KR101474284B1 - Microsatellite Marker for individualization in Korean native chicken and individualizing Method Using the Same - Google Patents

Abstract

The present invention relates to a method for identifying an individual using a microsatellite marker, and more particularly, to a method for identifying an individual of a traditional chicken using microsatellite markers, , A first set of ADL0304, a second set of LEI0251, ADL0259, ADL0021, MCW0104, MCW0261, MCW0087, ADL0292, GCT0016, MCW0029, MCW0145, LEI0107, ADL0304, ADL0324, MCW0063, MCW0264. A step of performing PCR amplification using a light marker, and a step of detecting an allele using an electrophoresis apparatus and analyzing the size of the product amplified in the amplifying step to determine a genotype.
Since the method according to the present invention uses a microsatellite marker having high individuality, it is possible to identify the individual of the native chicken and the parent of the native chicken more precisely than the morphological classification standard. Therefore, the method of the present invention can be applied to the identification of the native chickens to control the illegal circulation by positively influencing the preservation and reliability of the native chickens, thereby contributing to the development of the traditional chicken industry and the income increase of the farm household.

Description

Technical Field [0001] The present invention relates to a microsatellite marker for identifying an individual of a native chicken, and a method for identifying an individual of a native chicken using the same,

The present invention relates to a microsatellite marker for identifying an individual of a native chicken and a method of identifying an individual of a native chicken using the same. More particularly, the present invention relates to a microsatellite marker having a high polymorphism index, The size of the amplification product, the economic cost incurred in the analysis, and the like.

Poultry meat plays an important role in the income of the farm household and the rural economy to the extent that it accounts for more than 20% of the total meat production in our country. Chickens, which account for the highest percentage of them, are dependent on imports from most developed countries (US, UK, France, Germany, Denmark, etc.).

In the 1990s, the traditional chicken was obtained from 9 kinds of 5 varieties as "Traditional Chicken Restoration Project" in the Poultry Division of Livestock Societies in the 1990s. It is true.

In the case of cattle and pigs, the production history system is being implemented or promoted to ensure reliability by the distinction between domestic species and imported species. However, in case of traditional chickens, there is not much preservation and development, and its name or classification is clear Therefore, it is urgent to secure reliability as domestic species.

Therefore, it is necessary to develop microsatellite markers suitable for traditional chickens in order to develop high quality meat into brand meat by establishing individual identification methods using genotypes, and to increase the reliability of conventional chickens.

Since the 1990s, microsatellite markers have been used as the most efficient molecular markers for analyzing phylogeny and genetic linkage in humans as well as animals. In recent years, microsatellite markers have been used to identify specific individuals In the case of livestock, using the markers recommended by the International Animal Genetics Society and the Rosline Institute, etc., it is possible to use the characteristics that the polymorphism of alleles is not largely expressed in the systematic genetics, the production history system, .

Presently, genetic identification techniques such as genetic diversity research and paternity identification are conducted in Korea using microsatellite markers, but the usefulness and accuracy are still low.

Application No. 10-2004-0088540 Tracking and Identification of Origin of Chicken Meat Using Supersatellite Genes

It is an object of the present invention to provide a novel microsatellite markers which can be used for individual identification of a conventional chicken more effectively and can be accurately identified while securing a high level of power, And a detection kit for identification of a native chicken.

To achieve the above object, the present invention provides a method for identifying 12 or more conventional chicken individuals selected from the group consisting of LEI0251, ADL0259, ADL0021, MCW0104, MCW0261, MCW0087, ADL0292, GCT0016, MCW0029, MCW0145, LEI0107, ADL0304, ADL0324, MCW0063 and MCW0264 A microsatellite marker for the microsatellite.

The present invention also relates to the microsatellite markers of SEQ ID NO: 1 and 2, 3 and 4, 5 and 6, 7 and 8, 9 and 10, 11 and 12, 13 and 14, 15 and 16, 17 and 18, 19 and 20, 21 and 22, 23 and 24, 25 and 26, 27 and 28, 29 and 30 forward primer and reverse primer pairs.

In addition, the present invention provides a conventional chicken individual identification kit comprising the primer.

The present invention also relates to a method of analyzing a nucleic acid sample to be analyzed using at least 12 microsatellite selected from the group consisting of LEI0251, ADL0259, ADL0021, MCW0104, MCW0261, MCW0087, ADL0292, GCT0016, MCW0029, MCW0145, LEI0107, ADL0304, ADL0324, MCW0063 and MCW0264 PCR amplification using a marker specific primer; And detecting the amplified product through the electrophoresis apparatus to detect an allele and determine a genotype.

The primers of the PCR amplification step may be selected from the group consisting of SEQ ID NOs: 1 and 2, 3 and 4, 5 and 6, 7 and 8, 9 and 10, 11 and 12, 13 and 14, 15 and 16, 17 and 18, 19 And twelve pairs or more primers selected from the group consisting of forward primers and reverse primer pairs of 20, 21 and 22, 23 and 24, 25 and 26, 27 and 28, 29 and 30 .

As described above, according to the present invention, a microsatellite marker for identifying an individual of a native chicken and an individual identification method for a native chicken using the same are characterized in that a microsatellite marker having a higher individuality than the markers used in the prior art PCR is performed by preparing specific primers, and the results are used to provide more accurate individual identification of chickens. In addition, the method of identifying an individual of a traditional chicken using the micro satellite marker according to the present invention can be utilized as a means for preventing cheating in the distribution process of the native chicken, thereby increasing the reliability of the consumer for the native chicken It can help farmers to increase income.

Fig. 1 shows the electrophoresis results of the PCR products obtained using a primer specific to the microsatellite marker LEI0251.
Figure 2 shows the electrophoresis results of the PCR products obtained using a primer specific to the 2 microsatellite marker ADL0259.
Fig. 3 shows electrophoresis results of PCR products obtained using a primer specific to microsatellite marker ADL0021.
Fig. 4 shows electrophoresis results of PCR products obtained using primers specific to microsatellite marker MCW0104.
5 shows the electrophoresis results of PCR products obtained using primers specific to microsatellite marker MCW0261.
6 shows electrophoresis results of PCR products obtained using primers specific to microsatellite marker MCW0087.
Fig. 7 shows electrophoresis results of PCR products obtained using a primer specific to microsatellite marker ADL0292.
Fig. 8 shows the electrophoresis results of PCR products obtained using primers specific to microsatellite marker GCT0016.
9 shows electrophoresis results of PCR products obtained using primers specific to microsatellite marker MCW0029.
10 shows electrophoresis results of PCR products obtained using primers specific to microsatellite marker MCW0145.
Fig. 11 shows the electrophoresis results of PCR products obtained using primers specific to microsatellite marker LEI0107.
Fig. 12 shows electrophoresis results of the PCR products obtained using a primer specific to microsatellite marker ADL0304.
13 shows electrophoresis results of PCR products obtained using primers specific to microsatellite marker ADL0324.
14 shows electrophoresis results of the PCR products obtained using a primer specific to microsatellite marker MCW0063.
Fig. 15 shows electrophoresis results of PCR products obtained using a primer specific to microsatellite marker MCW0264.

Hereinafter, specific methods of the present invention will be described in detail with reference to examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited by the following examples.

Example  One : Traditional chicken  For object identification Micro satellite Marker  Selection

In order to select microsatellite markers that can be effectively used for identification of conventional chicken individuals, among the 150 microsatellite markers for analysis of chicken polymorphisms located in the entire region of the chicken chromosome proposed by the International Animal Genetics Society, And 15 markers with high polymorphism index.

The number of alleles of the selected microsatellite markers is 6 or more and the heterozygosity rate is 70% or more, which has higher individual identification accuracy than the selection criterion of microsatellite markers used in Patent Document 1. Here, the number of alleles affects the Polymorphic Information Contents (PIC) and also affects the heterozygosity of the next generation. Therefore, a large number of alleles of microsatellite markers means that the genetic diversity is enhanced, which means that the individual identification rate becomes higher.

Example  2 : Disclosure axis  And DNA  sample

A total of 685 blood samples were collected from 88 broodstock of 5 breeds and 597 broodstock groups which were preserved in Seonghwan Livestock Research Institute. The genomic DNA extraction process from the blood of the conventional chicken is as follows.

685 vials of blood were collected in tubes containing EDTA and incubated with buffer A (0.32 M Sucrose, 1 mM TrisHCl, 5 mM MgCl ₂ , 1% Triton X-100, dH ₂ O) was diluted to 4 volumes and centrifuged to remove the supernatant. The above procedure was repeated three times to remove the supernatant. Then, 250 μl of 2.25 ml of buffer B (400 mM NaCl, 2 mM EDTA, 10 mM TrisHCl, dH ₂ O) and buffer C (5% SDS, 2 mg / ml Proteinase K, 2.6 ml) And the mixture was slowly mixed upside down. The mixture was immersed in a shaking incubator at 50 ° C for one day. 675 μl of 6 M NaCl was added to the culture solution, and the mixture was vigorously shaken for 15 seconds. The mixture was centrifuged at 3000 rpm for 15 minutes, and the supernatant was transferred to a new tube. The DNA is precipitated by adding 2 volumes of 99% EtOH to the tube, and the precipitate is washed with 70% EtOH. Finally, 500 μl of TE buffer is added to dissolve the coagulated DNA.

Example  3: Micro satellite Marker  Specific primer  making

A primer specific to microsatellite markers selected in Example 1 was custom-made by LSK Co., Ltd. A labeling fluorescent material consisting of FAM, VIC, NED and PET was attached to the end of the forward primer among the primers, and the names, the label fluorescent materials and the base sequences of the respective primers are shown in Table 1.

location Chromosome sign Primer sequence SEQ ID NO: LEI0251 13 NED F GATCTAGAAATGGCTGACTGAC One R GGGTTACTCTTATGTTTAATGATGTC 2 ADL0259 9 VIC F CTCATTGCAGAGGAAGTTCT 3 R GTAATGGAGGATGCTCAGGT 4 ADL0021 9 PET F GCTCCTCGCTTTGCTCTGAA 5 R GCTTAGCCTCATCTCTTGTA 6 MCW0104 13 FAM F TAGCACAACTCAAGCTGTGAG 7 R AGACTTGCACAGCTGTGTACC 8 MCW0261 3 FAM F GAGCAGTTCATATGAAGTGCAG 9 R GTAGTAGCAGCTACACCAGAG 10 MCW0087 2 NED F ATTTCTGCAGCCAACTTGGAG 11 R CTCAGGCAGTTCTCAAGAACA 12 ADL0292 5 FAM F CCAAATCAGGCAAAACTTCT 13 R AAATGGCCTAAGGATGAGGA 14 GCT0016 9 NED F TCCAAGGTTCTCCAGTTC 15 R GGCATAAGGATAGCAACAG 16 MCW0029 5 VIC F GTGGACACCCATTTGTACCCTATG 17 R CATGCAATTCAGGACCGTGCA 18 MCW0145 One FAM F ACTTTATTCTCCAAATTTGGCT 19 R AAACACAATGGCAACGGAAAC 20 LEI0107 One NED F GCTGCTCAGAAGCATCTGTGC 21 R ATCATTGCTACACCATGGTTC 22 ADL0304 18 FAM F GGGGGAGAACTCTGGAAATG 23 R CCTCATGCTTCGTGCTTTTT 24 ADL0324 20 NED F TTGCCTCGACGGACCACAAT 25 R GCAGCCCCGCCAAGTAACTG 26 MCW0063 2 FAM F GGCTCCAAAAGCTTGTTCTTAGCT 27 R GAAAACCAGTAAAGCTTCTTAC 28 MCW0264 2 FAM F CTTACTTTTCACGACAGAAGC 29 R AGACTGAGTCACACTCGTAAG 30

Example  4 : PCR  Amplification

Using the DNA samples collected in Example 1 as a template, 15 pairs of primers prepared in Example 2 were used to perform PCR (PCR) under the following conditions. In PCR, 25 ng of template DNA, 1.0 μl of each primer (10 pmole), 0.2 μl of Taq DNA polymerase, 2.0 μl of 10 × buffer solution and 2.0 μl of 2.5 mM dNTP were treated with distilled water to give a total reaction volume of 20 μl . The mixture was subjected to denaturation at 94 ° C for 30 sec, primer binding at 60 ° C for 30 sec, initiation of the first reaction at 94 ° C for 10 min using Thermal Cycler PTC-0240 (MJ Research, Inc., MA, USA) The PCR reaction was terminated at 4 ° C after a final extension reaction at 72 ° C for 10 minutes.

After PCR, amplified products were electrophoresed using ABI3130 DNA automated sequencing system (Applied Biosystems, USA) to be classified according to size and fluorescent substance, and PCR product was purified using Genemapper version 3.0 (Applied Biosystems, USA) Size and number of alleles by marker type.

Example  5: Micro satellite Marker Polymorphism index  analysis

The heterozygosity (He, Heterozygosity) and polymorphic information content (PIC) of each microsatellite polymorphism were calculated using Cervus version 3.0.3 as a result obtained from Example 3 (Marshall et at 1998) Mol . Ecol. 7: 639-655).

As a result, the polymorphism index of each microsatellite is as shown in Table 2. In the present invention, a first set of micro satellite markers for identification of a traditional chicken consisting of twelve micro satellite markers LEI0251, ADL0259, ADL0021, MCW0104, MCW0261, MCW0087, ADL0292, GCT0016, MCW0029, MCW0145, LEI0107 and ADL0304 And a method for identifying an individual of a conventional chicken using a second set of microsatellite markers configured by adding one or more of the remaining micro satellite markers ADL0324, MCW0063, and MCW0264 to provide higher individual discrimination .

location Number of alleles N Size range (bp) HObs HExp PIC LEI0251 12 88 84 ~ 124 0.852 0.882 0.865 ADL0259 9 88 92 to 132 0.773 0.846 0.826 ADL0021 8 88 145-185 0.795 0.849 0.825 MCW0104 11 88 190 ~ 234 0.659 0.846 0.823 MCW0261 8 88 231-271 0.83 0.842 0.817 MCW0087 9 88 239-279 0.761 0.83 0.806 ADL0292 7 88 108 ~ 148 0.716 0.821 0.791 GCT0016 8 88 201 ~ 241 0.466 0.804 0.773 MCW0029 11 88 166-206 0.739 0.789 0.77 MCW0145 7 88 188-222 0.727 0.791 0.759 LEI0107 8 88 185 ~ 225 0.716 0.77 0.739 ADL0304 8 87 119 to 159 0.678 0.768 0.735 ADL0324 6 88 146-186 0.568 0.767 0.723 MCW0063 8 88 114 ~ 154 0.648 0.712 0.665 MCW0264 6 87 217 ~ 257 0.713 0.709 0.648

HObs: Observed Heterozygosity value

HExp: Expected Heterozygosity value

PIC: Polymorphic Information content

Example  6: Statistical analysis

Of the results obtained from Example 3, 88 chickens of 5 different breeds excluding 597 chickens were analyzed by the following method.

The significance test for the F - statistic estimates was obtained by the permutation test (PT) according to the method proposed by Goudet (2001). The polymorphism index ( He ), polymorphism index ( PIC ) (exclusion probability, PE ) was Cervus version 3.03 (Marshall et al., 1998). Based on the estimated F _st and F _is , the probabilities of occurrence of the same species in random and semi-sibling mothers were calculated using API-CALC version 1.0 (Ayres and Overall (2004) Molecular Ecology Notes 4: 315-318) Respectively.

Using the estimated F-statistics, the probability of occurrence of the microsatellite marker genotypes ( PI and Probability of identity from half sibs, PI _{half - sibs} ) and the paternity feeling rate (probability of parent exclusion parentas when both are unconfirmed;; PE _pu and probability of paternity exclusion PE) were estimated using the API-CALC version 1.0 and version 3.0.3 Cervus.

As a result, in the case using the whole of the micro-satellite markers randomly mating population at 1.01 × 10 _^-20, mating half hyeongmae group As shown in Table 3 it was a 3.85 × 10 ^-15. This means that when the 12 microsatellite markers of the first set are used for paternity identification and individual identification, 100% parent identification and individual identification are possible when the parent genotype and mating record are known, and the remaining three markers The added second set can be used as a supplementary role. In addition, when the species produced from 5 domestic varieties are produced and distributed to the farmers, it is assumed that they are a huge group of half-breed matings due to their absolute genetic contribution. In order to construct a single production line or brand, Even if considering the number of rearing, it is considered that there is no possibility that the same individual will appear.

division PI PI _half-sibs PI _sibs PE The first set 1.01X10 ^-20 3.85X10 ^-15 1.69X10 ^-7 0.999555 The second set 7.98X10 ^-29 2.28X10 ^-20 1.25X10 ^-8 0.999858

Example  7. The Micro satellite Marker  Used Traditional chicken  Object identification

In order to confirm the paternity discrimination effect of the microsatellite markers of the first set and the second set selected in the present invention, 685 numbers of native chicken were screened using a pair of primers specific to the microsatellite markers shown in Table 1, Respectively. More specifically, blood was collected from the parental group 88 and the offspring group 597 in the five species of native chicken, and DNA was isolated from the blood by the same method as in Example 1, and PCR was carried out using the same method as in Example 3 Respectively. The PCR product was electrophoresed using ABI3130 DNA automated sequencing system (Applied Biosystems, USA) to be classified according to size and fluorescent substance, and the size and type of fluorescent substance were measured using Genemapper version 3.0 (Applied Biosystems, USA) , And collected data using Microsoft Excel (Microsoft, USA, USA). Based on the collected data, the allele genotype was analyzed and paternity was discriminated and compared with the hybridization table.

As a result, 100% paternity identification was possible in the paternity discrimination power. When the frequency of occurrence of the same individuals using genotypes of parental generations was calculated, when the first set micro satellite markers provided in the present invention were used, The probability that the probability of emergence becomes zero can be confirmed. Therefore, when the breed is developed and distributed by using the pure system 5 series of the native chicken, the microsatellite markers of the present invention can be distinguished into the breed-specific differences, and thereby it can be applied to the production history system technology of the native breed varieties .

ADL0292 GCT0016 MCW0029 MCW0145 LEI0107 ADL0304 A1 A2 A1 A2 A1 A2 A1 A2 A1 A2 A1 A2 part 112 136 108 130 187 187 202 206 222 222 140 156 mother 134 136 110 130 161 161 190 206 210 212 156 156 R044 112 136 130 130 161 187 190 202 212 222 156 156 R046 112 134 108 110 161 187 206 206 212 222 156 156 R047 112 134 108 110 161 187 190 202 210 222 140 156 R264 112 136 130 130 161 187 190 206 210 222 152 152 R265 112 134 108 130 161 187 206 206 212 222 156 156 R266 112 136 130 130 161 187 190 206 210 222 156 156 R267 112 136 130 130 161 187 202 206 212 222 156 156 R268 112 134 108 130 161 187 190 202 212 222 140 156 LEI0251 ADL0259 ADL0021 MCW0104 MCW0261 MCW0087 A1 A2 A1 A2 A1 A2 A1 A2 A1 A2 A1 A2 part 100 126 110 128 184 188 196 206 241 245 267 275 mother 102 118 110 146 166 186 188 206 225 243 275 277 R044 100 102 110 146 166 184 206 206 225 241 275 277 R046 100 102 110 128 186 188 206 206 241 243 275 275 R047 118 126 110 146 186 188 188 196 243 245 267 277 R264 102 126 110 128 184 186 196 206 237 241 275 277 R265 102 126 110 128 166 188 188 196 241 243 275 275 R266 100 102 110 146 166 184 188 206 225 241 275 277 R267 100 102 110 110 166 184 188 206 241 243 275 275 R268 118 126 110 128 166 188 196 206 243 245 267 277

LEI0251 ADL0259 ADL0021 MCW0104 MCW0261 MCW0087 ADL0292 GCT0016 A1 A2 A1 A2 A1 A2 A1 A2 A1 A2 A1 A2 A1 A2 A1 A2 part 118 130 106 112 174 184 202 226 225 245 275 287 120 134 132 154 mother 116 120 112 128 184 186 202 210 225 243 271 283 120 134 110 110 L013 118 120 112 128 184 186 210 226 243 245 271 287 120 120 110 132 L014 118 130 112 112 174 184 202 210 225 243 283 287 120 134 110 154 L015 120 130 106 128 184 184 202 202 225 243 275 283 134 134 110 132 L016 118 130 106 112 184 184 202 210 225 225 283 287 134 134 110 132 L017 116 118 112 112 184 186 202 210 225 225 271 287 120 134 110 132 L018 118 130 112 112 184 184 210 226 225 225 283 287 120 120 110 132 L019 116 118 106 128 174 186 210 226 225 243 283 287 120 120 110 154 L205 118 120 112 112 184 184 210 226 243 245 271 287 120 134 110 132 MCW0029 MCW0145 LEI0107 ADL0304 ADL0324 MCW0063 MCW0264 A1 A2 A1 A2 A1 A2 A1 A2 A1 A2 A1 A2 A1 A2 part 161 185 190 200 210 210 140 158 166 182 132 140 233 233 mother 161 181 204 210 210 212 140 152 166 172 140 140 233 239 L013 161 161 200 210 210 210 140 140 172 182 140 140 233 239 L014 161 181 200 204 210 210 140 158 166 182 140 140 233 233 L015 161 181 190 204 210 212 140 152 166 172 132 140 233 239 L016 161 181 190 210 210 210 140 152 166 172 132 140 233 239 L017 161 161 200 204 210 212 140 152 166 182 132 140 233 233 L018 161 161 190 204 210 210 140 140 166 166 140 140 233 239 L019 181 185 190 204 210 210 140 140 166 182 140 140 233 233 L205 181 185 200 210 210 212 140 152 166 172 140 140 233 233

<110> ChungNam National University Foundation of University-Industry Cooperation <120> Microsatellite Marker for individual native in native          chicken and individualizing Method Using the Same <130> P12-0034 <160> 30 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> LEI0251_F <400> 1 gatctagaaa tggctgactg ac 22 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> LEI0251_R <400> 2 gggttactct tatgtttaat gatgtc 26 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0259_F <400> 3 ctcattgcag aggaagttct 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0259_R <400> 4 gtaatggagg atgctcaggt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0021_F <400> 5 gctcctcgct ttgctctgaa 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0021_R <400> 6 gcttagcctc atctcttgta 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0104_F <400> 7 tagcacaact caagctgtga g 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0104_R <400> 8 agacttgcac agctgtgtac c 21 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MCW0261_F <400> 9 gagcagttca tatgaagtgc ag 22 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0261_R <400> 10 gtagtagcag ctacaccaga g 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0087_F <400> 11 atttctgcag ccaacttgga g 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0087_R <400> 12 ctcaggcagt tctcaagaac a 21 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0292_F <400> 13 ccaaatcagg caaaacttct 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0292_R <400> 14 aaatggccta aggatgagga 20 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GCT0016_F <400> 15 tccaaggttc tccagttc 18 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GCT0016_R <400> 16 ggcataagga tagcaacag 19 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MCW0029_F <400> 17 gtggacaccc atttgtaccc tatg 24 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0029_R <400> 18 catgcaattc aggaccgtgc a 21 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MCW0145_F <400> 19 actttattct ccaaatttgg ct 22 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0145_R <400> 20 aaacacaatg gcaacggaaa c 21 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LEI0107_F <400> 21 gctgctcaga agcatctgtg c 21 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LEI0107_R <400> 22 atcattgcta caccatggtt c 21 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0304_F <400> 23 ggggaggaac tctggaaatg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0304_R <400> 24 cctcatgctt cgtgcttttt 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0324_F <400> 25 ttgcctcgac ggaccacaat 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ADL0324_R <400> 26 gcagccccgc caagtaactg 20 <210> 27 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> MCW0063_F <400> 27 ggctccaaaa gcttgttctt agct 24 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MCW0063_R <400> 28 gaaaaccagt aaagcttctt ac 22 <210> 29 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0264_F <400> 29 cttacttttc acgacagaag c 21 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MCW0264_R <400> 30 agactgagtc acactcgtaa g 21

Claims (5)

A method for identifying an individual of a traditional chicken using a first set of microsatellite markers consisting of micro satellite markers LEI0251, ADL0259, ADL0021, MCW0104, MCW0261, MCW0087, ADL0292, GCT0016, MCW0029, MCW0145, LEI0107, ADL0304. A method for identifying an individual of a conventional chicken using a second set of micro satellite markers comprising at least one of micro satellite markers ADL0324, MCW0063, and MCW0264 in the first set of micro satellite markers of claim 1. 1 and 2, 3 and 4, 5 and 6, 7 and 8, 9 and 10, 11 and 12, 13 and 14, 15 and 16, respectively, specific to the respective microsatellite markers of claims 1 or 2, 17 and 18, 19 and 20, 21 and 22, 23 and 24, 25 and 26, 27 and 28, 29 and 30, and a pair of reverse primers. A kit for identifying a conventional chicken, comprising a set of primers for identifying a native chicken of claim 3. The method according to any one of claims 1 to 3, comprising the steps of: identifying an individual of a native chicken using a first set of microsatellite markers and a second set;
(a) PCR amplifying a nucleic acid sample of a control for identification of a subject using the conventional chicken identification primer set of claim 3 to produce amplification products;
(b) detecting an allele of each amplification product from the amplification products produced in step (a) and determining the size of the allele gene;
(c) amplifying the nucleic acid sample of the individual to be identified by PCR amplification using the conventional chicken identification primer set of paragraph 3;
(d) detecting an allele of each amplification product from the amplification products produced in step (c) through an electrophoresis apparatus and determining an allele gene size;
(e-1) comparing the size of the alleles of the sample to be confirmed determined in the step (d) with the size of the alleles of the control determined in the steps (a) to (b) step;
(e-2) comparing the sizes of the alleles of the sample to be confirmed determined in the step (d) with the sizes of the alleles of the control determined in the steps (a) to (b) The method comprising the steps of: a.

Images