KR101891553B1 - A method of producing Woorimatdag No. 2 and Microsatellite marker composition for identification of Woorimatdag No. 2 - Google Patents

Abstract

The present invention relates to a method and apparatus for identifying and identifying a Korean animal No. 2 individual comprising a primer set that specifically binds to each super-satellite locus consisting of MCW0063, MCW0087, LEI0141, MCW0039, MCW0264, ADL0317, ROS0013, ADL0159, MCW0228, MCW0213, LEI0074, and LEI0135 And a method for identifying an individual of the present invention using the same. The marker composition of the present invention enables a distinctive breed classification by suggesting a method of molecular genetic level that can distinguish Korean chicken 2 from other breeds. In addition, it is possible to construct a standardized integrated database, and it can be usefully used as a basic data for the breed classification and breeding plan establishment of our poultry practical system.

Description

Technical Field [0001] The present invention relates to a method for producing the Tuna chicken No. 2 and a method for producing the same. 2 and Microsatellite marker composition for identification of Woorimatdag No. 2. 2}

The present invention relates to a method for producing Korean milk tuna chicken No. 2 and a supersatellite marker composition for identification of Korean tuna chicken No. 2 produced using the same. Specifically, the present invention relates to a production method of Korean milk chicken No. 2 produced using domestic native chicken poultry, and a marker composition for distinguishing Korean milk chicken No. 2 from other varieties.

Chicken native to Korea has been passed down from Korea since ancient times, and its productivity and economic efficiency have been lower than that of birds, laying hens and modified breeds coming from foreign countries. With the tendency to prefer livestock products with good taste and quality in recent years, the demand for traditional chicken has increased and the number of breeding has been increasing as the number of consumers who are looking for native species that meet our food quality has increased. However, fake native chickens produced by hybridization between laying hens and imported broilers, various kinds of chicken of unknown origin, and hybrid chickens appeared to lead to consumer distrust of native chickens. In addition, the conventional chicken has been lacking in uniformity of quality, improved in quality of production traits, and has not been established so that it has been difficult to standardize and industrialize production.

Therefore, the National Livestock Academy has gathered native breeding chickens scattered throughout the country since the 1992s, and has been focusing on the appearance and body shape, and has been making the first generation of red chicken breed, yellow brown breed, melanoma, white breed, To restore the pure-line native chicken. The restoration of the varieties was completed in 2007 by increasing the purity of the varieties so that they did not mix with other varieties for 15 years.

The offspring by interbreeding or interbreeding tend to be superior to those of their parents, such as growth rate, survival rate and number of laying hens, which is called heterosis. In general, the hybrid system is used as a paternal system, while the hybrid system is used as a maternal system because of its good ability to breed and scatter. Research has been carried out to produce a domestic practical system with excellent meat quality and improved growth through the use of native breeding poultry, which is fully indigenized in Korea. Industrialization research focusing on mass production has been carried out by establishing the production system of the pure - chicken - seed - chicken - breed - practical system, which is a chicken production method.

As a result of these studies, various domestic practical systems including Korean Chicken Nos. 2 and 3 (Korean Patent Application No. 10-2012-0055590) are being studied.

However, since the expression traits such as feather color are similar to those of native chickens such as native chickens and Korean horses, we need verification markers at the level of molecular genetics.

On the other hand, microsatellite (MS) is a repetitive DNA group consisting of about 2 to 6 nucleotide sequences, and is a non-coding DNA sequence that is uniformly distributed within the genome and exhibits a very high polymorphism. to be. When there is a polymorphism between varieties in the number of repeats, when a polymerase chain reaction (PCR) is performed using a primer designed in the adjacent region, The polymorphism is observed in the PCR product length and the DNA polymorphism can be detected. In addition, the supersatellite, like other genes, is transmitted to the offspring according to the Mendel's law of genetics and can be amplified by PCR and co-dominant when electrophoresed. In particular, because the size of the supersampler is small, it is possible to simultaneously amplify two to eight primers, thereby reducing time and cost for analyzing the polymorphism of the gene, and can easily analyze alleles of these genes. Through these analyzes, the supersatellite is recognized as an important DNA marker for analyzing the relationship between genetic diversity and genetic components in a group genetics field, which includes humans, mammals, fishes, and plants.

The inventors of the present invention have found that standardized genotypes can be determined as a result of efforts to accurately identify alleles of supersatellite loci and standardize them to develop an efficient method for identifying a Korean mutant.

Accordingly, the present invention provides a marker composition for discriminating between a different breed and a Korean chicken No. 2, which is difficult to distinguish clearly by expression traits, and an identification method using the marker composition.

The present invention relates to a chicken produced through multifunctional breeding between domestic and domestic native chicken breeding poultry, native chicken poultry and domestic poultry breeding poultry which has been restored and cultivated for 19 to 44 years and has excellent economic efficiency and productivity, And it is aimed to establish the production system of Woori chicken 2, a native type chicken.

Through the molecular genetically established identification method of the present invention, we intend to utilize it as a basic data for breed classification and breeding plan establishment of our poultry practical system.

In order to solve the above problems, the present invention relates to a method and apparatus for selecting and amplifying a supersatellite locus combination capable of distinguishing a variety of wild relatives between a Korean chicken 2 and other cultivars, detecting alleles, A second object identification method, a marker composition for identification, and a kit.

(A) obtaining a nucleic acid sample to be analyzed; (b) amplifying by multiplex PCR using a primer specific to the locus of the locus of the locus 2 of Korean chicken 2; (c) detecting an allele of the amplified product of step (b) and determining a genotype; And (d) preparing a distribution of the number and frequency of alleles using the allele genotype for the locus of super-satellite locus of Wu Chicken 2.

The selection of the supersatellite loci was made by considering the comprehensive amplification conditions (annealing temperature of the primer, product size, labeling fluorescent material), mixing the primers according to the concentration to prepare the reaction solution for the amplification reaction, The satellite loci are amplified by Multiplex PCR method. The amplified products were separated using an automatic DNA sequencer, and the distribution and size of alleles in each locus were analyzed. Based on these analysis data, genetic markers were selected for identification , We provide a way to identify the Tuna Chicken 2 entities.

The number of alleles of the supersatellite locus for selecting a supersatellite locus is preferably at least 5, more preferably at least 6, and most preferably at least 7.

Preparation of primers using the supersatellite locus of the present invention should be performed in consideration of multiplex PCR conditions such as annealing temperature and amplification product size.

According to one embodiment of the present invention, for the selection of an object of the present invention, specificity to each of the supersatellite loci composed of MCW0063, MCW0087, LEI0141, MCW0039, MCW0264, ADL0317, ROS0013, ADL0159, MCW0228, MCW0213, LEI0074 and LEI0135 May be used.

According to another embodiment, a supersatellite locus consisting of ADL0268, MCW0111, MCW0145, MCW0288, MCW0127, MCW0040, LEI0094, ADL0292, MCW0029, ROS0019, ADL0259, GCT0016, MCW0104, ROS0083, MCW0123, ADL0293, MCW0330 and ADL0304 May be further used.

The nucleotide sequence of the nucleotide sequence of the nucleotide sequence in which some of the nucleotide sequences of the primers are replaced with other nucleotides and / or the positions and orientations of the nucleotide sequences are changed may also be included in the scope of the primer according to the present invention.

According to an embodiment of the present invention, it is also possible to provide a kit for identifying a Korean Nutrition Factor II containing the marker composition as an active ingredient.

The amplified product after PCR was electrophoresed using ABI-3730 DNA automatic nucleotide sequencer (Applied Biosysytems, USA) to be classified by size and fluorescent substance, and PCR was performed using GeneMapper version 4.0 (Applied Biosystem, USA) Data were collected by classification of product size and type of marker.

Alleles of each microsatellite markers were determined by analysis group and individual using microsatellite toolkit software (Park, 2000) The expected heterozygosity and observed heterozygosity

heterozygosity, allele frequency, number of alleles at each locus, and number of alleles per breed population.

According to the present invention, the method for analyzing the Korean native chicken 2 gene can be used to construct a standardized integrated database of alleles using a supersatellite gene, and can be used to distinguish Korean Kuzuchi 2 from other varieties. In particular, the MS markers of the present invention can exhibit excellent individual discrimination, so that it is possible to easily discriminate from our taste buds, i.e., our chicken 1, 3 and 4.

According to another embodiment of the present invention, a primer set specifically binding to each super-satellite locus consisting of MCW0063, MCW0087, LEI0141, MCW0039, MCW0264, ADL0317, ROS0013, ADL0159, MCW0228, MCW0213, LEI0074, and LEI0135 The present invention relates to a marker composition for identification of a Korean traditional chicken No.2.

In addition to the primer set consisting of the above-mentioned 12 primers, the marker composition may further include a primer set of 12 kinds of primers, such as ADL0268, MCW0111, MCW0145, MCW0288, MCW0127, MCW0040, LEI0094, ADL0292, MCW0029, ROS0019, ADL0259, GCT0016, MCW0104, ROS0083, MCW0123, ADL0293, MCW0330, And a primer specific to a supersatellite locus consisting of ADL0304.

In another embodiment of the present invention, there is provided a kit for identification of Weifu chicken No. 2 comprising the marker composition.

In yet another embodiment, the present invention relates to a method of breeding Korean black chicken, Brown Korean chicken, or Rhode Island Red females produced by crossing a black Cornish male and Brown Cornish male with Brown Korean native chicken or Rhode Island Red female This is a new breed of Korean Native Chicken No. 2, which is produced by breeding a female breed No. 2 female (F1).

In addition, the present invention provides a Korean breed strain No. 2, which is produced by crossing a Brown Cornish male with Brown Korean native chicken or a Rhode Island Red female.

In addition, the present invention provides a method for producing Korean traditional breeding stock No. 2 by crossing a brown conis male between 21 to 72 weeks old after hatching and a brown native chicken or a Rhode Island Red female between 24 and 65 weeks old after hatching; And

And a step of crossing a male of the breed strain No. 2 between 24 and 65 wks after hatching with a male of black coinsing between 21 and 72 wks after hatching.

The present invention of the present invention can be economically raised because the growth rate is fast and the feed requirement rate is lower than that of native chicken. In addition, it has a low shearing force and high water holding capacity and high collagen content compared to ordinary broiler chickens and is characterized by excellent flavor and meat quality.

The Korean traditional breeding stock 2 of the present invention improved the breeding ability by breeding conventional native chicken breeds and domestic native breeds of native breeds of Korean native chickens by improving breeding ability of existing native breeds at the National Livestock Academy.

In the present inventive chicken 2, the brown chicken or the black native chicken is homogenized through restoration work of chickens that have been raised in Korea since the past, and the black, brown, tan, gray, Use a brown system or a black system. The characteristics of the traditional chicken are strong cancellation, active nature, and good hatchability. The characteristics of the traditional chicken are as follows: the body shape is rectangular and slender, and the crests are single-crested and red, and the legs stand up to around five. There are no wool in the shin, black or dark green, and four toes, and the male has a large toenail claw. Traditional chicken is similar to white leghorn species, so it has a light weight and powerful wings. When we look at the production capacity of traditional chicken, the body weight at 270 days is about 1.7 ~ 2.0 kg.

Table 1 shows the criteria for selection of appearance for each strain in the restoration process of the conventional chicken.

Selection Criteria for Traditional Chicken Restoration Process
Site name
Appearance feature system maroon partridge black White Body type Rectangular, lower toward the crown Crested (comb) Single-crest, upright in 5 orbs, medium in thickness, thin in thickness scarlet scarlet peony scarlet Head Medium to deep and wide maroon partridge black White Beak It is hard and slightly bent. Dark brown partridge black partridge Eye Medium in size, light and transparent brown brown Dark brown brown Face Be large and have no feathers scarlet Scarlet peony Scarlet Ear Be small and deep scarlet Scarlet black Scarlet earlobe
(ear lobe) Medium to oval Purple or white Purple or white Red or white Purple or white Meat beard
(wattle) It is thin, medium-sized, long under the chin. scarlet scarlet Black or red scarlet Neck Small, upright, slightly bent forward maroon partridge black White Neck feather
(neck hackle) It is long and covers the front part of the back. maroon partridge black White Back It slopes backward in a straight line. maroon partridge black White Breast It is round, slightly protruding, and developed forward Reddish brown or black partridge black White Adbomen It is developed in an oval shape. Reddish brown or black partridge black White Wing It is a little long and strong to carry. Reddish brown or black Tan or black black White Tail The development of tail feathers is very good and long. Cancer: Rust black
Number: Reddish brown Cancer: Rust black
Number: Tan black White Leg Feathers are densely populated. Brown partridge black White Shank Bone is hard and there is no hair Tan or occult Tan or occult Black or black Tan or occult Toe (toe) It grows well and has four toes and no hair. Tan or occult Tan or occult black Tan or occult A toenail claw
(spur) The male's claws are large Tan or occult Tan or occult Black or grayish black Tan or occult

In addition, Rhode island reds (Gallus gallus) are excellent breeding and laying herbaceous females with single crests or rose crests. Legs and skin are yellow, feathers and egg shells are reddish brown. The quality is gentle, the hatching and the chickens are good, and the meat and meat quality are excellent. The 150-day body weight of the Rhode Island Red species is 1.3 kg, the body weight at 270 days is 1.8 kg, and the egg weight at 270 days is 55-58 g.

Cornish (Gallus gallus) grows fast and is used as a meat special. It has a small, solid pea crest, and its wings are short but very muscular. The shoulders are wide and both sides of the torso are rounded. Thighs are round and muscular. The 150-day-old body weight of Cornis seed is 3.0 kg, the 270-day body weight is 3.7 kg, and the 270-day egg weight is 55-60 g.

On the other hand, in order to receive patents on animals, animal embryos must be deposited in research institutes approved by the government. Most embryos deposited with the depository should be stored for a long period of time, so they must undergo a viability test before embryos are frozen and stored. The purpose of freezing the embryos is to preserve certain animal lines for a long period of time, to thaw them if necessary, and then transplant them into the surrogate mother. The basic principle of embryo freezing is to remove the water (cell water) components present in the cells by using a cryoprotectant and osmotic phenomenon, to inhibit the formation of ice crystals in the cell and to find survival after fusion. However, in the case of avian eggs, the embryo is in egg form, and the eggs of the outermost eggs are shell-free for protection of the eggs. Therefore, since the present invention can not deposit the embryos of the present invention, the present invention enables reproducibility in the production of our tastes by using the cultivated and pure cultivars.

The supersatellite marker according to the present invention and the individual identification method of the Korean Cattle No. 2 using the same can quickly and accurately analyze a plurality of alleles of the supersaturate marker of Korean Cat 2.

It is also possible to distinguish distinct breeds by presenting a method of molecular genetic level that can distinguish them from other varieties with similar phenotypic characteristics.

Through this, it is possible to construct a standardized integrated database and it can be usefully used as a basic data for the breed classification and breeding plan establishment of our poultry practical system.

In accordance with the present invention, the production of native Korean chicken using the domestic native chicken poultry according to the present invention is generally superior to that of foreign introduced varieties in that the Korean native chicken is economically disadvantageous because it is light in weight, To provide a chicken having an excellent economy in terms of body weight and feed conversion rate and meat taste and meat quality suited to the national diet.

1 is a PI between genotype, PI and PI _{-sibs half sibs} Lt; / RTI >
Figure 2 shows Phylogenetic analysis of each population of 9 populations using the Reynolds genetic distance. Each color code represents a different group.
WM1 (Woorimatdag version 1), WM2 (Woorimatdag version 2), Hh (Hanhyup-3), Hn (Hyunin), RIR (Rhode Island Red), CoL (Cornish black), CoR Br (Broiler).
FIG. 3 shows a result of structure analysis using nine marker groups and 12 marker combinations. WM1 (Woorimatdag version 1), WM2 (Woorimatdag version 2), Hh (Hanhyup-3), Hn (Hyunin), RIR (Rhode Island Red), CoL (Cornish black), CoR Br (Broiler).
Figure 4 shows the scattering of the DAPC analysis of nine groups using the adegent R package. WM1 (Woorimatdag version 1), WM2 (Woorimatdag version 2), Hh (Hanhyup-3), Hn (Hyunin), RIR (Rhode Island Red), CoL (Cornish black), CoR Br (Broiler).
Fig. 5 is a schematic representation of the production method of the Korean chicken 2.
Figure 6 shows nine groups of phylogenetic trees using markers consisting of combinations of MCW0063, MCW0087, LEI0141, MCW0039, MCW0264, ADL0317, ROS0013, ADL0159, MCW0228, MCW0213, LEI0074 and LEI0135. Unlike the case of FIG. 2, FIG. 6 shows that the group of WM2 is somewhat dispersed and the group of WM2 is different. That is, from the results of FIG. 6, it can be seen that the combination of the markers of the present invention clearly distinguishes our Korean chicken 2 from other groups.
7 shows primer information of 30 microsatellite markers used in the present invention.

Hereinafter, embodiments of the present invention will be described in detail to facilitate understanding of the present invention. However, the embodiments according to the present invention can be modified into various other forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the invention are provided to more fully describe the present invention to those skilled in the art.

< Our Taste Chicken  2 production>

One. Traditional chicken  restore

The present inventors recognized the importance of our own seeds and began collecting native chicken seeds that have been maintained throughout the country. The 10,353 seeds collected were hatched and hatched in red, brown, and black , White system, and gray - brown system. Based on these seeds, we promoted the high quality chicken breeding project conducted by Korea Poultry Association. As a result of the high - quality breeding project of Korean traditional chicken, the individuals with relatively good or phenotypically fixed expressions were selected by appearance and ability test, and they were grouped into basic groups.

This process was repeated for 15 generations to establish a specific system of fixed purity. In order to maintain the purity of the generation, we selected about 800 hens and 200 cocks per plant, and selected about 30% of them. . Selection was based on the test results of individual characteristics of the major traits such as weight, age, laying and laying hens. In addition, selection of appearance was conducted in accordance with the table above for each hatching, 1, respectively. The abundance, breeding season, and spawning season of each trait were investigated for each species. The results of the tests were analyzed according to the generation management system , Pedigree management, selection, and isolation through accumulated and processed data by household and individual.

2. Our Taste Chicken  No. 2 production method and supply system

Fertilizer type domestic breed between 21 and 72 weeks after hatching. Pure domestic males and native fowl breeds or domestic fowl domestic fowl are mated to produce native breeds (F1). This native breeder breed improved the ability of the breeder to improve the breeding ability of the existing native breeder chickens. The breeder produced the breeder domestic breeder and the breeding male cattle 21 ~ 72 weeks after hatching, It is our chicken 2 which is native chicken (F2). We, Mizuhachi 2, which is produced by 3-way mating, has a fast growing rate and is economical. It can be used as a chicken for Samgyetang at 5 weeks of age and can be used as a chicken for smoking, smoked and fried chicken have. As a result, it is possible to produce a production system of seed-practical system which can be industrialized, and our chicken 2 can be produced.

3. Our Taste Chicken  Breeding method of No. 2

The broiler chickens 2 produced in the present invention are transferred to broiler chickens and maintained at a temperature of about 32 ° C for the first week. When the cabbage is dried at room temperature in the initial high temperature, the appetite declines, growth stagnation, and mortality are maintained, thus maintaining proper humidity of about 60 ~ 70%. Excessive marsupial growth in the house causes growth retardation and mortality, so the breeding density should be adjusted according to the season. Since water is essential for physiological mechanisms such as body temperature control, metabolism and respiration, water is installed within a 2 m radius. The first batch of vitamins and antibiotics were diluted with water, and then fed for 2 hours.

It is preferable to maintain the nutrient content of broiler diets because it is used for meat, but it is desirable to increase the nutrient content of the broiler as the growth rate is fast.

Nutrient content of Korean milk 2

nutrient Weekly 0-5 5 ~ 8 8-12 ME (kcal / kg) 3,059 3,123 3,187 CP (%) 20.3 18.6 16.7 Lee Sin (%) 1.11 0.98 0.84 Methionine + cystine (%) 0.79 0.71 0.63

ME: Metabolism energy

CP: Crude protein

4. Our Taste Chicken  2 Appearance characteristics  And Ability of the child , Chicken characteristics

Our Milk No.2 is produced by crossing a female Korean Brown Cattle No. 2 (F1) produced by crossing a male of Black Cornish and a female of Brown Cornish to Brown Korean native chicken. (CS × H), or by crossing a male (Black Cornish) and a female (No. 2) female F1 produced by crossing a female of Brown Cornish with a female Rhode Island Red (RS × H) or Brown Korean Cornish male and Black Cornish male to Brown Korean native chicken females (F1), which were produced by crossing female Korean Brown native chicken (CH × S) (FIG. 1).

1) Appearance characteristics

Our Tuna Chicken No. 2 is homogeneous in appearance because its genetic traits are based on pure. There are differences in appearance depending on the purple line used, mainly brown or black feather color is expressed, and the tongue color is dark blue or yellow, so it can be easily distinguished from normal broiler chickens or similar domestic chickens.

2) Development

If the growth rate of chickens is fast, the number of days required to reach the shipment weight is high and the amount of feed required for the growth is low, which is economical. We can use this chicken as a chicken for Samgyetang in the 35th day of rearing, and it can be used as a chicken for salmon or smoked chicken, about 2.2 ~ 2.3 kg when the rearing period is about 80 days. , It is economically advantageous because the feedability is high. There was no significant difference in weight gain by mating combination of Korean chicken 2.

The average weight of the weight of the Korean chicken 2 (unit: g)

Mating system Breeding period (week) 0 5 8 10 12                     --------------- Weight (g) --------------- A 40.8 750.6 1,534.2 2,117.6 2,656.7 B 39.9 727.9 1,545.3 2,140.1 2,733.5 C 39.4 744.4 1,529.2 2,094.1 2,601.6

A: CS x H, B: CH x S, C: RS x H

3) Feeding rate

It is very important to select a breeding line that has a low feed requirement for growth because the ratio of the feed cost to the broiler production cost is about 70%. As a result of the analysis of the feed conversion ratio, we found that the quality of the feed was improved because of the rapid growth rate. The feed conversion ratio between the two cultivar combinations of Korean Chicken 2 did not show any significant difference over the whole period.

The feed rate requirement of the Korean traditional chicken 2

Mating system Breeding period (week) 0-5 5 ~ 8 8-12 0-12                              ------------- Feeding rate ------------- A 2.15 1.84 4.15 3.20 B 2.17 1.72 3.99 3.09 C 2.09 1.73 4.10 3.09

A: CS x H, B: CH x S, C: RS x H

4) Physicochemical properties of chicken

The physicochemical properties (meat color, shear force, heat loss and water holding capacity) of chicken meat are shown in Table 5. Compared with 5 - week - old broiler and Korean ham chicken 2, the broiler chickens showed higher lightness and shear force indicating meat quality, and water holding capacity was lower. There was no significant difference in the lightness (L *), redness (a *) and yellowness (b *) of 5 - week - There was no. The meat color of 10 weeks old was the highest in B, Woori chicken 2, but there was no difference in redness and yellowness. The shear force at 10 weeks of age was not different between the treatments, but the heating loss was higher in Bwojjak chicken 2 than in C 2. Shear force and water holding capacity at 10 weeks of age were higher than that of normal broiler chicken.

Physical Characteristics of Korean Chicken 2nd Chicken

Strains Meat color (CIE ^{1 )} ) WSF ^{2 )}
(Kg / 0.5 inch ² ) WHC ^{4 )}
(%) L * a * b *                   ---------- 5 weeks ---------- broiler 53.2 5.91 10.5 3.29 57.25 A 50.0 5.57 7.88 0.93 60.5 B 51.5 5.80 9.41 0.94 60.0 C 51.8 4.72 7.46 0.95 60.9                  ---------- 10 weeks ---------- broiler 55.49 5.94 11.8 3.31 48.9 A 52.8 3.94 9.32 1.17 61.5 B 53.9 3.73 9.06 1.08 60.9 C 50.6 3.90 9.14 1.02 62.1

A: CS x H, B: CH x S, C: RS x H

1) CIE (Commision Internationale de Leclairage): L * = brightness, a * = redness, b * = yellowness.

2) WSF: Warner-Bratzler shear force

3) WHC: water holding capacity

There was a slight difference in fat and collagen content among the Korean mulberry cultivars, but there was no significant difference. The chemical composition of chicken meat at 5 weeks of age showed significant difference between pH and B, C, and Kwangjoo chicken 2, and the moisture content was lowest in Bwi tuna chicken 2, but the fat content was highest in Bwi tuna chicken 2. There was no significant difference in pH, moisture, fat, protein and ash content of chicken meat at 10 weeks of age. However, collagen content was higher in Cwoju chicken 2 than in broiler chicken. appear.

Chemical composition of chicken meat No. 2

Strains pH Moisture (%) Fat (%) Protein (%) Ash (%) Collagen
(g / 100 g)             ---------- 5 weeks ---------- broiler 5.89 74.91 1.18 22.42 0.80 0.82 A 5.93 77.8 0.94 23.6 0.99 1.29 B 5.87 77.1 1.20 23.8 1.01 1.01 C 5.95 77.4 0.89 23.9 1.00 1.09             ---------- 10 weeks ---------- broiler 5.85 74.67 0.68 22.8 1.44 0.81 A 5.88 75.0 0.19 24.8 0.95 0.97 B 5.82 74.7 0.17 24.7 1.02 1.06 C 5.87 74.8 0.32 24.6 1.04 1.20

A: CS x H, B: CH x S, C: RS x H

< Our Taste Chicken  Micro satellite for discrimination 2 Marker  Manufacturing>

One. Our Taste Chicken  2 genomic  DNA extraction

DNA from 187 embryo tissues of Korean hamster (WM2) was extracted using the PrimePrep ™ genomic DNA isolation kit (GeNetBio, Korea). The concentration of DNA samples was measured using a NanoDrop 2000C spectrophotometer (Thermo Scientific, USA) and stored at 20 ° C.

2. Micro satellite (MS) Marker PCR and  Genetic analysis genotyping )

30 MS markers with high expected heterozygosity (Hexp) and polymorphic information contents (PIC) value of WM2 were selected.

Multiplex PCR was performed to obtain a final volume of 20 μl. 10 pmol (Applied Biosystems, USA) of a forward primer and a reverse primer labeled with 50 ng of template DNA, 2 μl of primer mixture, fluorescent dye (FAM, VIC, NED, PET) , 2.5 mM dNTP (GeNet Bio, Korea), 10 X reaction buffer (GeNet Bio, Korea) and 2.5 units of Taq DNA polymerase (GeNet Bio, Korea). PCR was performed using My-Genie 96 Thermal Cycler (Bioneer, Korea) at 95 ° C for 10 min, at 95 ° C for 30 sec, at 60 ° C for 30 sec, at 72 ° C 30 sec for 35 cycles, and finally 72 for 10 min.

The PCR product was first electrophoresed on 3% agarose gel with ethidium bromide (EtBr) and confirmed to have a single DNA band under UV light. Genotyping was performed when the band appeared clearly. PCR products were diluted 20-fold for MS genetic analysis. The genetic analysis reaction was performed using 1 μL of diluted PCR product, 10 μL of Hi-Di ™ Formamide (Applied Biosystems, USA) and 0.1 μL of GeneScan ™ -500 LIZ ™ size standard marker Biosystems, USA). After dilution, the genetic analysis reaction mixture was denatured at 95 ° C for 2 minutes and fragment analysis was performed using a genetic analyzer 3130 xl (Applied Biosystems, USA) using a capillary array. MS genotypes were confirmed using GeneMapper ver.3.7 (Applied Biosystems, USA).

3. Statistical analysis

The number of alleles (Na), expected heterozygosity (He), and observed heterozygosity (Ho) were calculated using the Cervus 3.0 program (Marshall et al., 1998) And polymorphic information content (PIC) were measured. The expected odds _ratios (PI), random half sibs (PI _{half- sibs} ) and random sibs (PI _sibs ) of the random _groups were measured using API-CALC ver 1.0 (Ayres and Overall, 2004). Genetic distance was also measured using PowerMarker ver 3.25 (Liu and Muse, 2005).

Table 7 below shows primer information for each MS.

Marker
Chr
Dye
Forward (5 '- &gt;3')
Reverse (5 '- &gt;3')
Allele size (bp) ADL0268 One  PET CTCCACCCCTCTCAGAACTA CAACTTCCCATCTACCTACT 105-117 MCW0111 One NED GCTCCATGTGAAGTGGTTTA ATGTCCACTTGTCAATGATG 98-112 MCW0145 One FAM ACTTTATTCTCCAAATTTGGCT AAACACAATGGCAACGGAAAC 181-211 MCW0063 2 FAM GGCTCCAAAAGCTTGTTCTTAGCT GAAAACCAGTAAAGCTTCTTAC 132-150 MCW0087 2 NED ATTTCTGCAGCCAACTTGGAG CTCAGGCAGTTCTCAAGAACA 267-283 LEI0141 2 FAM CGCATTTGATGCATAACACATG AAGGCAAACTCAGCTGGAACG 220-242 MCW0039 2 VIC CATTGGACTGAGATGTCACTGCAG ACATTTGTCTAATGGTACTGTTAC 127-147 MCW0264 2 FAM CTTACTTTTCACGACAGAAGC AGACTGAGTCACACTCGTAAG 224-240 MCW0288 2 FAM GATCTGCTTCTCTGCCCCATG GGTACTGTCACCAGAATGAGC 108-122 MCW0127 3 VIC GAGTTCAGCAGGAATGGGATG TGCAATAAGAGAAGGTAAGGTC 227-241 MCW0040 3 VIC ACTCAAAAATGTGGTAGAATATAG ACCGAAATTGAGCAGAAGTTA 121-145 ADL0317 4 FAM AGTTGGTTTCAGCCATCCAT CCCAGAGCACACTGTCACTG 178-204 LEI0094 4 FAM GATCTCACCAGTATGAGCTGC TCTCACACTGTAACACAGTGC 254-280 ADL0292 5 FAM CCAAATCAGGCAAAACTTCT AAATGGCCTAAGGATGAGGA 110-138 MCW0029 5 VIC GTGGACACCCATTTGTACCCTATG CATGCAATTCAGGACCGTGCA 139-189 ROS0013 5 NED TGCTGCTCCTGGRAAATTG GAAAAGCCATGGAGGAATCA 220-242 ADL0159 6 VIC GCCATTATTTTTCCCTGTGT CTCCCCAAAGTCATTAGCAG 107-127 ROS0019 7 NED ATGTACAGGTTCCAGTGTCCG CCAGTTCATACAACCTTGAGTTGG 119-143 ADL0259 9 VIC CTCATTGCAGAGGAAGTTCT GTAATGGAGGATGCTCAGGT 107-129 GCT0016 9 NED TCCAAGGTTCTCCAGTTC GGCATAAGGATAGCAACAG 109-125 MCW0228 10 PET GATCTCTGCATTACAAGCATG TTGCTGACCTGCTCATGCAAG 221-239 MCW0104 13 FAM TAGCACAACTCAAGCTGTGAG AGACTTGCACAGCTGTGTACC 189-225 ROS0083 13 VIC CATTACAGCTCAGTGTTGGCA TTGCAAGTGCTCTCCCATC 109-129 MCW0213 13 NED GACAAGTCAACAACTTGCCAG CTGTTCACTTTAAGGACATGG 288-316 MCW0123 14 FAM CCACTAGAAAAGAACATCCTC GGCTGATGTAAGAAGGGATGA 79-89 ADL0293 17 PET GTAATCTAGAAACCCCATCT ACATACCGCAGTCTTTGTTC 105-119 MCW0330 17 VIC TGGACCTCATCAGTCTGACAG AATGTTCTCATAGAGTTCCTGC 254-286 ADL0304 18 FAM GGGGGAGAACTCTGGAAATG CCTCATGCTTCGTGCTTTTT 137-159 LEI0074 26 VIC GACCTGGTCCTGACATGGGTG GTTTGCTGATTAGCCATCGCG 224-240 LEI0135 28 NED CACAATGAAGGATGAATAGTGC AATTCACAGTTACACCTGAGG 131-142

The markers of MCW0063, MCW0087, LEI0141, MCW0039, MCW0264, ADL0317, ROS0013, ADL0159, MCW0228, MCW0213, LEI0074 and LEI0135 in Table 7 were selected.

(1) Polymorphism of MS markers

We found an average of 7.17 alleles in the 30 MS markers of our chicken 2. The expected heterozygosity (Hexp) ranged from 0.474 in ADL0304 to 0.841 in MCW0264. Observed heterozygosity (Hobs) ranged from 0.151 in GCT0016 to 0.885 in ADL0159, with an average of 0.741 per locus in the WM2 population. The polymorphic information content (PIC) ranged from 0.443 in ADL0304 to 0.819 in MCW0264, with an average of 0.682 per locus (see Table 8).

That is, as shown in the following Table 8, the MS markers of the present invention were thought to be useful for distinction of WM2 in terms of allele gene number and polymorphism.

Locus
no. of allele
HObs
HExp
PIC ADL0268 5 0.783 0.742 0.703 MCW0111 5 0.789 0.695 0.654 MCW0145 7 0.754 0.692 0.655 MCW0063 7 0.775 0.783 0.746 MCW0087 9 0.833 0.785 0.751 LEI0141 7 0.832 0.797 0.767 MCW0039 7 0.738 0.765 0.726 MCW0264 8 0.877 0.841 0.819 MCW0288 6 0.608 0.631 0.578 MCW0127 6 0.742 0.679 0.627 MCW0040 6 0.813 0.695 0.656 ADL0317 7 0.819 0.775 0.739 LEI0094 7 0.845 0.716 0.665 ADL0292 7 0.774 0.733 0.684 MCW0029 13 0.805 0.815 0.790 ROS0013 8 0.871 0.771 0.734 ADL0159 7 0.885 0.789 0.757 ROS0019 8 0.766 0.643 0.581 ADL0259 6 0.674 0.657 0.620 GCT0016 9 0.151 0.804 0.773 MCW0228 6 0.821 0.773 0.740 MCW0104 11 0.743 0.813 0.786 ROS0083 8 0.818 0.749 0.707 MCW0213 11 0.807 0.798 0.771 MCW0123 5 0.707 0.687 0.627 ADL0293 7 0.701 0.554 0.522 MCW0330 6 0.484 0.643 0.592 ADL0304 5 0.513 0.474 0.443 LEI0074 6 0.85 0.745 0.704 LEI0135 5 0.659 0.596 0.544 Mean 7.17 0.741 0.721 0.682

As shown in Table 8, the markers according to an embodiment of the present invention have an average of 7.17 alleles and have a Hexp value of 0.6 or more and a PIC value of 0.5 or more. Therefore, it is believed that the 30 selected markers provide high individual discrimination.

(2) Discrimination of the WM2

The measured Hexp and PIC values were used as the values to determine the selectability of MS markers for the identification of the population of the Tuna Chicken II population. After measuring the Hexp and PIC values, the same individual occurrence probability ( PI ), random half sibs ( PI _{half- sibs} ), and random sibs ( PI _sibs ) were measured using API_CALC 1.0. 12 results using the MS markers PI, PI _{-sibs half sibs} and PI values are respectively as shown 3.23E-33, 5.03E-22 and 8.61E-08.

That is, when statistical processing was performed using the 12 MS marker combinations of the present invention, the probability of occurrence of the same individual in the random mating group was 3.23 X 10 ^-33 , which indicates that the probability of occurrence of the same individual is extremely small Meaning that it can be effectively used for identification of an individual. 1 is a PI between genotype, PI and PI _{-sibs half sibs} And the probability of occurrence of the same individual is statistically shown through this.

Alternatively, the results using a combination of MCW0063, MCW0087, LEI0141, MCW0039, MCW0264, ADL0317, ROS0013, ADL0159, MCW0228, MCW0213, LEI0074, and a marker which is a combination of LEI0135 PI, PI and PI _{-sibs half sibs} Values were 6.57E-13, 7.01E-10, and 1.65E-05, respectively. That is, as a result of using the marker combination shown in the above comparative example, the probability of occurrence of the same individual was 6.57 X 10 ^-13 .

This means that the marker combination of the present invention has a more superior Mycobacterium &lt; RTI ID = 0.0 &gt; No. 2 &lt; / RTI &gt;

(3) Genetic distance analysis between WM2 and other varieties

Through genetic distance, genetic relationships between different populations can be measured. Nei's genetic distance is a measure of the distance between WM2 and other varieties using the pairwise co-ancestry matrix by allele frequency (see Table 9).

The closest genetic distance (0.1375) was found between WM1 and Cornish black (CoL). The distances between Korean Ogye (O) chicken and WM2 were the largest (0.791), followed by Rhode Island Red (RIR) and WM2 (0.788).

These results show that there is a clear difference between WM2 and other varieties.

Table 9 below shows the genetic distance between 12 varieties as a matrix.

Bb CoL CoR Hh Hn O RIR Wm1 Wm2 Bb - CoL 0.3267 - CoR 0.3251 0.3906 - Hh 0.2715 0.3114 0.3805 - Hn 0.4189 0.4090 0.4738 0.4460 - O 0.4587 0.4027 0.4543 0.4972 0.5287 - RIR 0.4371 0.4702 0.5382 0.3494 0.5492 0.6302 - Wm1 0.2791 0.1375 0.3365 0.2453 0.3667 0.4341 0.2478 - Wm2 0.7102 0.7225 0.7095 0.7121 0.7618 0.7914 0.7878 0.6904 -

* WM1 (Woorimatdag version 1), WM2 (Woorimatdag version 2), Hh (Hanhyup-3), Hn (Hyunin), RIR (Rhode Island Red), CoL (Cornish black) and Br (Broiler).

4. Phylogenetic analysis

Based on Nei's equations (1983), an unrooted neighbor-joining (NJ) phylogenetic tree was constructed from 263 chickens in group 9 of the nine groups using a combination of 12 markers. In each phylogenetic assay, the WM2 population was distinguished from the other populations. It was found that Korean Ogye (O) chicken was distinct from the group including WM1, Hanhyup-3 (Hh), Cornish black (CoL), and Broiler (Br) groups.

The gentetic structure of nine populations using microsatellite marker genotypes was investigated based on population clustering, which is shown in FIG.

The purpose of the structural analysis, performed using the Bayesian approach based on the marker genotype, is to graphically illustrate the herd population (Evanno et al., 2005).

As can be seen in FIG. 3, using K-value 2 and 12 MS markers, the population is completely separated between WM2 and other varieties. These results are also confirmed in the phylogenetic and discriminant analysis of each individual. Based on these results, it has been confirmed that the combination of the markers of the present invention can facilitate the distinction between the other group and Korean chicken 2.

In each of the nine groups, an array of each individual formed nine clusters, representing a genetic group. And they were inferred using the k-means algorithm performed on the R package adegenet (see FIG. 4). In addition, each dotted object was first graphically plotted according to their coordinates in the two major components. The bar graph of FIG. 4 shows the amount of variance determined by the two discriminant values using the coordinates. WM2 is clearly distinguished from other populations and these results are evident by phylogenetic analysis using the 12 selected MS markers of the present invention. Twelve selected MS markers can also be used to separate Korean Ogye (O) chicken and Rhode Island Red (RIR) groups.

In conclusion, it can be confirmed that the marker combination of the present invention can be used for screening of Korean Chicken 2.

Claims (8)

The present invention relates to a novel Mycobacterium tumefaciens identification marker composition comprising a primer set that specifically binds to each of the supersatellite loci consisting of MCW0063, MCW0087, LEI0141, MCW0039, MCW0264, ADL0317, ROS0013, ADL0159, MCW0228, MCW0213, LEI0074, and LEI0135 . The marker composition according to claim 1, wherein the marker composition is selected from the group consisting of ADL0268, MCW0111, MCW0145, MCW0288, MCW0127, MCW0040, LEI0094, ADL0292, MCW0029, ROS0019, ADL0259, GCT0016, MCW0104, ROS0083, MCW0123, ADL0293, MCW0330 and ADL0304. A primer specific to the locus, and a primer specific to the locus. 5. A kit identification product of Korean Myanmar chicken No. 2 comprising the marker composition according to claim 1 or 2. (a) obtaining a nucleic acid sample to be analyzed;
(b) amplifying by multiplex PCR using a primer specific to the locus of the locus of the locus 2 of Korean chicken 2;
(c) detecting the allele by electrophoresis of the amplified product of step (b) and determining the genotype; And
(d) preparing a distribution of the number and frequency of alleles using the allele genotype for the locus of super-satiety of the Korean Nutrition No. 2,
The supernatant loci of Wujiao chicken No. 2 were MCW0063, MCW0087, LEI0141, MCW0039, MCW0264, ADL0317, ROS0013, ADL0159, MCW0228, MCW0213, LEI0074 and LEI0135.
How to identify the object of our Tuna Chicken 2. delete delete delete delete

Images