32 ± 0.06 9.37 ± 0.46 3.13 + 0.04

4) Physical properties of native duck meat

The physical properties (meat color, heat loss and shear force) of our duck duck are shown in Table 7. At 6, 7, and 8 weeks of age, the lightness (L *) and heat loss decreased with age. The redness (a *) and yellowness (b *) of meat color were not different between 6 and 8 weeks old.

At 6, 7, and 8 weeks of age, the chemical properties decreased with the passage of time and protein increased.

Physico-chemical properties of our duck meat

division 6 weeks old 7 weeks old 8 weeks old CIE   L (brightness) 41.8 ± 0.78 ^a 39.0 ± 0.51 ^b 38.1 ± 0.21 ^b   a (redness) 17.9 ± 0.62 17.8 ± 0.29 17.6 + - 0.46   b (yellow degree) 6.50 ± 0.23 6.52 ± 0.25 6.57 + - 0.41 Heat loss,% 31.6 ± 0.48 ^a 27.9 ± 0.31 ^b 25.4 ± 0.29 ^c Shear force, kg / 0.5inch ² 3.45 ± 0.26 3.13 ± 0.15 2.98 ± 0.23 moisture, % 78.2 ± 0.09 ^a 76.4 ± 0.18 ^b 75.1 + - 0.11 ^c Fat, % 0.82 + 0.13 ^b 1.06 + 0.08 ^b 1.88 ± 0.16 ^a protein, % 19.0 ± 0.11 ^c 20.3 ± 0.13 ^b 20.9 ± 0.07 ^a View minutes,% 1.06 + - 0.01 ^b 1.13 + 0.01 ^a 1.10 ± 0.02 ^a

1) CIE (Commision Internationale de Leclairage): L * = brightness, a * = redness, b * = yellowness.

2) Warner-Bratzler shear force

Table 8 below shows the meat quality characteristics of the dumplings.

Our taste duck meat is relatively high in crude protein and water holding capacity, and has a unique flavor due to its fleshy texture. The content of polyunsaturated fatty acid in chest meat is high, and especially the content of arachidonic acid, which is an essential fatty acid, is high.

division protein
(%) Water holding capacity
(%) zest Flavor Texture Purity Polyunsaturated fatty acid Arachidonic acid Native duck 21.8 ^a 48.2 ^a 7.4 ^a 6.4 7.2 ^a 7.6 ^a 32.1 ^a 7.5 ^a A common duck 20.2 ^b 36.5 ^b 6.0 ^b 5.8 5.8 ^b 6.4 ^b 30.8 ^b 5.4 ^b

Example  2: Our taste duck Bellied Appearance characteristics  And scattering ability

1) Appearance characteristics

Because the genetic traits are based on obedience, the duck ducks are uniform in appearance. Depending on the obedience used, there is a difference in appearance, blackish brown or grayish-brown feathery color is expressed, dichromatic yellow is yellow or black, and it is easily distinguishable from the white appearance of a common duck. It has the ability to raise and has a relatively good spawning ability. Through our mating of two kinds of duck ducks A, B, we produce practical duck, our duck duck.

2) Development

Generally, it is economically advantageous that the weight of the duck for the purpose of scattering is small. The native duck for the purpose of meat must be breed to the side with high weight and high egg production. Therefore, the ducks for producing duck ducks weigh more than 3,000 g at 20 weeks of age.

system Weight (g / h) 0 weeks old 4 weeks old 8 weeks old 12 weeks 16 weeks 20 weeks old A (♀) 51.8 ± 0.25 1,203 ± 26.4 ^ab 2,505 ± 22.7 ^c 2,969 ± 50.2 ^c 3,068 ± 81.7 ^b 3,098 + - 79.3 ^b A (♂) 50.2 ± 0.37 1,145 ± 15.4 ^b 2,713 + - 61.4 ^b 3,398 ± 31.3 ^b 3,492 ± 34.4 ^a 3,302 ± 50.1 ^a B (♀) 50.5 ± 0.38 1,268 ± 31.4 ^a 2,617 ± 59.8 ^bc 3,101 ± 48.7 ^c 3,164 ± 51.6 ^b 3,277 ± 46.9 ^ab B (♂) 50.4 ± 0.15 1,201 ± 49.4 ^ab 2,927 ± 31.8 ^a 3,613 ± 60.7 ^a 3,676 ± 51.7 ^a 3,457 ± 37.4 ^a

A: korean Native Duck A Strain

B: korean Native Duck B Strain

Table 10 below shows the average body weight (unit: g) of each wet weight of each spawning season of the Korean dumpling.

system Length (weeks) 24 32 40 48 56 64 72 80 A 3,215 3,057 2,767 2,739 3,296 3,404 3,168 3,111 B 3,197 2,979 2,727 2,650 3,205 3,470 3,328 3,273 Average 3,206 3,018 2,747 2,695 3,251 3,437 3,248 3,192

* 40 to 48 weeks: lowered feed intake in summer, 64 weeks: lowered in winter

Table 11 shows the distribution of body weight, body weight, body weight, Our Taste Ducks Ducks Systematic Starters Ages, Lanterns & Weights

system Ability of acupuncture Day (Sun) Lunar (g) Weight (g) A 175.8 ^a 75.2 3,245 B 171.5 ^b 74.9 3.225 Average 173.7 75.1 3,235

The mean age of the first day of the first day of egg laying was found to be more than 50% for 2 consecutive days for each repetition. The average age of the eggs for each repetition was 175.8 days and 171.5 days The average egg weight was 75.1g and the mean weight was 3,235g.

3) Spawning ability

From the time of the test to the end of the test, the ratio of the number of eggs to the number of eggs per year was calculated at intervals of 4 weeks. The egg production rate by the age of the spawning period of the duck ducks in Korea (Unit:%)

system Mainland 20 to 80 20 to 24 24-28 28 ~ 32 32 to 36 36-40 40 to 44 44 ~ 48 48-52 52-56 56 to 60 60 to 64 64 to 68 68 ~ 72 72 ~ 76 76 to 80 A 11.1 68.3 82.7 83.4 81.5 72.8 71.5 64.2 63.6 60.0 52.4 46.4 49.2 63.3 71.3 62.8 B 14.5 84.4 88.0 86.6 85.7 77.2 80.3 81.2 74.7 63.0 61.8 51.6 55.3 68.5 81.1 70.3 Average 12.8 76.3 85.3 85.0 83.6 75.0 75.9 72.7 69.1 61.5 57.1 49.0 52.2 65.9 76.2 66.5

The egg - laying rate of duckweed ducklings dweller ranged from 32 to 36 wks with a maximum of 85.3% at 28 ~ 32 wks, and the egg - laying rate tended to decrease after 40 wks. The egg production rate of A and B strains was 62.8 and 70.3%, respectively, up to 80 weeks of age. The egg production rate was 49% at the age of 64 ~ 68 weeks in winter, but the egg production rate gradually increased with the wintering season and the egg production rate increased to 76.2% at 76 ~ 80 weeks of spring. These results suggest that the domestic duck has a great influence on the spawning as well as the lighting stimulus.

The number of spawning was ranged from 4 weeks to 80 weeks of age. Table 13 shows the number of laying eggs per dwelling system of the duck ducks. The number of laying eggs per dwelling species of ducklings (unit: dogs)

system Growth period (weeks) 20 to 24 20 to 28 20 to 32 20 to 36 20 to 40 20 to 44 20 to 48 20 ~ 52 20 ~ 56 20 to 60 20 to 64 20 to 68 20 to 72 20 ~ 76 20 to 80 A 3.4 15.4 38.7 60.3 82.4 103.7 121.8 137.9 152.7 168.0 180.5 193.4 204.7 218.7 235.5 B 5.5 21.7 45.0 67.0 89.9 110.4 131.1 152.8 172.7 190.0 205.1 219.2 232.7 248.6 267.5 Average 4.4 18.6 41.9 63.7 86.2 107.0 126.4 145.3 162.7 179.0 192.8 206.3 218.7 233.7 251.5

The average number of spawning of the A and B strains was 86.2 and 82.4 and 89.9, respectively. The A and B strains were 204.7 and 232.7, respectively, with a mean of 218.7 strains at 72 weeks of age. 235.5 and 267.5, respectively, representing an average of 251.5. In addition, the B strain tended to have more spawning than the A strain. From the above results, it is considered that for the production of the duck duck, the system B would be a female line and the system A would be used as a male line.

4) Lanzhou

The total egg weight (except for the anomalies and open waves) scattered by the repetition of each week from the time of the test to the end of the test was divided by the total number of eggs, Table 14 shows the average egg weight according to the age of the ducks of the Korean mussel ducks. Eggs from 28 to 32 weeks old started egg laying of 80g or more at 80.4 and 78.2g in A and B strains and 90.1 and 90.9g in eggs A and B at 52-56 weeks respectively Respectively. Mean egg weight was 86.5 and 85.6g in the A and B strains from 20 to 80 weeks of age, respectively.

The average egg weight per spawning season of the duck ducks ducks (g)

system Growth period (weeks) 20 to 80 20 to 24 24-28 28 ~ 32 32 to 36 36-40 40 to 44 44 ~ 48 48-52 52-56 56 to 60 60 to 64 64 to 68 68 ~ 72 72 ~ 76 76 to 80 A 73.8 75.1 80.4 84.8 86.4 86.7 85.9 88.5 90.1 92.7 91.6 93.1 89.9 89.9 89.3 86.5 B 68.4 77.2 78.2 79.5 81.2 84.3 84.4 88.9 90.9 92.4 92.5 92.6 91.6 90.0 92.2 85.6 Average 71.1 76.2 79.3 82.1 83.8 85.5 85.1 88.7 90.5 92.5 92.0 92.9 90.7 90.0 90.8 86.1

Example  3. Our taste  For identification of ducks Marker  Composition development

(1) Disclosure materials and DNA  extraction

Blood was collected from 20 juvenile duck ducks, commercial duck (CD) 20 juvenile veins and stored in tubes containing EDTA. 20 μl of each blood sample was fractionated and DNA was extracted using PrimePrep ™ Genomic DNA isolation kit for blood kit (GeNet Bio, Korea). The extracted DNA was analyzed by electrophoresis using agarose gel and DNA and NanoDrop 2000C spectrophotometer (Thermo Scientific, USA), and then stored at 20 ° C until MS marker genotype analysis was performed.

(2) Of the candidate marker  Selection and Marker  making

Based on the results of Maak et al. (2003) and Yinhua (2005; 2006) who confirmed MS marker mutations for studying individual identification and diversity of Peking ducks, 100 candidate markers were selected. To confirm the amplification of each marker, a square and reverse primer with no fluorescence dye was prepared and electrophoresis was performed to confirm the size and number of bands in native duck and Korean duck group. The presence or absence of the marker was confirmed. Among the identified markers, 29 markers were selected for PCR amplification and mutation confirmation. For analysis of MS marker genotypes, each marker square primer was subjected to Fragment analysis using GA3130xl (ABI, USA), and a square primer with fluorescence dye was prepared for amplification and used for amplification (Table 15).

No Marker Name Genebank ID chromosome Forward Primer Reverse Primer Size  ( bp ) Dye One ¹ CAUD111 AY587030 CAU5 CTGACATTACACACCCAAACAGC CTTGACAAACTTTGGGAACAAGG 101 FAM 2 ¹ CAUD127 AY587046 CAU1 CAAGCAATCTCACCTTCCTGC CCAGATAAAACAATAGATCCAGATG 204 FAM 3 ¹ CAUD132 AY587051 CAU12 GCAGGAACTCCCAGGAAAG CTTGTAGCCGTAGGATTGAGAC 308 FAM 4 ¹ AMU52 AB180534 CAU10 CTGAGTTTCTCACTGCCCAAGTG CTTCGAGTTAAGACAACAGCAGAC 189 NED 5 ¹ CAUD044 AY493289 CAU10 GCTCTAGGGTGAACTCTGTATCTCA GTGCTCTACCTACTAGTCATGACACT 271 NED 6 ¹ AMU68 AB180549 CAU9 CACGAGGAACAGGACTACA GAGCATACGATCCATGTCGG 371 NED 7 CAUD076 AY493321 CAU7 CCTGGAACAAGGAATTAGAAG GCTGTTGGGAAGAGTTCAGTG 123 PET 8 ¹ CAUD009 AY493254 NA CACATCGGGAGGGATTTTGGA GGAAATGCGGCTTAATGACAGC 248 PET 9 CAUD049 AY493294 CAU2 CCTGTAGTTTAGTTGCTGGATA CATTCCACAATACTTAGAGCAGATGGAG 341 PET 10 ¹ APH04 AJ515884 CAU6 GCTGCCTTCCACAACACTAC CGTCATGGTGCAGCTATCG 132 VIC 11 ¹ AMU123 AB180602 NA GAATCACCGAGTGGTGTTCAGG CAAATGGTGATAAATGAAACCTCACAGG 231 VIC 12 AMU63 AB180545 NA GCGCAGATAAAGGCGGAGG GATCTCCGAAAGAGAGGAGG 323 VIC 13 ¹ APH08 AJ515887 CAU6 CTGTGAAGCGAGCTAATTCAGC GTGTGCATCTGGGTGTGTATG 107 FAM 14 ¹ CAUD005 AY493250 CAU1 CTGGCTGCTTCATTGCTGA CACATCTCAGGTCCTACAAGAC 216 FAM 15 ¹ CAUD128 AY587047 NA GGCTGCTCCATGACAGGAG CTAGTTGTCCAGCAAAGACAATGC 399 FAM 16 CAUD109 AY587028 CAU4 GGGACTTTGCTGTTAACATTGC CTCCTCAGGTGTTTCCACAC 188 NED 17 CAUD001 AY493246 CAU11 ACAGCTTCAGCAGACTTAGAACTG TGAGCTTCAGGTGAAATCCATGT 303 NED 18 ¹ AMU3 AB180488 NA CTGAACCTGGCGGTATAAAGTGA CTTCTTGGCAATGTCTTGAAGTGG 231 PET 19 ¹ CAUD069 AY493314 CAU1 CTACTCAGTGTGCCTAATACCTC GGTTAGTGAGTGAAGGGAGTT 349 PET 20 ¹ CAUD086 AY493331 CAU1 CTGCATCCAAACTAGGCAGAC CAGACACCTACGGATATCGCTC 187 VIC 21 ¹ APH20 AJ515895 NA CTGCGTTCATGACATTGTGAAGTG GAGGCTTTAGGAGAGATTGAAAAAGTAC 277 VIC 22 ¹ CAUD066 AY493311 CAU1 GCAGGAAAGGAAGTGAGCC GCTCTGTTGCTCTTGTAACGAG 179 FAM 23 ¹ APH24 AJ515899 CAU3 ACTAATCAACCAGTGGTCAGAGA CTGGAAACACTCTTGCGAATTCAG 282 FAM 24 ¹ CAUD039 AY493284 CAU1 CAGAGAGTGAAAGCTGCTGC ACATGCCACTTGAACTTAATCAGGAA 249 NED 25 ¹ CAUD040 AY493285 CAU12 CTTGACGTTTCCTCACTGGAGA GTTTACGCTGTGCGTGACTC 350 NED 26 ¹ CAUD011 AY493256 NA CAGGCTTCCTTACAGTTGTGTG TCCAAGCCACCTACAGAGGT 284 PET 27 ¹ CAUD031 AY493276 CAU1 GGTAACTGTGTGCAGTGGTTTC CCTCCTGTCAAACAGGATCA 373 PET 28 ¹ CAUD035 AY493280 CAU6 GCTTCACTGCAGAACCAACTG CAAGCAGGTTGGCTTCCAG 217 VIC 29 ¹ CAUD048 AY493293 CAU11 CTGGACATCATTGCACAGACATAGT GACCTCAGAAATCTGCTGTTAGCT 336 VIC

* NA: not available; ¹ analyzed markers

(3) PCR  Amplification and Fragment 분석

PCR amplification of the markers obtained by mutation confirmation was performed using 2.5 mM dNTPs (GenetBio, Korea), 10X reaction buffer (GenetBio, Korea) and 2.5 units of prime Taq DNA polymerase (GenetBio, Korea) PCR amplification was performed. The amplification conditions were pre-denaturation at 95 ° C for 10 minutes, followed by denaturation at 95 ° C for 30 seconds, annealing at 63 ° C for 30 seconds, extension at 72 ° C for 30 seconds, and final extension at 72 ° C for 10 minutes To obtain an amplified product. The obtained amplified products were diluted with 10 ~ 20X dilutions per marker, and 10 μl of HI-DI ^™ Formamide (ABI, USA) and 1 μl of 500LIZ ^™ 0.1 ㎕ of sizestandard (ABI, USA) was added and Fragment analysis was performed using GA3130xl (ABI, USA).

(4) MS Marker  Genotyping and statistical analysis

Genomic information of the acquired markers was generated by setting binary information for each genotype using Genemapper 4.1 (ABI, USA) program. Cervus 3.0.6 (Marshall et al., 1998) was used to analyze the number of alleles (N), expected heterozygosity (Hexp) and polymorphism information content (PIC) (Liu and Muse, 2005) were used to confirm the genetic distance and Neighbor-Joining (NJ) systematics of the two groups. In addition, we used API_CALC ver 1.0 (Ayres and Overall, 2004) to determine the frequency of occurrence of the same species in arbitrary populations.

Example  4. MS Marker  Genotype identification and polymorphism

(One) MS Marker  Genotype identification

The genotypes of MS markers in duck and practical ducks were confirmed. Of the 29 markers selected, only 24 markers showed correct genotypes. In the five markers CAUD001, CAUD019, CAUD049, CAUD076, and AMU62, And were excluded from genotype assurance. The total number of alleles (N), heterozygosity (Hexp), and polymorphism (PIC) of the two groups were 4.7, 0.554 and 0.495 in the total of 24 MS marker genotypes except 5 markers. These results are shown in Table 16 below.

Marker
Name Our taste duck (KND) Practical Duck (CD) N HObs HExp PIC N HObs HExp PIC CAUD111 6 0.789 0.794 0.739 7 0.8 0.749 0.699 CAUD127 2 0.211 0.273 0.231 5 0.55 0.524 0.455 CAUD132 2 0.211 0.273 0.231 3 0.2 0.268 0.238 AMU52 One 0 0 0 One 0 0 0 CAUD044 4 0.421 0.404 0.365 4 0.45 0.387 0.351 AMU68 3 0.737 0.61 0.528 5 0.8 0.658 0.592 CAUD009 2 0 0.114 0.105 3 0.05 0.188 0.174 APH04 5 0.158 0.727 0.666 4 0.25 0.501 0.438 AMU123 4 0.263 0.405 0.368 2 0.2 0.185 0.164 APH08 7 0.579 0.748 0.696 5 0.55 0.546 0.455 CAUD005 5 0.765 0.754 0.692 6 0.7 0.656 0.603 CAUD128 3 0.368 0.317 0.275 3 0.35 0.312 0.282 AMU3 4 0.294 0.606 0.513 4 0.55 0.565 0.504 CAUD069 13 0.722 0.884 0.847 12 0.8 0.853 0.815 CAUD086 5 0.789 0.755 0.69 4 0.55 0.758 0.69 APH20 3 0.526 0.647 0.553 3 0.6 0.565 0.461 CAUD066 4 0.526 0.643 0.568 4 0.412 0.594 0.505 APH24 5 0.421 0.606 0.509 3 0.235 0.469 0.375 CAUD039 4 0.579 0.558 0.475 5 0.65 0.642 0.553 CAUD040 12 0.789 0.811 0.77 12 0.85 0.883 0.847 CAUD011 4 0.632 0.585 0.478 2 0.4 0.431 0.332 CAUD031 4 0.579 0.552 0.441 2 0.4 0.328 0.269 CAUD035 5 0.526 0.482 0.443 4 0.55 0.573 0.518 CAUD048 6 0.833 0.743 0.686 7 0.6 0.715 0.65 Average 4.7 0.488 0.554 0.495 4.6 0.479 0.515 0.457

In the taste duck population, the CAUD069 marker showed 13 alleles, 0.884 heterozygosity, and 0.847 polymorphism (Table 16). In our taste duck population, CAUD009 marker with two alleles was 0.114 The polymorphism of 0.105 showed the minimum value. The number of alleles, heterozygosity, and polymorphism in our duck and practical ducks were slightly different, but most markers showed the same level of alleles, heterozygosity, and polymorphism. In particular, the AMU52 markers were confirmed to be mutated in one allele in both the taste duck group and the utility duck group (Table 16). The results show that Botstein et al. (1980) showed that when the heterozygosity (Hexp) of each marker is greater than 0.6 and the polymorphism (PIC) is greater than 0.5, It was found that 13 markers were available in our taste duck group and 8 markers were available in the practical duck group. Therefore, when these markers are preferentially selected and combined, it is considered that they can be used for identification of individuals, breed identification, and product registration. These results indicate the possibility of using MS markers in identification of individual species and classification of cultivars (Seo et al., 2013; Choi et al., 2013).

(2) Analysis of varietal lineage and frequency of occurrence of the same species, paternity identification rate analysis

Genetic distances of the two groups were calculated using 24 markers to analyze the Neighbor-Joining (NJ) scheme of the obtained marker genome by PowerMarker 3.25 program. And it was confirmed that the groups were relatively close to each other. However, when we compare genetic distance differences between individuals, the practical ducks 35 and 36 samples show the closest distance to the genetic distance of 0.1774, and the samples of our duck duck 16 and practical duck 40 are 0.7351 Because it was shown to show distant genetic distance, the similarity of the group was confirmed but it seems that the difference of specific individuals is apparent. As shown in Fig. 2, 3 groups were formed by using the 24 markers genotypes of each individual. As a result, these groups were found to contain a mixture of Korean duck ducks and practical duck samples. However, We found that the group containing mainly ducks was formed, and that one group formed the group containing mainly the duck ducks. These results confirmed the possibility of breed classification through selection using genetic information of selected markers.

To determine the rate of the individual identification marker secured to the same object, the calculated occurrence frequency results in any group ^{(PI) 1.64 × 10 -16,} 2.60 × 10 -7, any group at any hyeongmae (PI _sib) half hyeongmae group ( PI _{half - sib} ) to 1.30 × 10 - ¹² , indicating the frequency of occurrence of the same individuals converging to zero in all groups, so that the markers used in this study can be fully utilized as individual identification markers . In order to combine the efficiency of the markers and the economical markers, the markers having high heterozygosity and polymorphism were selected and the minimum number of markers converging on the identification rate of 0 was checked. As a result, from the use of only the 13 markers of the present invention, (See FIG. 3). In addition, since their paternity confirmation rate is 0.999975, it shows paternity confirmation rate close to 100%. Therefore, the markers obtained in this study can be useful as individual identification and paternity markers.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Woorimatori produced by Korean native pure line duck and          producing method thereof <130> P15-048 <150> 10-2014-0024557 <151> 2014-02-28 <160> 58 <170> Kopatentin 2.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CAUD111_Forward Primer <400> 1 ctgacattac acacccaaac agc 23 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CAUD111_Reverse Primer <400> 2 cttgacaaac tttgggaaca agg 23 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CAUD127_Forward Primer <400> 3 caagcaatct caccttcctg c 21 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CAUD127_Reverse Primer <400> 4 ccagataaaa caatagatcc agatg 25 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CAUD132_Forward Primer <400> 5 gcaggaactc ccaggaaag 19 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CAUD132_Reverse Primer <400> 6 cttgtagccg taggattgag ac 22 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> AMU52_Forward Primer <400> 7 ctgagtttct cactgcccaa gtg 23 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AMU52_Reverse Primer <400> 8 cttcgagtta agacaacagc agac 24 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CAUD044_Forward Primer <400> 9 gctctagggt gaactctgta tctca 25 <210> 10 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CAUD044_Reverse Primer <400> 10 gtgctctacc tactagtcat gacact 26 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AMU68_Forward Primer <400> 11 cacgaggaac aggactaca 19 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AMU68_Reverse Primer <400> 12 gagcatacga tccatgtcgg 20 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CAUD076_Forward Primer <400> 13 cctggaacaa ggaattagaa g 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CAUD076_Reverse Primer <400> 14 gctgttggga agagttcagt g 21 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CAUD009_Forward Primer <400> 15 cacatcggga gggattttgg a 21 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CAUD009_Reverse Primer <400> 16 ggaaatgcgg cttaatgaca gc 22 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CAUD049_Forward Primer <400> 17 cctgtagttt agttgctgga ta 22 <210> 18 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> CAUD049_Reverse Primer <400> 18 cattccacaa tacttagagc agatggag 28 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CAUD049_Forward Primer <400> 19 cctgtagttt agttgctgga ta 22 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CAUD049_Reverse Primer <400> 20 cgtcatggtg cagctatcg 19 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AMU123_Forward Primer <400> 21 gaatcaccga gtggtgttca gg 22 <210> 22 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> AMU123_Reverse Primer <400> 22 caaatggtga taaatgaaac ctcacagg 28 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AMU63_Forward Primer <400> 23 gcgcagataa aggcggagg 19 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AMU63_Reverse Primer <400> 24 gatctccgaa agagaggagg 20 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> APH08_Forward Primer <400> 25 ctgtgaagcg agctaattca gc 22 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> APH08_Reverse Primer <400> 26 gtgtgcatct gggtgtgtat g 21 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CAUD005_Forward Primer <400> 27 ctggctgctt cattgctga 19 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CAUD005_Reverse Primer <400> 28 cacatctcag gtcctacaag ac 22 <210> 29 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CAUD128_Forward Primer <400> 29 ggctgctcca tgacaggag 19 <210> 30 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CAUD128_Reverse Primer <400> 30 ctagttgtcc agcaaagaca atgc 24 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CAUD109_Forward Primer <400> 31 gggactttgc tgttaacatt gc 22 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAUD109_Reverse Primer <400> 32 ctcctcaggt gtttccacac 20 <210> 33 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CAUD001_Forward Primer <400> 33 acagcttcag cagacttaga actg 24 <210> 34 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CAUD001_Reverse Primer <400> 34 tgagcttcag gtgaaatcca tgt 23 <210> 35 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> AMU3_Forward Primer <400> 35 ctgaacctgg cggtataaag tga 23 <210> 36 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AMU3_Reverse Primer <400> 36 cttcttggca atgtcttgaa gtgg 24 <210> 37 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CAUD069_Forward Primer <400> 37 ctactcagtg tgcctaatac ctc 23 <210> 38 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CAUD069_Reverse Primer <400> 38 ggttagtgag tgaagggagt t 21 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CAUD086_Forward Primer <400> 39 ctgcatccaa actaggcaga c 21 <210> 40 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CAUD086_Reverse Primer <400> 40 cagacaccta cggatatcgc tc 22 <210> 41 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> APH20_Forward Primer <400> 41 ctgcgttcat gacattgtga agtg 24 <210> 42 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> APH20_Reverse Primer <400> 42 gaggctttag gagagattga aaaagtac 28 <210> 43 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CAUD066_Forward Primer <400> 43 gcaggaaagg aagtgagcc 19 <210> 44 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CAUD066_Reverse Primer <400> 44 gctctgttgc tcttgtaacg ag 22 <210> 45 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> APH24_Forward Primer <400> 45 actaatcaac cagtggtcag aga 23 <210> 46 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> APH24_Reverse Primer <400> 46 ctggaaacac tcttgcgaat tcag 24 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAUD039_Forward Primer <400> 47 cagagagtga aagctgctgc 20 <210> 48 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> CAUD039_Reverse Primer <400> 48 acatgccact tgaacttaat caggaa 26 <210> 49 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CAUD040_Forward Primer <400> 49 cttgacgttt cctcactgga ga 22 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAUD040_Reverse Primer <400> 50 gtttacgctg tgcgtgactc 20 <210> 51 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CAUD011_Forward Primer <400> 51 caggcttcct tacagttgtg tg 22 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAUD011_Reverse Primer <400> 52 tccaagccac ctacagaggt 20 <210> 53 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CAUD031_Forward Primer <400> 53 ggtaactgtg tgcagtggtt tc 22 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CAUD031_Reverse Primer <400> 54 cctcctgtca aacaggatca 20 <210> 55 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CAUD035_Forward Primer <400> 55 gcttcactgc agaaccaact g 21 <210> 56 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> CAUD035_Reverse Primer <400> 56 caagcaggtt ggcttccag 19 <210> 57 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> CAUD048_Forward Primer <400> 57 ctggacatca ttgcacagac atagt 25 <210> 58 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> CAUD048_Reverse Primer <400> 58 gacctcagaa atctgctgtt agct 24

Claims (9)

(a1) collecting native ducks in a first area;
(a2) sorting the native ducks collected in the first area according to native duck selection criteria to secure a group of blackish brown native ducks; And
(a3) a step of crossing the black brown native duck obtained in the step (a2) to establish a species duck of line A, securing a duck duck duck originating from a first area, and
(b1) collecting native ducks in a second area which is remote from the first area and in which native mating can not occur between native ducks;
(b2) sorting the native ducks collected in the second area according to native duck selection criteria to secure a group of blackish brown native ducks; And
(b3) a step of crossing the black brown native duck obtained in the step (b2) to establish the species B duck, and securing the duck native duck originating from the second region,
(c) crossing the A-species duck and the B-species duck
How to produce our new taste duck duck. [3] The method according to claim 1, wherein the selection criteria for establishing the longitudinal ducks of the A-line and the B-line are blackish-brown in appearance and have a body weight of 1000 g or more at 4 weeks of age. 2. The method of claim 1, wherein the first area is a wall area and the second area is a hamping area. A new variety produced by the method of any one of claims 1 to 3. [Claim 5] The method according to claim 4, wherein the flavored duck meat comprises 6 to 10% by weight of arachidonic acid in the total fatty acids contained in the breast meat, based on the total weight of fatty acids. [Claim 5] The novelty taste duck according to claim 4, wherein the taste duck has a water holding capacity (%) of not less than 40%. 5. The method of claim 4, wherein the weed duck has a yellow, black or bronze color of the beak; The head of the male is bronze colored at the breeding season; It is black, brown or dark brown in the non-season; The head of a female is black, brown or dark brown; The eyes are round and the color is black and / or brown; Neck is shifted from head to back; The male duck may have a white band at the border of the head and neck, and the neck color is brown; The feathers of the wing are brown on the outside and white on the inside; The back is transited from neck to tail, the color is brown and / or black; The color of the tail is generally black and / or brown; The tip of the tail is curled up; The trunk is smooth and rounded; The skin is light gray or light dark brown; The chest is dark brown and / or grayish white; Four toes are yellow and / or black; There is a webbed between the toes. A locus for identification of our taste duck object comprising a primer set that specifically binds to each of the supersatellite loci consisting of CAUD111, AMU68, APH04, APH08, CAUD005, AMU3, CAUD069, CAUD086, APH20, CAUD066, APH24, CAUD040, Composition. 9. A kit for identifying a taste bud of a mussels comprising the marker composition according to claim 8.

Images