KR102276917B1 - EST-SSR primer set for identifying Perilla frutescens cultivar, kit for identifying Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same - Google Patents

EST-SSR primer set for identifying Perilla frutescens cultivar, kit for identifying Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same Download PDF

Info

Publication number
KR102276917B1
KR102276917B1 KR1020200023401A KR20200023401A KR102276917B1 KR 102276917 B1 KR102276917 B1 KR 102276917B1 KR 1020200023401 A KR1020200023401 A KR 1020200023401A KR 20200023401 A KR20200023401 A KR 20200023401A KR 102276917 B1 KR102276917 B1 KR 102276917B1
Authority
KR
South Korea
Prior art keywords
primer set
seq
nos
represented
perilla
Prior art date
Application number
KR1020200023401A
Other languages
Korean (ko)
Inventor
권순재
이민규
유재일
김동건
김정민
안준우
김진백
Original Assignee
한국원자력연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국원자력연구원 filed Critical 한국원자력연구원
Priority to KR1020200023401A priority Critical patent/KR102276917B1/en
Application granted granted Critical
Publication of KR102276917B1 publication Critical patent/KR102276917B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to an EST-SSR primer set for identifying perilla and beefsteak plant varieties, a kit for identifying perilla and beefsteak plant varieties including the same, and a method for identifying genetic resources of perilla and beefsteak plant varieties using the same.

Description

들깨 및 차조기 품종 판별용 EST-SSR 프라이머 세트, 이를 포함하는 들깨 및 차조기 품종 판별용 키트, 그리고 이를 이용한 들깨 및 차조기 품종의 유전자원 판별 방법{EST-SSR primer set for identifying Perilla frutescens cultivar, kit for identifying Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same}EST-SSR primer set for identifying perilla and perilla varieties, kit for identifying perilla and perilla varieties including the same, and a method for identifying genetic resources of perilla and perilla varieties using the same Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same}

본 발명은 들깨 및 차조기 품종을 판별할 수 있는 EST-SSR 프라이머 세트, 이를 포함하는 들깨 및 차조기 품종 판별용 키트, 그리고 이를 이용한 들깨 및 차조기 품종의 유전자원을 판별하는 방법에 관한 것이다. The present invention relates to an EST-SSR primer set capable of discriminating cultivars of perilla and perilla, a kit for discriminating cultivars of perilla and perilla including the same, and a method of discriminating genetic resources of cultivars of perilla and perilla using the same.

육종에 이용되고 있는 대부분의 주요 작물 및 소 재배 작물에서 해마다 많은 양의 유전자원이 수집 및 육성되고 있다. 또한, 기존 돌연변이 육종 방법보다는 방사선을 이용한 첨단 방사선 육종 기술이 현재 국내외로 널리 수행되고 있는 실정이다. 그러나 육종기술의 발전에 반해 수집 및 육성된 식물 유전자원에 대한 평가는 충분히 이루어지지 않고 있는 실정이다. 또한 품종의 판별과 함께 유전자원의 유용 형질 탐색과 분류, 그리고 유연관계의 규명은 유전자원의 보존이나 신품종의 창출 및 작물의 개량에 있어서 매우 중요하다.In most major crops and cattle grown crops used for breeding, a large amount of genetic resources are collected and nurtured every year. In addition, the state-of-the-art radiation breeding technology using radiation rather than the existing mutation breeding method is currently being widely performed at home and abroad. However, in contrast to the development of breeding technology, the evaluation of collected and cultivated plant genetic resources is not sufficiently performed. In addition, along with the identification of varieties, the search for useful traits and classification of genetic resources, and the identification of related relationships are very important in the preservation of genetic resources, creation of new varieties, and crop improvement.

최근 분자생물학의 급속한 발전으로 핵산(DNA) 수준에서 유전자원의 다양성(bio-diversity) 연구를 가능케 하는 핵산 지문 분석 방법 및 다양한 DNA 마커들이 개발되었다. 이를 통해 유용 형질 탐색, 생물의 종 판별, 품종 분류/동정 및 집단 개체군의 유연관계 분석을 외부환경 등에 대하여 거의 영향을 받지 않고 간단하고 신속하게 수행할 수 있게 되었다. 지금까지 개발된 PCR(polymerase chain reaction)을 이용한 핵산지문법(fingerprinting)에는 RAPD(randomly amplified polymorphic DNAs) 방법, AFLP(amplified fragment length polymorphic DNA) 방법, SSR (simple sequence repeat) 방법 등이 있다. Recently, with the rapid development of molecular biology, nucleic acid fingerprint analysis methods and various DNA markers have been developed that enable the study of bio-diversity at the nucleic acid (DNA) level. Through this, search for useful traits, identification of species of organisms, classification/identification of varieties, and analysis of relationship between groups and populations could be performed simply and quickly without being affected by the external environment. Nucleic acid fingerprinting using PCR (polymerase chain reaction) developed so far includes randomly amplified polymorphic DNAs (RAPD) method, amplified fragment length polymorphic DNA (AFLP) method, and simple sequence repeat (SSR) method.

상기 방법 중 RAPD 방법은 비특이적 PCR 산물이 증폭되므로 재현성이 떨어지는 단점이 있고, AFLP 방법은 높은 DNA 다형성 검출로 각광받고 있지만 재현성이 떨어지는 밴드의 출현과 분석이 복잡하다는 단점이 있다. 이에 반해, SSR (Simple sequence repeat) 혹은 초위성체(Microsatellite)는 유전자좌에서 보이는 다형성으로, 단순 반복 염기서열의 반복 횟수 차이로 관찰된다. 생물의 유전체에 존재하는 많은 수의 SSR을 초위성체라고 하는데, 초위성체는 2-6개의 뉴클레오티드가 단순 반복되어 있는 경우가 많고 이는 DNA 복제 시 불균형 교차 등으로 인해 생성되는 것으로 알려져 있으며, 단순반복서열의 반복 수는 식물의 종간 혹은 종 내에도 다양한 차이를 보이기 때문에 다형성의 수준이 높은 다중대립인자이고, 공우성 마커이고 재현성도 뛰어나다. EST-SSR은 cDNA에서 추출한 SSR로서 Genomic DNA의 SSR이 가지는 인트론(intron) 및 비번역(untranslation) 영역이 제외된 실제 단백질로 코딩되는 유전자 부위만을 이용하여 개발하였기 때문에 실제 유전자의 차이 및 동정에 더욱 정확하게 사용이 가능하다. 통상적으로 초위성체는 그 주위의 DNA 염기서열로부터 고안된 프라이머를 이용하여 PCR(polymerase chain reaction)을 통해 증폭시킬 수 있으며, 증폭된 산물은 단순 염기서열 반복수의 차이로부터 다형성을 보인다. Among the above methods, the RAPD method has a disadvantage in that reproducibility is poor because non-specific PCR products are amplified, and the AFLP method is in the spotlight as a high DNA polymorphism detection, but the appearance and analysis of a band with poor reproducibility is complicated. In contrast, simple sequence repeat (SSR) or microsatellite is a polymorphism seen at a locus, and is observed by a difference in the number of repetitions of the simple repeat nucleotide sequence. A large number of SSRs in the genome of an organism are called supersatellites. Supersatellites often have simple repeats of 2-6 nucleotides, which are known to be generated due to unbalanced crossovers during DNA replication. Since the number of repeats of plants shows various differences between or within species of plants, it is a multi-allele with a high level of polymorphism, is a co-dominant marker, and has excellent reproducibility. EST-SSR is an SSR extracted from cDNA and developed using only the gene region encoded by the actual protein excluding the intron and untranslation regions of the SSR of genomic DNA. can be used accurately. In general, supersatellites can be amplified through PCR (polymerase chain reaction) using primers designed from the surrounding DNA sequence, and the amplified product shows polymorphism from the difference in the number of repeats of the simple sequence.

특히, 초위성체는 분석이 용이하고 높은 재현성을 가지는 장점으로 인하여 생물종의 동정에 자주 사용되고 있으며, 외부 환경의 영향을 전혀 받지 않는다는 장점이 있다. 이와 같은 SSR 방법의 우수성으로 인해 여러 주요작물 및 소재배 작물에서 SSR 마커를 개발하려는 연구가 한창 진행 중에 있다. 최근에는 SSR 마커가 식물의 유전 육종이나 질병 및 분자생물학적 연구에 매우 유용한 것으로 확인되었다. 따라서, 일부 국가에서는 자국의 주요 농작물에 대한 초위성체 연구가 상당히 진행되어 있으며, 예를 들면, 미국에서는 옥수수, 독일에서는 보리나 감자, 이탈리아에는 포도에 대한 연구가 이루어져 이에 대한 데이터베이스가 구축되어 있다. In particular, supersatellites are often used for identification of biological species due to their easy analysis and high reproducibility, and have the advantage that they are not affected by the external environment at all. Due to the superiority of the SSR method, studies to develop SSR markers in several major crops and cultivar crops are in full swing. Recently, it has been confirmed that SSR markers are very useful for genetic breeding of plants, diseases, and molecular biology studies. Therefore, in some countries, supersatellite research on major crops in their country is progressing considerably. For example, research on corn in the United States, barley or potatoes in Germany, and grapes in Italy has been made and a database has been established.

최근 2~3년간 식물에서 초위성체를 염색체 지도 작성과 새로운 유용 유전자 동정, 및 유전 육종에 활용하는 연구가 매우 활발히 진행되고 있으며, 세계적인 식량자원으로 중요한 벼와 옥수수 등에 대한 연구가 특히 활발히 수행되고 있다. 특히 SSR 방법은 외부 환경의 영향을 전혀 받지 않는다는 장점이 있어, 예를 들어. 공개특허 제2013-0013464호와 같이 EST-SSR 프라이머 세트를 이용하여 감 품종을 판별하는 방법에 대해 연구되고 있어, 이와 같은 SSR 방법의 우수성으로 인해 여러 주요작물 및 소재배 작물에서 SSR 마커를 개발하려는 연구가 한창 진행 중에 있다.For the last two to three years, research on using supersatellites in plants for chromosome mapping, identification of new useful genes, and genetic breeding has been very active, and research on rice and corn, which are important global food resources, is being actively carried out. . In particular, the SSR method has the advantage that it is not affected by the external environment at all, for example. As in Korean Patent Publication No. 2013-0013464, a method for discriminating persimmon varieties using the EST-SSR primer set is being studied. Research is in full swing.

본 발명은 들깨 및 차조기의 품종을 판별하기 위하여, 신규한 EST-SSR 프라이머 세트를 개발하고, 들깨 및 차조기 품종의 유전적 다형성, 유연관계를 분석하여, 들깨 및 차조기의 품종을 판별할 수 있는 프라이머 세트를 제공한다. The present invention develops a novel EST-SSR primer set to discriminate the varieties of perilla and perilla, and analyzes the genetic polymorphism and kinship of perilla and perilla varieties, primers capable of discriminating the varieties of perilla and perilla provides a set.

본 발명은 상기 프라이머 세트를 포함하는 들깨 및 차조기 품종 판별용 키트를 제공한다. The present invention provides a kit for identifying perilla and perilla varieties comprising the primer set.

본 발명은 상기 프라이머 세트를 이용한 들깨 및 차조기의 품종을 판별하는 방법을 제공한다. The present invention provides a method for discriminating the varieties of perilla and perilla using the primer set.

본 발명의 일 견지에 있어서, 본 발명은 서열번호 1 및 2로 표시되는 프라이머 세트 1; 서열번호 3 및 4로 표시되는 프라이머 세트 2; 서열번호 5 및 6으로 표시되는 프라이머 세트 3; 서열번호 7 및 8로 표시되는 프라이머 세트 4; 서열번호 9 및 10으로 표시되는 프라이머 세트 5; 서열번호 11 및 12로 표시되는 프라이머 세트 6; 서열번호 13 및 14로 표시되는 프라이머 세트 7; 서열번호 15 및 16으로 표시되는 프라이머 세트 8; 서열번호 17 및 18로 표시되는 프라이머 세트 9; 서열번호 19 및 20으로 표시되는 프라이머 세트 10; 서열번호 21 및 22로 표시되는 프라이머 세트 11; 서열번호 23 및 24로 표시되는 프라이머 세트 12; 서열번호 25 및 26으로 표시되는 프라이머 세트 13; 서열번호 27 및 28로 표시되는 프라이머 세트 14; 서열번호 29 및 30으로 표시되는 프라이머 세트 15; 서열번호 31 및 32로 표시되는 프라이머 세트 16; 서열번호 33 및 34로 표시되는 프라이머 세트 17; 서열번호 35 및 36으로 표시되는 프라이머 세트 18; 서열번호 37 및 38로 표시되는 프라이머 세트 19; 서열번호 39 및 40으로 표시되는 프라이머 세트 20; 서열번호 41 및 42로 표시되는 프라이머 세트 21; 서열번호 43 및 44로 표시되는 프라이머 세트 22; 서열번호 45 및 46으로 표시되는 프라이머 세트 23; 서열번호 47 및 48로 표시되는 프라이머 세트 24; 서열번호 49 및 50으로 표시되는 프라이머 세트 25; 서열번호 51 및 52로 표시되는 프라이머 세트 26; 서열번호 53 및 54로 표시되는 프라이머 세트 27; 서열번호 55 및 56으로 표시되는 프라이머 세트 28; 서열번호 57 및 58로 표시되는 프라이머 세트 29; 서열번호 59 및 60으로 표시되는 프라이머 세트 30; 서열번호 61 및 62로 표시되는 프라이머 세트 31; 서열번호 63 및 64로 표시되는 프라이머 세트 32; 서열번호 65 및 66으로 표시되는 프라이머 세트 33; 서열번호 67 및 68로 표시되는 프라이머 세트 34; 서열번호 69 및 70으로 표시되는 프라이머 세트 35; 서열번호 71 및 72로 표시되는 프라이머 세트 36; 서열번호 73 및 74로 표시되는 프라이머 세트 37; 서열번호 75 및 76으로 표시되는 프라이머 세트 38; 서열번호 77 및 78로 표시되는 프라이머 세트 39; 서열번호 79 및 80으로 표시되는 프라이머 세트 40; 서열번호 81 및 82로 표시되는 프라이머 세트 41; 서열번호 83 및 84로 표시되는 프라이머 세트 42; 서열번호 85 및 86으로 표시되는 프라이머 세트 43; 서열번호 87 및 88로 표시되는 프라이머 세트 44; 서열번호 89 및 90으로 표시되는 프라이머 세트 45; 서열번호 91 및 92로 표시되는 프라이머 세트 46; 서열번호 93 및 94로 표시되는 프라이머 세트 47; 서열번호 95 및 96으로 표시되는 프라이머 세트 48; 서열번호 97 및 98로 표시되는 프라이머 세트 49; 서열번호 99 및 100으로 표시되는 프라이머 세트 50; 서열번호 101 및 102로 표시되는 프라이머 세트 51; 서열번호 103 및 104로 표시되는 프라이머 세트 52; 서열번호 105 및 106으로 표시되는 프라이머 세트 53; 서열번호 107 및 108로 표시되는 프라이머 세트 54; 서열번호 109 및 110으로 표시되는 프라이머 세트 55; 서열번호 111 및 112로 표시되는 프라이머 세트 56; 서열번호 113 및 114로 표시되는 프라이머 세트 57; 및 서열번호 115 및 116으로 표시되는 프라이머 세트 58을 포함하는, 들깨 및 차조기 품종 판별용 EST-SSR(expressed sequence tags-simple sequence repeat) 프라이머 세트를 제공하는 것이다. In one aspect of the present invention, the present invention provides a primer set 1 represented by SEQ ID NOs: 1 and 2; primer set 2 represented by SEQ ID NOs: 3 and 4; primer set 3 represented by SEQ ID NOs: 5 and 6; primer set 4 represented by SEQ ID NOs: 7 and 8; primer set 5 represented by SEQ ID NOs: 9 and 10; Primer set 6 represented by SEQ ID NOs: 11 and 12; Primer set 7 represented by SEQ ID NOs: 13 and 14; primer set 8 represented by SEQ ID NOs: 15 and 16; primer set 9 represented by SEQ ID NOs: 17 and 18; Primer set 10 represented by SEQ ID NOs: 19 and 20; Primer set 11 represented by SEQ ID NOs: 21 and 22; Primer set 12 represented by SEQ ID NOs: 23 and 24; primer set 13 represented by SEQ ID NOs: 25 and 26; Primer set 14 represented by SEQ ID NOs: 27 and 28; Primer set 15 represented by SEQ ID NOs: 29 and 30; primer set 16 represented by SEQ ID NOs: 31 and 32; Primer set 17 represented by SEQ ID NOs: 33 and 34; Primer set 18 represented by SEQ ID NOs: 35 and 36; Primer set 19 represented by SEQ ID NOs: 37 and 38; Primer set 20 represented by SEQ ID NOs: 39 and 40; primer set 21 represented by SEQ ID NOs: 41 and 42; Primer set 22 represented by SEQ ID NOs: 43 and 44; Primer set 23 represented by SEQ ID NOs: 45 and 46; Primer set 24 represented by SEQ ID NOs: 47 and 48; Primer set 25 represented by SEQ ID NOs: 49 and 50; primer set 26 represented by SEQ ID NOs: 51 and 52; Primer set 27 represented by SEQ ID NOs: 53 and 54; Primer set 28 represented by SEQ ID NOs: 55 and 56; Primer set 29 represented by SEQ ID NOs: 57 and 58; Primer set 30 represented by SEQ ID NOs: 59 and 60; Primer set 31 represented by SEQ ID NOs: 61 and 62; Primer set 32 represented by SEQ ID NOs: 63 and 64; Primer set 33 represented by SEQ ID NOs: 65 and 66; Primer set 34 represented by SEQ ID NOs: 67 and 68; Primer set 35 represented by SEQ ID NOs: 69 and 70; Primer set 36 represented by SEQ ID NOs: 71 and 72; Primer set 37 represented by SEQ ID NOs: 73 and 74; primer set 38 represented by SEQ ID NOs: 75 and 76; Primer set 39 represented by SEQ ID NOs: 77 and 78; primer set 40 represented by SEQ ID NOs: 79 and 80; primer set 41 represented by SEQ ID NOs: 81 and 82; primer set 42 represented by SEQ ID NOs: 83 and 84; primer set 43 represented by SEQ ID NOs: 85 and 86; Primer set 44 represented by SEQ ID NOs: 87 and 88; Primer set 45 represented by SEQ ID NOs: 89 and 90; Primer set 46 represented by SEQ ID NOs: 91 and 92; Primer set 47 represented by SEQ ID NOs: 93 and 94; Primer set 48 represented by SEQ ID NOs: 95 and 96; Primer set 49 represented by SEQ ID NOs: 97 and 98; Primer set 50 represented by SEQ ID NOs: 99 and 100; Primer set 51 represented by SEQ ID NOs: 101 and 102; Primer set 52 represented by SEQ ID NOs: 103 and 104; Primer set 53 represented by SEQ ID NOs: 105 and 106; Primer set 54 represented by SEQ ID NOs: 107 and 108; Primer set 55 represented by SEQ ID NOs: 109 and 110; Primer set 56 represented by SEQ ID NOs: 111 and 112; Primer set 57 represented by SEQ ID NOs: 113 and 114; And it is to provide an EST-SSR (expressed sequence tags-simple sequence repeat) primer set for discrimination of perilla and perilla varieties, including a primer set 58 represented by SEQ ID NOs: 115 and 116.

본 발명의 일 견지에 있어서, 본 발명은 상기 들깨 및 차조기 품종 판별용 EST-SSR 프라이머 세트를 포함하는 들깨 및 차조기 품종 판별용 키트를 제공하는 것이다. In one aspect of the present invention, the present invention provides a kit for discrimination of perilla and perilla varieties comprising the EST-SSR primer set for discrimination of perilla and perilla varieties.

본 발명의 일 견지에 있어서, 본 발명은 판별 대상인 들깨 및 차조기 품종의 DNA를 주형으로 하고, 상기 들깨 및 차조기 품종 판별용 EST-SSR 프라이머 세트를 이용하여 PCR 증폭시키는 단계; 및 PCR 증폭산물의 증폭 유무 및 크기로 분석하는 단계를 포함하는, 들깨 및 차조기 품종의 유전자원 판별 방법을 제공하는 것이다. In one aspect of the present invention, the present invention includes the steps of PCR amplifying using the EST-SSR primer set for discrimination of perilla and perilla varieties using the DNA of perilla and perilla varieties to be identified as a template; And it is to provide a method for determining genetic resources of perilla and perilla varieties, comprising the step of analyzing the presence and absence and size of the PCR amplification product.

본 발명에 따른 프라이머 세트는 새롭게 개발되는 마커로써 들깨 및 차조기의 품종/유전자원 DNA 다형성을 효과적으로 검출할 수 있으며, 들깨간, 차조기간 또는 들깨 및 차조기간의 구별도 가능하다. 이는 들깨 및 차조기 품종의 DNA 프로파일을 작성하는데 유용하게 이용될 수 있다. 또한, 이를 통해 들깨, 차조기 품종의 유전자원을 효율적으로 평가함으로써, 신규 유전자원 도입 시 기존 보유자원과의 중복성 분석 및 신규성 확립을 효과적으로 수행할 수 있는 효과를 제공할 수 있다.As a newly developed marker, the primer set according to the present invention can effectively detect cultivar/genetic DNA polymorphisms of perilla and perilla, and it is also possible to distinguish between perilla and perilla or perilla and perilla. This can be usefully used to prepare the DNA profile of perilla and perilla varieties. In addition, by efficiently evaluating the genetic resources of perilla and perilla varieties through this, it is possible to provide the effect of effectively performing an analysis of redundancy with existing resources and establishment of novelty when introducing new genetic resources.

도 1은 본 발명의 EST-SSR 프라이머 세트를 이용하여 판별된 73종의 들깨 및 13종의 차조기(총 96종)의 계통수를 나타낸다. 1 shows the phylogenetic tree of 73 types of perilla and 13 types of perilla (a total of 96 types) determined using the EST-SSR primer set of the present invention.

이하, 첨부된 도면을 참조하여 본 발명의 바람직한 실시 형태를 설명한다. 그러나, 본 발명의 실시 형태는 여러 가지 다른 형태로 변형될 수 있으며, 본 발명의 범위가 이하 설명하는 실시 형태로 한정되는 것은 아니다. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Hereinafter, preferred embodiments of the present invention will be described with reference to the accompanying drawings. However, the embodiment of the present invention may be modified in various other forms, and the scope of the present invention is not limited to the embodiments described below.

본 발명은 들깨 및 차조기의 야생종, 돌연변이 품종에 대해 다형성을 나타내는 들깨 및 차조기 품종 식별용 프라이머 세트를 제공한다. The present invention provides a primer set for identifying cultivars of perilla and perilla showing polymorphism in wild and mutant cultivars of perilla and perilla.

구체적으로, 본 발명은 들깨 및 차조기 품종을 식별할 수 있는 EST-SSR 프라이머 세트를 제공한다. Specifically, the present invention provides an EST-SSR primer set that can identify perilla and perilla varieties.

더욱 구체적으로, 본 발명은 서열번호 1 및 2로 표시되는 프라이머 세트 1; 서열번호 3 및 4로 표시되는 프라이머 세트 2; 서열번호 5 및 6으로 표시되는 프라이머 세트 3; 서열번호 7 및 8로 표시되는 프라이머 세트 4; 서열번호 9 및 10으로 표시되는 프라이머 세트 5; 서열번호 11 및 12로 표시되는 프라이머 세트 6; 서열번호 13 및 14로 표시되는 프라이머 세트 7; 서열번호 15 및 16으로 표시되는 프라이머 세트 8; 서열번호 17 및 18로 표시되는 프라이머 세트 9; 서열번호 19 및 20으로 표시되는 프라이머 세트 10; 서열번호 21 및 22로 표시되는 프라이머 세트 11; 서열번호 23 및 24로 표시되는 프라이머 세트 12; 서열번호 25 및 26으로 표시되는 프라이머 세트 13; 서열번호 27 및 28로 표시되는 프라이머 세트 14; 서열번호 29 및 30으로 표시되는 프라이머 세트 15; 서열번호 31 및 32로 표시되는 프라이머 세트 16; 서열번호 33 및 34로 표시되는 프라이머 세트 17; 서열번호 35 및 36으로 표시되는 프라이머 세트 18; 서열번호 37 및 38로 표시되는 프라이머 세트 19; 서열번호 39 및 40으로 표시되는 프라이머 세트 20; 서열번호 41 및 42로 표시되는 프라이머 세트 21; 서열번호 43 및 44로 표시되는 프라이머 세트 22; 서열번호 45 및 46으로 표시되는 프라이머 세트 23; 서열번호 47 및 48로 표시되는 프라이머 세트 24; 서열번호 49 및 50으로 표시되는 프라이머 세트 25; 서열번호 51 및 52로 표시되는 프라이머 세트 26; 서열번호 53 및 54로 표시되는 프라이머 세트 27; 서열번호 55 및 56으로 표시되는 프라이머 세트 28; 서열번호 57 및 58로 표시되는 프라이머 세트 29; 서열번호 59 및 60으로 표시되는 프라이머 세트 30; 서열번호 61 및 62로 표시되는 프라이머 세트 31; 서열번호 63 및 64로 표시되는 프라이머 세트 32; 서열번호 65 및 66으로 표시되는 프라이머 세트 33; 서열번호 67 및 68로 표시되는 프라이머 세트 34; 서열번호 69 및 70으로 표시되는 프라이머 세트 35; 서열번호 71 및 72로 표시되는 프라이머 세트 36; 서열번호 73 및 74로 표시되는 프라이머 세트 37; 서열번호 75 및 76으로 표시되는 프라이머 세트 38; 서열번호 77 및 78로 표시되는 프라이머 세트 39; 서열번호 79 및 80으로 표시되는 프라이머 세트 40; 서열번호 81 및 82로 표시되는 프라이머 세트 41; 서열번호 83 및 84로 표시되는 프라이머 세트 42; 서열번호 85 및 86으로 표시되는 프라이머 세트 43; 서열번호 87 및 88로 표시되는 프라이머 세트 44; 서열번호 89 및 90으로 표시되는 프라이머 세트 45; 서열번호 91 및 92로 표시되는 프라이머 세트 46; 서열번호 93 및 94로 표시되는 프라이머 세트 47; 서열번호 95 및 96으로 표시되는 프라이머 세트 48; 서열번호 97 및 98로 표시되는 프라이머 세트 49; 서열번호 99 및 100으로 표시되는 프라이머 세트 50; 서열번호 101 및 102로 표시되는 프라이머 세트 51; 서열번호 103 및 104로 표시되는 프라이머 세트 52; 서열번호 105 및 106으로 표시되는 프라이머 세트 53; 서열번호 107 및 108로 표시되는 프라이머 세트 54; 서열번호 109 및 110으로 표시되는 프라이머 세트 55; 서열번호 111 및 112로 표시되는 프라이머 세트 56; 서열번호 113 및 114로 표시되는 프라이머 세트 57; 및 서열번호 115 및 116으로 표시되는 프라이머 세트 58을 포함하는, 들깨 및 차조기 품종 판별용 EST-SSR(expressed sequence tags-simple sequence repeat) 프라이머 세트를 제공한다. More specifically, the present invention provides a primer set 1 represented by SEQ ID NOs: 1 and 2; primer set 2 represented by SEQ ID NOs: 3 and 4; primer set 3 represented by SEQ ID NOs: 5 and 6; primer set 4 represented by SEQ ID NOs: 7 and 8; primer set 5 represented by SEQ ID NOs: 9 and 10; Primer set 6 represented by SEQ ID NOs: 11 and 12; Primer set 7 represented by SEQ ID NOs: 13 and 14; primer set 8 represented by SEQ ID NOs: 15 and 16; primer set 9 represented by SEQ ID NOs: 17 and 18; Primer set 10 represented by SEQ ID NOs: 19 and 20; Primer set 11 represented by SEQ ID NOs: 21 and 22; Primer set 12 represented by SEQ ID NOs: 23 and 24; primer set 13 represented by SEQ ID NOs: 25 and 26; Primer set 14 represented by SEQ ID NOs: 27 and 28; Primer set 15 represented by SEQ ID NOs: 29 and 30; primer set 16 represented by SEQ ID NOs: 31 and 32; Primer set 17 represented by SEQ ID NOs: 33 and 34; Primer set 18 represented by SEQ ID NOs: 35 and 36; Primer set 19 represented by SEQ ID NOs: 37 and 38; Primer set 20 represented by SEQ ID NOs: 39 and 40; primer set 21 represented by SEQ ID NOs: 41 and 42; Primer set 22 represented by SEQ ID NOs: 43 and 44; Primer set 23 represented by SEQ ID NOs: 45 and 46; Primer set 24 represented by SEQ ID NOs: 47 and 48; Primer set 25 represented by SEQ ID NOs: 49 and 50; primer set 26 represented by SEQ ID NOs: 51 and 52; Primer set 27 represented by SEQ ID NOs: 53 and 54; Primer set 28 represented by SEQ ID NOs: 55 and 56; Primer set 29 represented by SEQ ID NOs: 57 and 58; Primer set 30 represented by SEQ ID NOs: 59 and 60; Primer set 31 represented by SEQ ID NOs: 61 and 62; Primer set 32 represented by SEQ ID NOs: 63 and 64; Primer set 33 represented by SEQ ID NOs: 65 and 66; Primer set 34 represented by SEQ ID NOs: 67 and 68; Primer set 35 represented by SEQ ID NOs: 69 and 70; Primer set 36 represented by SEQ ID NOs: 71 and 72; Primer set 37 represented by SEQ ID NOs: 73 and 74; primer set 38 represented by SEQ ID NOs: 75 and 76; Primer set 39 represented by SEQ ID NOs: 77 and 78; primer set 40 represented by SEQ ID NOs: 79 and 80; primer set 41 represented by SEQ ID NOs: 81 and 82; primer set 42 represented by SEQ ID NOs: 83 and 84; primer set 43 represented by SEQ ID NOs: 85 and 86; Primer set 44 represented by SEQ ID NOs: 87 and 88; Primer set 45 represented by SEQ ID NOs: 89 and 90; Primer set 46 represented by SEQ ID NOs: 91 and 92; Primer set 47 represented by SEQ ID NOs: 93 and 94; Primer set 48 represented by SEQ ID NOs: 95 and 96; Primer set 49 represented by SEQ ID NOs: 97 and 98; Primer set 50 represented by SEQ ID NOs: 99 and 100; Primer set 51 represented by SEQ ID NOs: 101 and 102; Primer set 52 represented by SEQ ID NOs: 103 and 104; Primer set 53 represented by SEQ ID NOs: 105 and 106; Primer set 54 represented by SEQ ID NOs: 107 and 108; Primer set 55 represented by SEQ ID NOs: 109 and 110; Primer set 56 represented by SEQ ID NOs: 111 and 112; Primer set 57 represented by SEQ ID NOs: 113 and 114; And it provides an EST-SSR (expressed sequence tags-simple sequence repeat) primer set for discrimination of perilla and perilla varieties, comprising a primer set 58 represented by SEQ ID NOs: 115 and 116.

본 발명의 EST-SSR 프라이머 세트는 번호 1 ~ 96으로 이루어진 그룹으로부터 선택되는 들깨 또는 차조기 품종을 구분할 수 있으며, 상기 들깨 및 차조기 품종은 하기 표 1에 정리되었다. 이 때, 안티스페릴(Antisperill)은 한국특허출원 제10-2016-0120830호에 개시된, 기탁번호 KCTC 13077BP의 차조기일 수 있다.The EST-SSR primer set of the present invention can distinguish perilla or perilla varieties selected from the group consisting of numbers 1 to 96, and the perilla and perilla varieties are summarized in Table 1 below. At this time, antisperill (Antisperill) may be perilla perilla disclosed in Korean Patent Application No. 10-2016-0120830, accession number KCTC 13077BP.

번호 number 품종명(Accession)Accession 번호 number 품종명breed name 번호 number 품종명breed name 1One Antisperillantisperll 3333 IT 226664IT 226664 6565 IT 220393IT 220393 22 Wild type(차조기 야생종)Wild type 3434 IT 226671IT 226671 6666 IT 220395IT 220395 33 IT 220380IT 220380 3535 IT 226672IT 226672 6767 IT 220397IT 220397 44 IT 226692IT 226692 3636 IT 236930IT 236930 6868 IT 226732IT 226732 55 IT 229043IT 229043 3737 IT 240108IT 240108 6969 IT 226733IT 226733 66 IT 242083IT 242083 3838 IT 274215IT 274215 7070 IT 226737IT 226737 77 IT 242256IT 242256 3939 IT 305543IT 305543 7171 IT 226742IT 226742 88 IT 267741IT 267741 4040 IT 226663IT 226663 7272 IT 226743IT 226743 99 IT 271306IT 271306 4141 IT 274210IT 274210 7373 IT 226744IT 226744 1010 IT 271317IT 271317 4242 IT 196391IT 196391 7474 IT 260616IT 260616 1111 IT 283645IT 283645 4343 IT 220659IT 220659 7575 IT 271262IT 271262 1212 IT 286213IT 286213 4444 IT 223670IT 223670 7676 IT 274283IT 274283 1313 IT 286246IT 286246 4545 IT 240105IT 240105 7777 IT 274284IT 274284 1414 IT 296762IT 296762 4646 IT 240106IT 240106 7878 IT 274285IT 274285 1515 IT 305302IT 305302 4747 IT 240107IT 240107 7979 IT 274286IT 274286 1616 IT 308494IT 308494 4848 IT 242623IT 242623 8080 IT 274288IT 274288 1717 IT 226670IT 226670 4949 IT 246853IT 246853 8181 IT 274290IT 274290 1818 IT 271310IT 271310 5050 IT 271259IT 271259 8282 IT 274301IT 274301 1919 IT 271311IT 271311 5151 IT 273794IT 273794 8383 IT 274295IT 274295 2020 IT 271319IT 271319 5252 IT 273827IT 273827 8484 IT 200354IT 200354 2121 IT 283597IT 283597 5353 IT 276486IT 276486 8585 IT 226466IT 226466 2222 IT 293400IT 293400 5454 IT 277881IT 277881 8686 IT 274208IT 274208 2323 IT 293402IT 293402 5555 IT 286191IT 286191 8787 IT 226627IT 226627 2424 IT 293403IT 293403 5656 IT 298992IT 298992 8888 PF98075PF98075 2525 IT 201764IT 201764 5757 PF08126PF08126 8989 PF11107PF11107 2626 IT 201765IT 201765 5858 PF08145PF08145 9090 IT 162886IT 162886 2727 IT 201771IT 201771 5959 IT 229026IT 229026 9191 IT 175835IT 175835 2828 IT 201773IT 201773 6060 PF09159PF09159 9292 IT 175889IT 175889 2929 IT 201780IT 201780 6161 IT 302031IT 302031 9393 IT 177137IT 177137 3030 IT 226471IT 226471 6262 IT 213786IT 213786 9494 IT 180973IT 180973 3131 IT 226486IT 226486 6363 IT 226451IT 226451 9595 IT 185622IT 185622 3232 IT 226573IT 226573 6464 IT 220387IT 220387 9696 IT 185625IT 185625

*1: 한국원자력연구원 개발품종, 품종보호권 출원번호: 출원2019-270; 2: 1번의 원품종, 한국원자력연구원 보유; IT No.: 농촌진흥청 농업유전자원센터 관리번호; PF No.: 강원대학교 보유 유전자원. 모든 유전자원은 한국원자력연구원에서 보유하고 있음. * 1: Korea Atomic Energy Research Institute developed variety, variety protection right Application No.: Application 2019-270; 2: Original variety No. 1, possessed by Korea Atomic Energy Research Institute; IT No.: Rural Development Administration Agricultural Genetic Resource Center management number; PF No.: Genetic resources owned by Kangwon National University. All genetic resources are owned by the Korea Atomic Energy Research Institute.

본 발명에 있어서, “프라이머”는 카피하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 말하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용된다. In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primers are allowed to initiate synthesis of the extension product.

따라서, 상기 EST-SSR 프라이머 세트는 들깨 및 차조기를 대상으로 DNA를 추출하고, 이로부터 cDNA 라이브러리를 제조하여 시퀀스를 분석한 후, EST 상의 SSR 부위를 분석하고, 상기 SSR 부위를 증폭할 수 있는 프라이머 세트를 제조하여 이로부터 증폭된 밴드의 증폭크기를 통해, 야생종뿐만 아니라, 방사선육종 기술을 이용하여 개발된 돌연변이 종의 들깨 및 차조기의 유전적 유연관계를 분석하여, 미지의 들깨 및 차조기의 품종을 판별할 수 있다. Therefore, the EST-SSR primer set extracts DNA from perilla and perilla, prepares a cDNA library therefrom and analyzes the sequence, analyzes the SSR site on the EST, and a primer capable of amplifying the SSR site Through the amplification size of the band amplified from the preparation of the set, the genetic relationship between wild and mutant species of perilla and perilla developed using radiobreeding technology was analyzed, and unknown varieties of perilla and perilla were identified. can be discerned.

한편, 본 발명은 본 발명의 들깨 및 차조기 품종 판별용 EST-SSR 프라이머 세트를 포함하는 들깨 및 차조기 품종 판별용 키트를 제공한다. On the other hand, the present invention provides a kit for discrimination of perilla and perilla varieties comprising the EST-SSR primer set for discrimination of perilla and perilla varieties of the present invention.

이를 위해, 본 발명의 EST-SSR 프라이머 세트는 DNA 삽입(intercalating) 형광, 인광 또는 방사성을 발하는 물질을 표지 물질로써 더 포함할 수 있으나, 이에 제한되는 것은 아니다. 바람직하게, 상기 표지 물질은 VIC, NED, FAM, HEX 또는 PET일 수 있다. 상기 표지 물질은 표적 서열의 증폭 시 프라이머의 5'-말단에 VIC, NED, FAM, HEX 또는 PET를 표지하여 PCR을 수행하면 표적 서열이 검출 가능한 형광 표지 물질로 표지될 수 있다. 또한, 방사성 물질을 이용한 표지는 PCR 수행 시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하면 증폭 산물이 합성되면서 방사성이 증폭 산물에 혼입되어 증폭 산물이 방사성으로 표지 될 수 있다. To this end, the EST-SSR primer set of the present invention may further include a DNA intercalating fluorescence, phosphorescence or radioactive material as a labeling material, but is not limited thereto. Preferably, the labeling material may be VIC, NED, FAM, HEX or PET. The labeling material may be labeled with a fluorescent labeling material capable of detecting the target sequence when PCR is performed by labeling VIC, NED, FAM, HEX or PET at the 5'-end of the primer during amplification of the target sequence. In addition, when a radioactive isotope such as 32 P or 35 S is added to the PCR reaction solution for labeling using a radioactive material, the amplification product is synthesized and radioactivity is incorporated into the amplification product, and the amplification product may be radioactively labeled.

나아가, 본 발명의 들깨 및 품종 판별용 키트는 당업계에서 사용되는 PCR에 필요한 시약을 더 포함할 수 있다. 예를 들어, 상기 PCR에 필요한 시약은 프라이머 세트(정방향 프라이머, 역방향 프라이머) 외에 적정량의 DNA 중합효소(예를 들어 Taq DNA 폴리머라제, Enzymatics), dNTP 혼합물, PCR 반응 버퍼(예를 들어, KCl, Tris-HCl 및 MgCl2를 함유한 버퍼) 및 물을 포함할 수 있다. Furthermore, the kit for identifying perilla and varieties of the present invention may further include reagents necessary for PCR used in the art. For example, the reagents required for the PCR include an appropriate amount of a DNA polymerase (eg Taq DNA polymerase, Enzymatics), a dNTP mixture, a PCR reaction buffer (eg, KCl, buffer containing Tris-HCl and MgCl 2 ) and water.

한편, 본 발명은 들깨 및 차조기 품종의 유전자원을 판별하는 방법을 제공한다. On the other hand, the present invention provides a method for determining the genetic resources of perilla and perilla varieties.

상세하게, 본 발명은 판별 대상인 들깨 및 차조기 품종의 DNA를 주형으로 하고, 본 발명의 들깨 및 차조기 품종 판별용 EST-SSR 프라이머 세트를 이용하여 PCR 증폭시키는 단계; 및 PCR 증폭산물의 증폭 유뮤 및 크기를 분석하는 단계를 포함하는, 들깨 및 차조기 품종의 유전자원 판별 방법을 제공한다. In detail, the present invention includes the steps of PCR amplifying using the EST-SSR primer set for discrimination of perilla and perilla varieties of the present invention, using the DNA of perilla and perilla cultivar as a discrimination target; And it provides a method for determining genetic resources of perilla and perilla varieties, comprising the step of analyzing the presence and size of the amplification of the PCR amplification product.

상기 PCR 증폭시키는 단계는 본 발명의 EST-SSR 프라이머 세트를 포함하는 들깨 및 차조기 품종 판별용 키트를 이용하여 수행될 수 있으며, 예를 들어, 미지의 들깨 및 차조기 품종으로부터 DNA를 추출한 후, 상기 DNA를 주형으로 하여 서열목록 1 내지 116의 프라이머의 각 세트를 이용하여 PCR을 수행할 수 있다. The PCR amplification step may be performed using a kit for identifying perilla and perilla varieties comprising the EST-SSR primer set of the present invention, for example, after DNA is extracted from unknown perilla and perilla varieties, the DNA PCR can be performed using each set of primers of SEQ ID NOs: 1 to 116 using as a template.

상기 판별 대상인 들깨 및 차조기 품종의 DNA는 당업자가 이해하는 기술 수준으로 추출할 수 있는 것으로, 특별히 제한되지 않는다. The DNA of perilla and perilla cultivar, which is the target of the discrimination, can be extracted to a level of skill understood by those skilled in the art, and is not particularly limited.

나아가, 상기 PCR의 증폭 조건은 당업자가 이해하는 기술 수준에서의 통상의 방법에 따라 수행될 수 있는 것으로, 특별히 제한되지 않으며, 예를 들어, 본 발명의 PCR 조건은 94℃에서 1분, 58℃에서 45초, 72℃에서 45초의 합성반응을 40회 시킨 후, 72℃에서 5분 동안 마지막으로 안정적인 합성을 유도하여 PCR 반응을 수행할 수 있다. Furthermore, the PCR amplification conditions can be performed according to a conventional method at the level of skill understood by those skilled in the art, and is not particularly limited. For example, the PCR conditions of the present invention are 94°C for 1 minute, 58°C. After 40 synthetic reactions of 45 seconds at 72°C and 45 seconds at 72°C, the PCR reaction can be performed by inducing a final stable synthesis at 72°C for 5 minutes.

본 발명은 상기 PCR 증폭 산물의 증폭크기를 분석하는 단계에 후속적으로, 상기 PCR 증폭산물의 증폭크기와 상기 프라이머 세트에 의한 들깨 및 차조기 품종별 기준 크기과의 상동성 동정을 통해 들깨 및 차조기 품종을 판별하는 단계를 포함할 수 있다. Following the step of analyzing the amplification size of the PCR amplification product, the present invention provides perilla and perilla varieties through homology identification between the amplification size of the PCR amplification product and the reference size for each perilla and perilla cultivar by the primer set. It may include the step of determining.

이는 판별 대상인 들깨 및 차조기 품종의 DNA를 주형으로 증폭된 PCR 산물을, 상기 표 1에 기재된 들깨 73종 및 차조기 23종의 품종의 DNA를 주형으로 증폭된 PCR 산물과 비교하여, 판별 대상인 들깨 및 차조기가 기존의 들깨 및 차조기에 해당하는 것인 지 여부를 판단할 수 있다. This is by comparing the PCR product amplified with the DNA of the perilla and perilla varieties to be identified as a template, and the PCR product amplified by using the DNA of 73 perilla and 23 perilla varieties described in Table 1 above as a template, and perilla and perilla perilla to be identified. It can be determined whether or not corresponds to the existing perilla and perilla.

따라서, 상기 들깨 및 차조기 품종별 기준 증폭 유무 및 크기는, 상기 프라이머 세트에 의해 증폭되는 표 1에 기재된 들깨 및 차조기의 품종으로 이루어진 그룹으로부터 선택되는 적어도 하나의 들깨 및 차조기 품종의 증폭 유무 및 크기일 수 있다. Therefore, the presence or absence and size of the standard amplification for each perilla and perilla varieties, at least one perilla and perilla varieties selected from the group consisting of the varieties of perilla and perilla described in Table 1 amplified by the primer set, the presence and size of amplification can

이하, 구체적인 실시예를 통해 본 발명을 보다 구체적으로 설명한다. 하기 실시예는 본 발명의 이해를 돕기 위한 예시에 불과하며, 본 발명의 범위가 이에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail through specific examples. The following examples are merely examples to help the understanding of the present invention, and the scope of the present invention is not limited thereto.

실시예Example

(1) 식물 재료와 DNA 추출(1) Extraction of plant material and DNA

전라북도 정읍시 한국원자력연구원 첨단방사선연구소 포장에서 증식되고, 방사선육종 기술을 이용하여 개발된 돌연변이 품종과 원품종으로 상기 돌연변이 품종인 안티스페릴(Antisperill)은 한국특허출원 제10-2016-0120830호에 개시된, 기탁번호 KCTC 13077BP의 차조기이다. 나아가 농촌진흥청 유전자원센터에서 분양 받은 89종, 강원대학교에서 분양 받은 5종, 총 96종(들깨 73종, 차조기 23종)을 사용하였다(표 1 참조)The mutant variety and original variety grown in the field of the Advanced Radiation Research Center at the Korea Atomic Energy Research Institute in Jeongeup-si, Jeollabuk-do, and developed using radiation breeding technology. Antisperill, the mutant variety, was disclosed in Korean Patent Application No. 10-2016-0120830 , perilla with accession number KCTC 13077BP. Furthermore, a total of 96 species (73 perilla, 23 perilla) were used, including 89 species distributed from the Rural Development Administration Genetic Resource Center and 5 species distributed from Kangwon National University (see Table 1).

표 1에 기재된 96종의 들깨 및 차조기 품종에 대해 식물체의 DNA를 추출(Genomic extraction)하였다. Plant DNA was extracted (Genomic extraction) for 96 kinds of perilla and perilla seeds listed in Table 1.

구체적으로는 각 품종의 어린잎을 채취하여 파쇄 후 CTAB 분리법(Cetyl Trimethyl Ammonium Bromide; Murray 외., Nuc, Res., 4321-4325, 1980)을 사용하여 추출하였다. Specifically, young leaves of each variety were collected and crushed, followed by extraction using CTAB separation method (Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc, Res., 4321-4325, 1980).

(2) EST-SSR 마커의 개발 (2) Development of EST-SSR markers

차조기 야생종 그룹에서 동일한 SSR 사이즈를 갖는 20,054개의 SSR과 Antisperill 품종 그룹에서 동일한 SSR 사이즈를 갖는 16,727개의 SSR 서열에서 두 그룹간 비교 가능한 공통의 SSR 서열 14,780개를 선별(RNA-시퀀싱 3반복 사용)하고, 상기 14,780개의 들깨 및 차조기 EST 반복 서열 중 반복 모티프를 가지는 EST-서열을 선별하였다. 선별된 반복 모티프를 가지는 EST-서열을 기초로, SSR 길이가 차이나는 102개의 서열을 이용하여 총 102개의 프라이머 세트를 제조하였다. From 20,054 SSRs having the same SSR size in the perilla wild species group and 16,727 SSR sequences having the same SSR size in the Antisperill cultivar group, 14,780 common SSR sequences comparable between the two groups were selected (using RNA-sequencing 3 repetitions), Among the 14,780 perilla and perilla EST repeat sequences, an EST-sequence having a repeat motif was selected. Based on the EST-sequence having the selected repeat motif, a total of 102 primer sets were prepared using 102 sequences having different SSR lengths.

상기 102개의 프라이머 세트가 상기 표 1에 기재된 96종의 들깨 및 차조기 품종에서 DNA 다형성을 검출하고 유전적 다양성을 분석하는 데 유용하게 사용될 수 있는 마커로써 사용될 수 있는 지 확인하기 위해, 상기 96종의 들깨 및 차조기 품종에서 추출된 DNA를 주형으로, 상기 102개의 프라이머 세트를 이용하여 PCR 증폭 및 자동 전기영동 분석 장치를 통해 증폭 여부를 확인하였다. In order to confirm that the 102 primer sets can be used as markers that can be usefully used to detect DNA polymorphisms and analyze genetic diversity in the 96 kinds of perilla and perilla plants listed in Table 1, the 96 kinds of primers Using the DNA extracted from perilla and perilla varieties as a template, the 102 primer sets were used to confirm amplification through PCR amplification and automatic electrophoresis analysis apparatus.

PCR은 96종의 들깨 및 차조기 품종의 DNA 주형(template)에 2㎕에, 5U Taq DNA 폴리머라제(Enzymatics), 2㎕ 10X PCR 반응버퍼, 1.6㎕ dNTP, 각 프라이머 세트 2㎕에 증류수 10.3㎕을 첨가하여 총 부피 20㎕에서 반응하였다. PCR 조건은 94℃에서 1분, 58℃에서 45초, 72℃에서 45초의 합성반응을 40회 시킨 후, 72℃에서 5분 동안 마지막으로 안정적인 합성을 유도하였다. 나아가, 상기와 같은 PCR의 증폭 산물은 자동 전기영동 분석장치 Caliper Labchip GX Ⅱ를 이용하여 증폭 산물의 결과를 확인하였다. PCR was performed by adding 10.3 μl of distilled water to 2 μl of a DNA template of 96 perilla and perilla varieties, 5U Taq DNA polymerase (Enzymatics), 2 μl 10X PCR reaction buffer, 1.6 μl dNTP, and 2 μl of each primer set. was added to react in a total volume of 20 μl. PCR conditions were 40 times of synthesis reaction of 1 minute at 94°C, 45 seconds at 58°C, and 45 seconds at 72°C, and finally, stable synthesis was induced at 72°C for 5 minutes. Furthermore, for the PCR amplification product as described above, the result of the amplification product was confirmed using an automatic electrophoresis analyzer Caliper Labchip GX II.

그 결과 102개의 프라이머 세트 중 58개의 프라이머 세트에서, 96종의 들개 및 차조기 중 적어도 하나의 품종에서 PCR 증폭 산물이 검출되는 것을 확인하였으며, 상기와 같이 PCR 증폭 산물이 검출되는 58개의 프라이머 세트를 표 2에 정리하였다. As a result, in 58 primer sets out of 102 primer sets, it was confirmed that PCR amplification products were detected in at least one breed of 96 wild dogs and perilla breeds, and 58 primer sets in which PCR amplification products are detected as described above are shown in Table It is summarized in 2.

프라이머 세트Primer set 서열order 서열번호SEQ ID NO: 반복 모티프repeat motif PCR 증폭 산물의 예상 크기Expected size of PCR amplification products 대립인자의 수number of alleles 1One GCAACCCGCCATTTCTGATGGCAACCCGCCATTTCTGATG 1One (AG)11(AG)11 118118 44 TGGTGATGAATGATGATGATGCCGTGGTGATGAATGATGATGATGCCG 22 22 GCAGCATTCTTCGACCGTTGGCAGCATTCTTCGACCGTTG 33 (TCA)5(TCA)5 261261 33 AGGATCCTCCCACGGATAGGAGGATCCTCCCACGGATAGG 44 33 GGAAATCAGGTGGAAATGGCAGGAAATCAGGTGGAAATGGCA 55 (GA)9(GA)9 178178 44 TATTCGTGTGTGCAGACAGCTATTCGTGTGTGCAGACAGC 66 44 CATAGAAGCATGCACGGCACCATAGAAGCATGCACGGCAC 77 (GAA)7(GAA)7 148148 77 ATGGTGAAGGGGGATCGAGAATGGTGAAGGGGGATCGAGA 88 55 CATGTTTCTGCTCTTGCACGTCATGTTTCTGCTCTTGCACGT 99 (TA)8(TA)8 226226 55 CGTGCTACTGGAAAGGTGGTCGTGCTACTGGAAAGGTGGT 1010 66 TCAGACACCACCCATAACAGCTCAGACACCACCCATAACAGC 1111 (TGC)5(TGC)5 251251 33 TCGGAGAACATGAAGCAGCATCGGAGAACATGAAGCAGCA 1212 77 CATAGCTGCTCCACCGGTACCATAGCTGCTCCACCGGTAC 1313 (AC)12(AC)12 297297 99 TTTCTGCAATTTTCGGGCCGTTTCTGCAATTTTCGGGCCG 1414 88 AGCGAACCCTACTTTAAAACATCAAGCGAACCCTACTTTAAAACATCA 1515 (CT)7(CT)7 116116 66 CTGCCGATGAGACTTCTCCCCTGCCGATGAGACTTCTCCC 1616 99 AATTGCGGTGTTGGTGAAGCAATTGCGGTGTTGGTGAAGC 1717 (TC)9(TC)9 170170 99 TCGGGATTGTCTACTGCTGCTCGGGATTGTCTACTGCTGC 1818 1010 CACGCTTCCTACACCCTCTCCACGCTTCCTACACCCTCTC 1919 (CT)8(CT)8 144144 44 GGATGACTGATTCGCTTCAGCGGATGACTGATTCGCTTCAGC 2020 1111 TATGCACATCCGCTCCCAAATATGCACATCCGCTCCCAAA 2121 (TG)10(TG)10 226226 66 TCCCAAACACTTTTCAAACCACATCCCAAACACTTTTCAAACCACA 2222 1212 TCGCCGCACACACATATACATCGCCGCACACACATATACA 2323 (CCCGTCTG)2(CCCGTCTG)2 174174 22 TCCTCGAACACGCACTTCAATCCTCGAACACGCACTTCAA 2424 1313 AGGCAGGCAATCAAGTCACAAGGCAGGCAATCAAGTCACA 2525 (TCATAAA)2(TCATAAA)2 215215 33 CGCCATTTCCTCCGTCCATACGCCATTTCCTCCGTCCATA 2626 1414 TCTCCCCAAATCCACTCCCTTCTCCCCAAATCCACTCCCT 2727 (AACAACCAC)2(AACAACCAC)2 265265 55 ACGGAATACCCAGTTCAGCTGACGGAATACCCAGTTCAGCTG 2828 1515 GGCAGCCCGACTTTTTGAAGGGCAGCCCGACTTTTTGAAG 2929 (TGCTGA)3(TGCTGA)3 117117 66 TTCGCTGCCTTCTTAGCTCCTTCGCTGCCTTCTTAGCTCC 3030 1616 CATCCATGAGTTGGGCTGGTCATCCATGAGTTGGCTGGT 3131 (AG)9(AG)9 102102 33 TGCGTACTTGTGAGTCCCAATGCGTACTTGTGAGTCCCAA 3232 1717 CCACCACCCTTTTCTCCCAACCACCACCCTTTTCTCCCAA 3333 (TTC)14(TTC)14 110110 99 CGGCATGATCTCGAGTCGAACGGCATGATCTCGAGTCGAA 3434 1818 TTCAACCACACCACCTTGCTTTCAACCACACCACCTTGCT 3535 (GAA)6(GAA)6 183183 55 TCGCACGTCTCGTTTGTGTATCGCACGTCTCGTTTGTGTA 3636 1919 ATACCCAAGGTACGCCCTCTATACCCAAGGTACGCCCCTCT 3737 (TCA)8(TCA)8 228228 66 CGAGACGGGCTTCTTCGAATCGAGACGGGCTTCTTCGAAT 3838 2020 ACGAGTGCAAGAAATCCGGTACGAGTGCAAGAAATCCGGT 3939 (CT)12(CT)12 261261 44 AGTCAAAGAGAGCAGTGCCGAGTCAAAGAGAGCAGTGCCG 4040 2121 ATTCGCCGCTCTCACTCTTCATTCCGCCGCTCTCACTCTTC 4141 (TC)8(TC)8 130130 77 CGCCTCAGCTGTTGAACCTACGCCTCAGCTGTTGAACCTA 4242 2222 CTGCTCTACCGAGGAACACCCTGCTCTACCGAGGAACACC 4343 (GT)10(GT)10 201201 33 ACCGAACCAAACATGCCCTAACCGAACCAAACATGCCCTA 4444 2323 TGGACGGAGCCATAAAACGTTGGACGGAGCCATAAAACGT 4545 (CA)9(CA)9 209209 77 CTGTGCGTATGCTGAGACGACTGTGCGTATGCTGAGACGA 4646 2424 GCTGCAATGGCTGAACGAAAGCTGCAATGGCTGAACGAAA 4747 (CAG)7(CAG)7 199199 33 CAGCTTCCGACAAACGCATTCAGCTTCCGACAAACGCATT 4848 2525 AGCAATTCCCAACCAGCAGAAGCAATTCCAACCAGCAGA 4949 (CGTGTT)2(CGTGTT)2 297297 22 AGCGTTTAGGCTTTCCGTGAAGCGTTTAGGCTTTCCGTGA 5050 2626 CCCTATGTTTCCTGCTGCCACCCTATGTTTCCTGCTGCCA 5151 (CTCCAT)9(CTCCAT)9 222222 77 ACCTCTCGTGGTAACCTCCAACCTCTCGTGGTAACCTCCA 5252 2727 CTCAACTCCGGTGTCCAACACTCAACTCCGGTGTCCAACA 5353 (CT)11(CT)11 164164 44 CAGCGGACTTGGCAGAAAACCAGCGGACTTGGCAGAAAC 5454 2828 CAAACACACTATGCGACGCCCAAACACACTATGCGACGCC 5555 (CAT)7(CAT)7 123123 44 CCCAGCCATGTAGCTCGTACCCCAGCCATGTAGCTCGTAC 5656 2929 GCGTTTAGGCACAACAAGCAGCGTTTAGGCACAACAAGCA 5757 (GGGATC)2(GGGATC)2 221221 66 TCTGCACTGCATGGAAAGGATCTGCACTGCATGGAAAGGA 5858 3030 CCCCGGAACTGTCATTACCCCCCCGGAACTGTCATTACCC 5959 (CT)9(CT)9 266266 55 TCCTCCCCTGAATCAGTGGATCCTCCCCTGAATCAGTGGA 6060 3131 ATCTCTGGACTCTTCGCTGCATCTCTGGACTCTTCGCTGC 6161 (TGCCAT)2(TGCCAT)2 102102 22 TGTGCGAGATGTGTGGAACATGTGCGAGATGTGTGGAACA 6262 3232 ACGGCAAGAAGAGTCCGAAGACGGCAAGAAGAGTCCGAAG 6363 (GCCCAG)2(GCCCAG)2 223223 33 GGCGGTGCACCTCTTGAATAGGCGGTGCACCTCTTGAATA 6464 3333 ACTCGTCTGTCGCTTCGTTTACTCGTCTGTCGCTTCGTTT 6565 (CT)11(CT)11 281281 55 CTGGAGGCTCGAGCAATCTCCTGGAGGCTCGAGCAATCTC 6666 3434 ACAAACACAGCAACGGGGTAACAAACACAGCAACGGGGTA 6767 (CT)7(CT)7 173173 66 GAGAGGAATACGCGACTGGGGAGAGGAATACGCGACTGGG 6868 3535 ATCCCTCGAGTTGCTGCAAAATCCCTCGAGTTGCTGCAAA 6969 (CAGACA)3(CAGACA)3 225225 33 AAAGCTGCATCCTTCCACGAAAAGCTGCATCCTTCCACGA 7070 3636 TCTGTGCTCAAGGCCATGTTTCTGTGCTCAAGGCCATGTT 7171 (GAA)9(GAA)9 268268 33 AAGGTTTCCGGCATCGTCTTAAGGTTTCCGGCATCGTCTT 7272 3737 TCCTCCTCATCGTCATCTTCATCCTCCTCATCGTCATCTTCA 7373 (TTC)16(TTC)16 137137 66 GAGGCTAGAGGATTGACCGCGAGGCTAGAGGATTGACCGC 7474 3838 AGCGAGTACAGTGAAGACGACAGCGAGTACAGTGAAGACGAC 7575 (GAT)7(GAT)7 124124 33 CCGAACTCGAACCCTTGACACCGAACTCGAACCCTTGACA 7676 3939 TCTGGCTGCAGATTTCCACTTCTGGCTGCAGATTTCCACT 7777 (TCACTAC)3(TCACTAC)3 250250 44 AGTGGATCGGAGCTAGGGTTAGTGGATCGGAGCTAGGGTT 7878 4040 GATCTCTCCGCTTCTCCTGCGATCTCTCCGCTTCTCCTGC 7979 (TGTGTT)2(TGTGTT)2 220220 44 CACCCACTTGCCCACTCATACACCCACTTGCCCACTCATA 8080 4141 AACCCAGTACCTTTCAGGCCAACCCAGTACCTTTCAGGCC 8181 (TC)10(TC)10 133133 44 TTTGGCGATCATAAAGCGCGTTTGGCGATCATAAAGCGCG 8282 4242 AGCTGAGAGCCCTTAGAGCTAGCTGAGAGCCCTTAGAGCT 8383 (ATGCAG)2(ATGCAG)2 155155 44 ACCCTCTTGCAGTTGCTTGTACCCTCTTGCAGTTGCTTGT 8484 4343 GCAAAGCGGCTGCAGAAAAAGCAAAGCGGCTGCAGAAAAA 8585 (GAA)10(GAA)10 176176 33 TTGTTCGACATCGTCTGCCATTGTTCGACATCGTCTGCCA 8686 4444 ACAGTGTAAGGATTCAGGCGTACAGTGTAAGGATTCAGGCGT 8787 (TA)8(TA)8 128128 22 CGAAGTAGTGTCCCTTTATTTGGTCGAAGTAGTGTCCCTTTATTTGGT 8888 4545 TTCCGCCGCCTTTTTCTTTGTTCCGCCGCCTTTTTCTTTG 8989 (TG)8(TG)8 146146 44 AGTCCACACACTTCACTTCCAAGTCCACACACTTCACTTCCA 9090 4646 TTCGGTGGTGGACGAAGAAGTTCGGTGGTGGACGAAGAAG 9191 (AAG)7(AAG)7 227227 33 CATCCCTCTGCCACCACATTCATCCCTCTGCCACCACATT 9292 4747 CGGCTATGAGTCTGAGGAAGTCGGCTATGAGTCTGAGGAAGT 9393 (GAAGAG)3(GAAGAG)3 159159 88 TTGGCGCAAAGAATTGGCTCTTGGCGCAAAGAATTGGCTC 9494 4848 CCTCGCCACACCAAGTACAACCTCGCCACACCAAGTACAA 9595 (TCGATT)4(TCGATT)4 114114 99 TGCTGCTGCTGTTGTTGATGTGCTGCTGCTGTTGTTGATG 9696 4949 ATGCCACCATCATGGAAGCTATGCCACCATCATGGAAGCT 9797 (AAG)6(AAG)6 143143 77 GCATCTCTGCTTTCTTGCGGGCATCTCTGCTTTCTTGCGG 9898 5050 GCAAGTGCAAACCCGATTCCGCAAGTGCAAACCCGATTCC 9999 (CAG)6(CAG)6 247247 1111 CTTCCCTCCCAATTCCGTCACTTCCCTCCCAATTCCGTCA 100100 5151 TCCATGGTTCAGAATTCAGGGGTCCATGGTTCAGAATTCAGGGG 101101 (AG)7(AG)7 115115 44 TAATGTGCGCCACCGAGTTCTAATTGTGCGCCACCGAGTTC 102102 5252 TCTCATATGCAACGGCCTCCTCTCATATGCAACGGCCTCC 103103 (GGA)5(GGA)5 157157 33 CGGATCATCGGACCCTGTGGCGGATCATCGGACCCTGTGG 104104 5353 CAAGGTTTCAGCAGCAACCCCAAGGTTTCAGCAGCAACCC 105105 (AACTTCC)2(AACTTCC)2 263263 33 ACATTGGTGGCTGACAACCAACATTGGTGGCTGACAACCA 106106 5454 ATCCAGCAGCCGATTCCATTATCCAGCAGCCGATTCCATT 107107 (AAG)6(AAG)6 175175 22 ACTGGATCGGCTTCAAGCTCACTGGATCGGCTTCAAGCTC 108108 5555 TAAATGCATCAGCTCCCGCATAAATGCATCAGCTCCCGCA 109109 (AG)9(AG)9 195195 44 AGCTAGCGTCATGGCACTTTAGCTAGCGTCATGGCACTTT 110110 5656 ACATGAAATCCCTAATCGCTGCACATGAAATCCCTAATCGCTGC 111111 (CTAATCGGCG)2(CTAATCGGCG)2 103103 22 GAGAGGAGGCTGTGGTAGGAGAGAGGAGGCTGTGGTAGGA 112112 5757 TCTCCGATGATGAGACGAGAGTCTCCGATGATGAGACGAGAG 113113 (AG)9(AG)9 190190 44 AGCAGGCAAACCAAGATCCAAGCAGGCAAACCAAGATCCA 114114 5858 AGGAGTGTGGAAACGGTCTACAGGAGTGTGGAAACGGTCTAC 115115 (GCG)5(GCG)5 114114 33 TAATCGATTGCCCACCGCTTTAATCGATTGCCCACCGCTT 116116

*홀수 서열번호는 정방향 프라이머, 짝수 서열번호는 역방향 프라이머임.* Odd SEQ ID NOs are forward primers and even SEQ ID NOs are reverse primers.

(3) EST-SSR 분석(3) EST-SSR analysis

상기 58개 EST-SSR 프라이머 세트의 유용성에 대한 평가 및 96개의 유전자원간의 유전적 다양성을 분석하였다. The usefulness of the 58 EST-SSR primer sets and the genetic diversity among 96 genetic resources were analyzed.

구체적으로, 총 대립인자의 수, 주 대립인자의 빈도(Major allele frequency), 유전자의 다양성(Gene Diversity), 및 다형성 정보(Polymorphic Information Content, PIC)를 측정하기 위해 Powermarker version 3.25(Liu and Muse 2005)를 사용하였다. UPGMA tree 알고리즘은 MEGA7 software (Tamura et al., 2016)를 사용하였다. Specifically, Powermarker version 3.25 (Liu and Muse 2005) to measure the total number of alleles, Major allele frequency, Gene Diversity, and Polymorphic Information Content (PIC). ) was used. For the UPGMA tree algorithm, MEGA7 software (Tamura et al., 2016) was used.

상기 다형성 정보를 확인하기 위해, 하기 수학식 1을 사용하여 PIC(polymorphism information content)값을 산출하였다. In order to confirm the polymorphism information, a polymorphism information content (PIC) value was calculated using Equation 1 below.

[수학식 1][Equation 1]

Figure 112020020152354-pat00001
Figure 112020020152354-pat00001

(상기 수학식 1에서 Pi는 i번째 대립유전자의 빈도를 나타내고, n은 마커의 대립유전자의 전체 수를 나타냄, 품종 간 유전적인 유사성은 Powermarker version 3.25(Liu and Muse 2005) 프로그램을 사용하여 분석함.)(In Equation 1, P i represents the frequency of the i-th allele, n represents the total number of alleles of the marker, and the genetic similarity between varieties was analyzed using the Powermarker version 3.25 (Liu and Muse 2005) program. box.)

상기 96종의 들깨 및 차조기의 유전자원에 대해 58개의 EST-SSR를 분석한 결과, 총 270개의 대립유전자가 탐색되었는데 각각의 SSR에서 2~11개의 범위였고, 평균 대립유전자 수는 4.66개였다. 상기 프라이머 세트 별 유전적 다양성은 0.041에서 8.70의 범위로 나타났고, 평균 0.55 수준이었다. 이형접합 기대치 및 각 마커의 유용성을 나타내는 다형성 정보(polymorphism information content. PIC)의 값은 각각 0~1.00 및 0.041~0.86 (Primer 1과 Primer 91) 범위로 분석되었고, 평균은 각각 0.07 및 0.50 이였다. 상기와 같은 분석 결과를 표 3에 정리하였다. As a result of analyzing 58 EST-SSRs for the genetic resources of 96 species of perilla and perilla, a total of 270 alleles were found, ranging from 2 to 11 in each SSR, and the average number of alleles was 4.66. The genetic diversity for each primer set ranged from 0.041 to 8.70, with an average level of 0.55. The values of heterozygous expectation and polymorphism information content (PIC) indicating the usefulness of each marker were analyzed in the range of 0 to 1.00 and 0.041 to 0.86 (Primer 1 and Primer 91), respectively, and the mean was 0.07 and 0.50, respectively. Table 3 summarizes the analysis results as described above.

프라이머 세트Primer set 주 대립인자 빈도(Major Allele Frequency)Major Allele Frequency 표현형 수(Genotype No.)Number of phenotypes (Genotype No.) 관측 수(No. of obs.)No. of obs. 대립유전자 수(Allele No.)Allele No. 유용성(Availability)Availability 유전적 다양성(Gene Diversity)Gene Diversity 이형접합 기대치(Heterozygosity)Heterozygosity 다형성 정보(PIC)Polymorphic Information (PIC) 1One 0.97890.9789 4.00004.0000 95.000095.0000 44 0.98960.9896 0.04150.0415 0.04210.0421 0.04120.0412 22 0.84210.8421 3.00003.0000 95.000095.0000 33 0.98960.9896 0.26900.2690 0.00000.0000 0.23810.2381 33 0.77080.7708 4.00004.0000 96.000096.0000 44 1.00001.0000 0.38390.3839 0.00000.0000 0.35760.3576 44 0.41670.4167 7.00007.0000 96.000096.0000 77 1.00001.0000 0.66750.6675 0.00000.0000 0.60920.6092 55 0.72920.7292 5.00005.0000 96.000096.0000 55 1.00001.0000 0.43860.4386 0.00000.0000 0.40670.4067 66 0.78130.7813 3.00003.0000 96.000096.0000 33 1.00001.0000 0.36310.3631 0.00000.0000 0.33040.3304 77 0.29170.2917 9.00009.0000 96.000096.0000 99 1.00001.0000 0.82420.8242 0.00000.0000 0.80280.8028 88 0.32780.3278 9.00009.0000 90.000090.0000 66 0.93750.9375 0.76550.7655 0.10000.1000 0.72800.7280 99 0.44210.4421 9.00009.0000 95.000095.0000 99 0.98960.9896 0.72440.7244 0.00000.0000 0.69080.6908 1010 0.70830.7083 4.00004.0000 96.000096.0000 44 1.00001.0000 0.43490.4349 0.00000.0000 0.37120.3712 1111 0.35420.3542 6.00006.0000 96.000096.0000 66 1.00001.0000 0.76710.7671 0.00000.0000 0.73220.7322 1212 0.86980.8698 3.00003.0000 96.000096.0000 22 1.00001.0000 0.22650.2265 0.01040.0104 0.20090.209 1313 0.53130.5313 3.00003.0000 96.000096.0000 33 1.00001.0000 0.59220.5922 0.00000.0000 0.51690.5169 1414 0.61460.6146 5.00005.0000 96.000096.0000 55 1.00001.0000 0.56860.5686 0.00000.0000 0.52660.5266 1515 0.55730.5573 8.00008.0000 96.000096.0000 66 1.00001.0000 0.60150.6015 0.02080.0208 0.54510.5451 1616 0.67710.6771 3.00003.0000 96.000096.0000 33 1.00001.0000 0.45550.4555 0.00000.0000 0.37650.3765 1717 0.18750.1875 12.000012.0000 96.000096.0000 99 1.00001.0000 0.84700.8470 0.04170.0417 0.82780.8278 1818 0.32290.3229 5.00005.0000 96.000096.0000 55 1.00001.0000 0.77040.7704 0.00000.0000 0.73340.7334 1919 0.44150.4415 8.00008.0000 94.000094.0000 66 0.97920.9792 0.68080.6808 0.02130.0213 0.62620.6262 2020 0.72110.7211 4.00004.0000 95.000095.0000 44 0.98960.9896 0.43170.4317 0.01050.0105 0.38110.3811 2121 0.27960.2796 7.00007.0000 93.000093.0000 77 0.96880.9688 0.80590.8059 0.00000.0000 0.77850.7785 2222 0.48420.4842 3.00003.0000 95.000095.0000 33 0.98960.9896 0.63110.6311 0.00000.0000 0.55940.5594 2323 0.24210.2421 7.00007.0000 95.000095.0000 77 0.98960.9896 0.81990.8199 0.00000.0000 0.79490.7949 2424 0.54740.5474 3.00003.0000 95.000095.0000 33 0.98960.9896 0.52210.5221 0.00000.0000 0.41490.4149 2525 0.92710.9271 2.00002.0000 96.000096.0000 22 1.00001.0000 0.13520.1352 0.00000.0000 0.12610.1261 2626 0.42710.4271 7.00007.0000 96.000096.0000 77 1.00001.0000 0.70880.7088 0.00000.0000 0.66310.6631 2727 0.61050.6105 4.00004.0000 95.000095.0000 44 0.98960.9896 0.55340.5534 0.00000.0000 0.49580.4958 2828 0.57290.5729 4.00004.0000 96.000096.0000 44 1.00001.0000 0.50650.5065 0.04170.0417 0.39800.3980 2929 0.62500.6250 6.00006.0000 96.000096.0000 66 1.00001.0000 0.56790.5679 0.00000.0000 0.53470.5347 3030 0.47400.4740 6.00006.0000 96.000096.0000 55 1.00001.0000 0.68640.6864 0.01040.0104 0.64210.6421 3131 0.87500.8750 3.00003.0000 96.000096.0000 22 1.00001.0000 0.21880.2188 0.02080.0208 0.19480.1948 3232 0.46350.4635 2.00002.0000 96.000096.0000 33 1.00001.0000 0.56490.5649 0.92710.9271 0.46800.4680 3333 0.61460.6146 5.00005.0000 96.000096.0000 55 1.00001.0000 0.57050.5705 0.00000.0000 0.53040.5304 3434 0.45740.4574 6.00006.0000 94.000094.0000 66 0.97920.9792 0.72000.7200 0.00000.0000 0.68690.6869 3535 0.59380.5938 3.00003.0000 96.000096.0000 33 1.00001.0000 0.51930.5193 0.00000.0000 0.42830.4283 3636 0.39470.3947 4.00004.0000 95.000095.0000 33 0.98960.9896 0.65870.6587 0.01050.0105 0.58450.5845 3737 0.32630.3263 6.00006.0000 95.000095.0000 66 0.98960.9896 0.78070.7807 0.00000.0000 0.74750.7475 3838 0.85420.8542 3.00003.0000 96.000096.0000 33 1.00001.0000 0.25950.2595 0.00000.0000 0.24370.2437 3939 0.63540.6354 4.00004.0000 96.000096.0000 44 1.00001.0000 0.47790.4779 0.00000.0000 0.38220.3822 4040 0.44790.4479 4.00004.0000 96.000096.0000 44 1.00001.0000 0.69230.6923 0.00000.0000 0.64240.6424 4141 0.29170.2917 2.00002.0000 96.000096.0000 44 1.00001.0000 0.74310.7431 1.00001.0000 0.69530.6953 4242 0.54950.5495 4.00004.0000 91.000091.0000 44 0.94790.9479 0.59270.5927 0.00000.0000 0.52510.5251 4343 0.55210.5521 3.00003.0000 96.000096.0000 33 1.00001.0000 0.56100.5610 0.00000.0000 0.47700.4770 4444 0.70830.7083 2.00002.0000 96.000096.0000 22 1.00001.0000 0.41320.4132 0.00000.0000 0.32780.3278 4545 0.63540.6354 4.00004.0000 96.000096.0000 44 1.00001.0000 0.54640.5464 0.00000.0000 0.50490.5049 4646 0.63540.6354 4.00004.0000 96.000096.0000 33 1.00001.0000 0.46710.4671 0.02080.0208 0.36270.3627 4747 0.53130.5313 8.00008.0000 96.000096.0000 88 1.00001.0000 0.65190.6519 0.03130.0313 0.61250.6125 4848 0.39580.3958 9.00009.0000 96.000096.0000 99 1.00001.0000 0.77840.7784 0.00000.0000 0.75490.7549 4949 0.34380.3438 7.00007.0000 96.000096.0000 77 1.00001.0000 0.74020.7402 0.00000.0000 0.69580.6958 5050 0.23030.2303 18.000018.0000 89.000089.0000 1111 0.92710.9271 0.86970.8697 1.00001.0000 0.85680.8568 5151 0.65630.6563 5.00005.0000 96.000096.0000 44 1.00001.0000 0.48830.4883 0.02080.0208 0.41820.4182 5252 0.92710.9271 3.00003.0000 96.000096.0000 33 1.00001.0000 0.13650.1365 0.00000.0000 0.12960.1296 5353 0.88540.8854 3.00003.0000 96.000096.0000 33 1.00001.0000 0.20810.2081 0.00000.0000 0.19570.1957 5454 0.63540.6354 2.00002.0000 96.000096.0000 22 1.00001.0000 0.46330.4633 0.00000.0000 0.35600.3560 5555 0.55910.5591 4.00004.0000 93.000093.0000 44 0.96880.9688 0.61650.6165 0.00000.0000 0.56930.5693 5656 0.52600.5260 3.00003.0000 96.000096.0000 22 1.00001.0000 0.49860.4986 0.38540.3854 0.37430.3743 5757 0.47400.4740 5.00005.0000 96.000096.0000 44 1.00001.0000 0.63750.6375 0.03130.0313 0.57090.5709 5858 0.79170.7917 3.00003.0000 96.000096.0000 33 1.00001.0000 0.34090.3409 0.00000.0000 0.30030.3003 평균Average 0.56460.5646 5.03455.0345 95.344895.3448 55 0.99320.9932 0.55180.5518 0.06460.0646 0.50150.5015

(4) 증폭 유무 및 크기 분석(4) Amplification presence and absence and size analysis

상기 표 1의 각 품종에서 본 발명의 58개의 프라이머 세트를 이용한 PCR 증폭 반응에서 증폭 유무 및 크기를 다음과 같이 표 4a 내지 4o에 정리하였다:The presence or absence and size of amplification in the PCR amplification reaction using the 58 primer sets of the present invention in each variety in Table 1 are summarized in Tables 4a to 4o as follows:

Figure 112020020152354-pat00002
Figure 112020020152354-pat00002

Figure 112020020152354-pat00003
Figure 112020020152354-pat00003

Figure 112020020152354-pat00004
Figure 112020020152354-pat00004

Figure 112020020152354-pat00005
Figure 112020020152354-pat00005

Figure 112020020152354-pat00006
Figure 112020020152354-pat00006

Figure 112020020152354-pat00007
Figure 112020020152354-pat00007

Figure 112020020152354-pat00008
Figure 112020020152354-pat00008

Figure 112020020152354-pat00009
Figure 112020020152354-pat00009

Figure 112020020152354-pat00010
Figure 112020020152354-pat00010

Figure 112020020152354-pat00011
Figure 112020020152354-pat00011

Figure 112020020152354-pat00012
Figure 112020020152354-pat00012

Figure 112020020152354-pat00013
Figure 112020020152354-pat00013

Figure 112020020152354-pat00014
Figure 112020020152354-pat00014

Figure 112020020152354-pat00015
Figure 112020020152354-pat00015

Figure 112020020152354-pat00016
Figure 112020020152354-pat00016

나아가, 상기 표 4a 내지 표 4o에서 정리한 58개의 EST-SSR 프라이머를 이용하여 96개의 유전자원 간의 유전적 유사도를 확인한 결과를 도 1에 나타내었다.Furthermore, the results of confirming the genetic similarity between 96 genetic resources using the 58 EST-SSR primers summarized in Tables 4a to 4o are shown in FIG. 1 .

따라서, 본 발명의 58개의 EST-SSR 프라이머 세트에 의해 96종의 들깨 및 차조기를 판별할 수 있음을 확인할 수 있었으며, 상기와 같은 58개의 프라이머 세트를 이용하여 미지의 들깨 및 차조기가 상기 96종의 들깨 및 차조기에 해당하는 지 역시 판별할 수 있다. Therefore, it was confirmed that 96 kinds of perilla and perilla perilla can be discriminated by the 58 EST-SSR primer sets of the present invention. It can also be determined whether it corresponds to perilla and perilla.

이상에서 본 발명의 실시예에 대하여 상세하게 설명하였지만 본 발명의 권리범위는 이에 한정되는 것은 아니고, 청구범위에 기재된 본 발명의 기술적 사상을 벗어나지 않는 범위 내에서 다양한 수정 및 변형이 가능하다는 것은 당 기술분야의 통상의 지식을 가진 자에게는 자명할 것이다.Although the embodiments of the present invention have been described in detail above, the scope of the present invention is not limited thereto, and various modifications and variations are possible within the scope without departing from the technical spirit of the present invention described in the claims. It will be apparent to those of ordinary skill in the art.

<110> Korea Atomic Energy Research Institute <120> EST-SSR primer set for identifying Perilla frutescens cultivar, kit for identifying Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same <130> DPP-2019-2123-KR <160> 116 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 1 Forward <400> 1 gcaacccgcc atttctgatg 20 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer set 2 Reverse <400> 2 tggtgatgaa tgatgatgat gccg 24 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 2 Forward <400> 3 gcagcattct tcgaccgttg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 2 Reverse <400> 4 aggatcctcc cacggatagg 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 3 Forward <400> 5 ggaaatcagg tggaaatggc a 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 3 Reverse <400> 6 tattcgtgtg tgcagacagc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 4 Forward <400> 7 catagaagca tgcacggcac 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 4 Reverse <400> 8 atggtgaagg gggatcgaga 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 5 Forward <400> 9 catgtttctg ctcttgcacg t 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 5 Reverse <400> 10 cgtgctactg gaaaggtggt 20 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 6 Forward <400> 11 tcagacacca cccataacag c 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 6 Reverse <400> 12 tcggagaaca tgaagcagca 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 7 Forward <400> 13 catagctgct ccaccggtac 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 7 Reverse <400> 14 tttctgcaat tttcgggccg 20 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer set 8 Forward <400> 15 agcgaaccct actttaaaac atca 24 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 8 Reverse <400> 16 ctgccgatga gacttctccc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 9 Forward <400> 17 aattgcggtg ttggtgaagc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 9 Reverse <400> 18 tcgggattgt ctactgctgc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 10 Forward <400> 19 cacgcttcct acaccctctc 20 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 10 Reverse <400> 20 ggatgactga ttcgcttcag c 21 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 11 Forward <400> 21 tatgcacatc cgctcccaaa 20 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer set 11 Reverse <400> 22 tcccaaacac ttttcaaacc aca 23 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 12 Forward <400> 23 tcgccgcaca cacatataca 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 12 Reverse <400> 24 tcctcgaaca cgcacttcaa 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 13 Forward <400> 25 aggcaggcaa tcaagtcaca 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 13 Reverse <400> 26 cgccatttcc tccgtccata 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 14 Forward <400> 27 tctccccaaa tccactccct 20 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 14 Reverse <400> 28 acggaatacc cagttcagct g 21 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 15 Forward <400> 29 ggcagcccga ctttttgaag 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 15 Reverse <400> 30 ttcgctgcct tcttagctcc 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 16 Forward <400> 31 catccatgag ttgggctggt 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 16 Reverse <400> 32 tgcgtacttg tgagtcccaa 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 17 Forward <400> 33 ccaccaccct tttctcccaa 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 17 Reverse <400> 34 cggcatgatc tcgagtcgaa 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 18 Forward <400> 35 ttcaaccaca ccaccttgct 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 18 Reverse <400> 36 tcgcacgtct cgtttgtgta 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 19 Forward <400> 37 atacccaagg tacgccctct 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 19 Reverse <400> 38 cgagacgggc ttcttcgaat 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 20 Forward <400> 39 acgagtgcaa gaaatccggt 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 20 Reverse <400> 40 agtcaaagag agcagtgccg 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 21 Forward <400> 41 attcgccgct ctcactcttc 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 21 Reverse <400> 42 cgcctcagct gttgaaccta 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 22 Forward <400> 43 ctgctctacc gaggaacacc 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 22 Reverse <400> 44 accgaaccaa acatgcccta 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 23 Forward <400> 45 tggacggagc cataaaacgt 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 23 Reverse <400> 46 ctgtgcgtat gctgagacga 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 24 Forward <400> 47 gctgcaatgg ctgaacgaaa 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 24 Reverse <400> 48 cagcttccga caaacgcatt 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 25 Forward <400> 49 agcaattccc aaccagcaga 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 25 Reverse <400> 50 agcgtttagg ctttccgtga 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 26 Forward <400> 51 ccctatgttt cctgctgcca 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 26 Reverse <400> 52 acctctcgtg gtaacctcca 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 27 Forward <400> 53 ctcaactccg gtgtccaaca 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 27 Reverse <400> 54 cagcggactt ggcagaaaac 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 28 Forward <400> 55 caaacacact atgcgacgcc 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 28 Reverse <400> 56 cccagccatg tagctcgtac 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 29 Forward <400> 57 gcgtttaggc acaacaagca 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 29 Reverse <400> 58 tctgcactgc atggaaagga 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 30 Forward <400> 59 ccccggaact gtcattaccc 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 30 Reverse <400> 60 tcctcccctg aatcagtgga 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 31 Forward <400> 61 atctctggac tcttcgctgc 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 31 Reverse <400> 62 tgtgcgagat gtgtggaaca 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 32 Forward <400> 63 acggcaagaa gagtccgaag 20 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 32 Reverse <400> 64 ggcggtgcac ctcttgaata 20 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 33 Forward <400> 65 actcgtctgt cgcttcgttt 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 33 Reverse <400> 66 ctggaggctc gagcaatctc 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 34 Forward <400> 67 acaaacacag caacggggta 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 34 Reverse <400> 68 gagaggaata cgcgactggg 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 35 Forward <400> 69 atccctcgag ttgctgcaaa 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 35 Reverse <400> 70 aaagctgcat ccttccacga 20 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 36 Forward <400> 71 tctgtgctca aggccatgtt 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 36 Reverse <400> 72 aaggtttccg gcatcgtctt 20 <210> 73 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 37 Forward <400> 73 tcctcctcat cgtcatcttc a 21 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 37 Reverse <400> 74 gaggctagag gattgaccgc 20 <210> 75 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 38 Forward <400> 75 agcgagtaca gtgaagacga c 21 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 38 Reverse <400> 76 ccgaactcga acccttgaca 20 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 39 Forward <400> 77 tctggctgca gatttccact 20 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 39 Reverse <400> 78 agtggatcgg agctagggtt 20 <210> 79 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 40 Forward <400> 79 gatctctccg cttctcctgc 20 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 40 Reverse <400> 80 cacccacttg cccactcata 20 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 41 Forward <400> 81 aacccagtac ctttcaggcc 20 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 41 Reverse <400> 82 tttggcgatc ataaagcgcg 20 <210> 83 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 42 Forward <400> 83 agctgagagc ccttagagct 20 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 42 Reverse <400> 84 accctcttgc agttgcttgt 20 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 43 Forward <400> 85 gcaaagcggc tgcagaaaaa 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 43 Reverse <400> 86 ttgttcgaca tcgtctgcca 20 <210> 87 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 44 Forward <400> 87 acagtgtaag gattcaggcg t 21 <210> 88 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer set 44 Reverse <400> 88 cgaagtagtg tccctttatt tggt 24 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 45 Forward <400> 89 ttccgccgcc tttttctttg 20 <210> 90 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 45 Reverse <400> 90 agtccacaca cttcacttcc a 21 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 46 Forward <400> 91 ttcggtggtg gacgaagaag 20 <210> 92 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 46 Reverse <400> 92 catccctctg ccaccacatt 20 <210> 93 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 47 Forward <400> 93 cggctatgag tctgaggaag t 21 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 47 Reverse <400> 94 ttggcgcaaa gaattggctc 20 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 48 Forward <400> 95 cctcgccaca ccaagtacaa 20 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 48 Reverse <400> 96 tgctgctgct gttgttgatg 20 <210> 97 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 49 Forward <400> 97 atgccaccat catggaagct 20 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 49 Reverse <400> 98 gcatctctgc tttcttgcgg 20 <210> 99 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 50 Forward <400> 99 gcaagtgcaa acccgattcc 20 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 50 Reverse <400> 100 cttccctccc aattccgtca 20 <210> 101 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer set 51 Forward <400> 101 tccatggttc agaattcagg gg 22 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 51 Reverse <400> 102 taatgtgcgc caccgagttc 20 <210> 103 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 52 Forward <400> 103 tctcatatgc aacggcctcc 20 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 52 Reverse <400> 104 cggatcatcg gaccctgtgg 20 <210> 105 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 53 Forward <400> 105 caaggtttca gcagcaaccc 20 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 53 Reverse <400> 106 acattggtgg ctgacaacca 20 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 54 Forward <400> 107 atccagcagc cgattccatt 20 <210> 108 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 54 Reverse <400> 108 actggatcgg cttcaagctc 20 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 55 Forward <400> 109 taaatgcatc agctcccgca 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 55 Reverse <400> 110 agctagcgtc atggcacttt 20 <210> 111 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer set 56 Forward <400> 111 acatgaaatc cctaatcgct gc 22 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 56 Reverse <400> 112 gagaggaggc tgtggtagga 20 <210> 113 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 57 Forward <400> 113 tctccgatga tgagacgaga g 21 <210> 114 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 57 Reverse <400> 114 agcaggcaaa ccaagatcca 20 <210> 115 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 58 Forward <400> 115 aggagtgtgg aaacggtcta c 21 <210> 116 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 58 Reverse <400> 116 taatcgattg cccaccgctt 20 <110> Korea Atomic Energy Research Institute <120> EST-SSR primer set for identifying Perilla frutescens cultivar, kit for identifying Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same <130> DPP-2019-2123-KR <160> 116 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 1 Forward <400> 1 gcaacccgcc atttctgatg 20 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer set 2 Reverse <400> 2 tggtgatgaa tgatgatgat gccg 24 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 2 Forward <400> 3 gcagcattct tcgaccgttg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 2 Reverse <400> 4 aggatcctcc cacggatagg 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 3 Forward <400> 5 ggaaatcagg tggaaatggc a 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 3 Reverse <400> 6 tattcgtgtg tgcagacagc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 4 Forward <400> 7 catagaagca tgcacggcac 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 4 Reverse <400> 8 atggtgaagg gggatcgaga 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 5 Forward <400> 9 catgtttctg ctcttgcacg t 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 5 Reverse <400> 10 cgtgctactg gaaaggtggt 20 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 6 Forward <400> 11 tcagacacca cccataacag c 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 6 Reverse <400> 12 tcggagaaca tgaagcagca 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 7 Forward <400> 13 catagctgct ccaccggtac 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 7 Reverse <400> 14 tttctgcaat tttcgggccg 20 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer set 8 Forward <400> 15 agcgaaccct actttaaaac atca 24 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 8 Reverse <400> 16 ctgccgatga gacttctccc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 9 Forward <400> 17 aattgcggtg ttggtgaagc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 9 Reverse <400> 18 tcgggattgt ctactgctgc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 10 Forward <400> 19 cacgcttcct acaccctctc 20 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 10 Reverse <400> 20 ggatgactga ttcgcttcag c 21 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 11 Forward <400> 21 tatgcacatc cgctcccaaa 20 <210> 22 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer set 11 Reverse <400> 22 tcccaaacac ttttcaaacc aca 23 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 12 Forward <400> 23 tcgccgcaca cacatataca 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 12 Reverse <400> 24 tcctcgaaca cgcacttcaa 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 13 Forward <400> 25 aggcaggcaa tcaagtcaca 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 13 Reverse <400> 26 cgccatttcc tccgtccata 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 14 Forward <400> 27 tctccccaaa tccactccct 20 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 14 Reverse <400> 28 acggaatacc cagttcagct g 21 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 15 Forward <400> 29 ggcagcccga ctttttgaag 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 15 Reverse <400> 30 ttcgctgcct tcttagctcc 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 16 Forward <400> 31 catccatgag ttgggctggt 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 16 Reverse <400> 32 tgcgtacttg tgagtcccaa 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 17 Forward <400> 33 ccaccaccct tttctcccaa 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 17 Reverse <400> 34 cggcatgatc tcgagtcgaa 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 18 Forward <400> 35 ttcaaccaca ccaccttgct 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 18 Reverse <400> 36 tcgcacgtct cgtttgtgta 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 19 Forward <400> 37 atacccaagg tacgccctct 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 19 Reverse <400> 38 cgagacgggc ttcttcgaat 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 20 Forward <400> 39 acgagtgcaa gaaatccggt 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 20 Reverse <400> 40 agtcaaagag agcagtgccg 20 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 21 Forward <400> 41 attcgccgct ctcactcttc 20 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 21 Reverse <400> 42 cgcctcagct gttgaaccta 20 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 22 Forward <400> 43 ctgctctacc gaggaacacc 20 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 22 Reverse <400> 44 accgaaccaa accagcccta 20 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 23 Forward <400> 45 tggacggagc cataaaacgt 20 <210> 46 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 23 Reverse <400> 46 ctgtgcgtat gctgagacga 20 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 24 Forward <400> 47 gctgcaatgg ctgaacgaaa 20 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 24 Reverse <400> 48 cagcttccga caaacgcatt 20 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 25 Forward <400> 49 agcaattccc aaccagcaga 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 25 Reverse <400> 50 agcgtttagg ctttccgtga 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 26 Forward <400> 51 ccctatgttt cctgctgcca 20 <210> 52 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 26 Reverse <400> 52 acctctcgtg gtaacctcca 20 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 27 Forward <400> 53 ctcaactccg gtgtccaaca 20 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 27 Reverse <400> 54 cagcggactt ggcagaaaac 20 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 28 Forward <400> 55 caaacacact atgcgacgcc 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 28 Reverse <400> 56 cccagccatg tagctcgtac 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 29 Forward <400> 57 gcgtttaggc acaacaagca 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 29 Reverse <400> 58 tctgcactgc atggaaagga 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 30 Forward <400> 59 ccccggaact gtcattaccc 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 30 Reverse <400> 60 tcctcccctg aatcagtgga 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 31 Forward <400> 61 atctctggac tcttcgctgc 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 31 Reverse <400> 62 tgtgcgagat gtgtggaaca 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 32 Forward <400> 63 acggcaagaa gagtccgaag 20 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 32 Reverse <400> 64 ggcggtgcac ctcttgaata 20 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 33 Forward <400> 65 actcgtctgt cgcttcgttt 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 33 Reverse <400> 66 ctggaggctc gagcaatctc 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 34 Forward <400> 67 acaaacacag caacggggta 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 34 Reverse <400> 68 gagaggaata cgcgactggg 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 35 Forward <400> 69 atccctcgag ttgctgcaaa 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 35 Reverse <400> 70 aaagctgcat ccttccacga 20 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 36 Forward <400> 71 tctgtgctca aggccatgtt 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 36 Reverse <400> 72 aaggtttccg gcatcgtctt 20 <210> 73 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 37 Forward <400> 73 tcctcctcat cgtcatcttc a 21 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 37 Reverse <400> 74 gaggctagag gattgaccgc 20 <210> 75 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 38 Forward <400> 75 agcgagtaca gtgaagacga c 21 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 38 Reverse <400> 76 ccgaactcga acccttgaca 20 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 39 Forward <400> 77 tctggctgca gatttccact 20 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 39 Reverse <400> 78 agtggatcgg agctagggtt 20 <210> 79 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 40 Forward <400> 79 gatctctccg cttctcctgc 20 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 40 Reverse <400> 80 cacccacttg cccactcata 20 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 41 Forward <400> 81 aacccagtac ctttcaggcc 20 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 41 Reverse <400> 82 tttggcgatc ataaagcgcg 20 <210> 83 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 42 Forward <400> 83 agctgagagc ccttagagct 20 <210> 84 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 42 Reverse <400> 84 accctcttgc agttgcttgt 20 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 43 Forward <400> 85 gcaaagcggc tgcagaaaaa 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 43 Reverse <400> 86 ttgttcgaca tcgtctgcca 20 <210> 87 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 44 Forward <400> 87 acagtgtaag gattcaggcg t 21 <210> 88 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer set 44 Reverse <400> 88 cgaagtagtg tccctttatt tggt 24 <210> 89 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 45 Forward <400> 89 ttccgccgcc tttttctttg 20 <210> 90 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 45 Reverse <400> 90 agtccacaca cttcacttcc a 21 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 46 Forward <400> 91 ttcggtggtg gacgaagaag 20 <210> 92 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 46 Reverse <400> 92 catccctctg ccaccacatt 20 <210> 93 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 47 Forward <400> 93 cggctatgag tctgaggaag t 21 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 47 Reverse <400> 94 ttggcgcaaa gaattggctc 20 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 48 Forward <400> 95 cctcgccaca ccaagtacaa 20 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 48 Reverse <400> 96 tgctgctgct gttgttgatg 20 <210> 97 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 49 Forward <400> 97 atgccaccat catggaagct 20 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 49 Reverse <400> 98 gcatctctgc tttcttgcgg 20 <210> 99 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 50 Forward <400> 99 gcaagtgcaa acccgattcc 20 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 50 Reverse <400> 100 cttccctccc aattccgtca 20 <210> 101 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer set 51 Forward <400> 101 tccatggttc agaattcagg gg 22 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 51 Reverse <400> 102 taatgtgcgc caccgagttc 20 <210> 103 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 52 Forward <400> 103 tctcatatgc aacggcctcc 20 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 52 Reverse <400> 104 cggatcatcg gaccctgtgg 20 <210> 105 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 53 Forward <400> 105 caaggtttca gcagcaaccc 20 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 53 Reverse <400> 106 accattggtgg ctgacaacca 20 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 54 Forward <400> 107 atccagcagc cgattccatt 20 <210> 108 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 54 Reverse <400> 108 actggatcgg cttcaagctc 20 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 55 Forward <400> 109 taaatgcatc agctcccgca 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 55 Reverse <400> 110 agctagcgtc atggcacttt 20 <210> 111 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer set 56 Forward <400> 111 acatgaaatc cctaatcgct gc 22 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 56 Reverse <400> 112 gagaggaggc tgtggtagga 20 <210> 113 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 57 Forward <400> 113 tctccgatga tgagacgaga g 21 <210> 114 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 57 Reverse <400> 114 agcaggcaaa ccaagatcca 20 <210> 115 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Primer set 58 Forward <400> 115 aggagtgtgg aaacggtcta c 21 <210> 116 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer set 58 Reverse <400> 116 taatcgattg cccaccgctt 20

Claims (5)

서열번호 1 및 2로 표시되는 프라이머 세트 1; 서열번호 3 및 4로 표시되는 프라이머 세트 2; 서열번호 5 및 6으로 표시되는 프라이머 세트 3; 서열번호 7 및 8로 표시되는 프라이머 세트 4; 서열번호 9 및 10으로 표시되는 프라이머 세트 5; 서열번호 11 및 12로 표시되는 프라이머 세트 6; 서열번호 13 및 14로 표시되는 프라이머 세트 7; 서열번호 15 및 16으로 표시되는 프라이머 세트 8; 서열번호 17 및 18로 표시되는 프라이머 세트 9; 서열번호 19 및 20으로 표시되는 프라이머 세트 10; 서열번호 21 및 22로 표시되는 프라이머 세트 11; 서열번호 23 및 24로 표시되는 프라이머 세트 12; 서열번호 25 및 26으로 표시되는 프라이머 세트 13; 서열번호 27 및 28로 표시되는 프라이머 세트 14; 서열번호 29 및 30으로 표시되는 프라이머 세트 15; 서열번호 31 및 32로 표시되는 프라이머 세트 16; 서열번호 33 및 34로 표시되는 프라이머 세트 17; 서열번호 35 및 36으로 표시되는 프라이머 세트 18; 서열번호 37 및 38로 표시되는 프라이머 세트 19; 서열번호 39 및 40으로 표시되는 프라이머 세트 20; 서열번호 41 및 42로 표시되는 프라이머 세트 21; 서열번호 43 및 44로 표시되는 프라이머 세트 22; 서열번호 45 및 46으로 표시되는 프라이머 세트 23; 서열번호 47 및 48로 표시되는 프라이머 세트 24; 서열번호 49 및 50으로 표시되는 프라이머 세트 25; 서열번호 51 및 52로 표시되는 프라이머 세트 26; 서열번호 53 및 54로 표시되는 프라이머 세트 27; 서열번호 55 및 56으로 표시되는 프라이머 세트 28; 서열번호 57 및 58로 표시되는 프라이머 세트 29; 서열번호 59 및 60으로 표시되는 프라이머 세트 30; 서열번호 61 및 62로 표시되는 프라이머 세트 31; 서열번호 63 및 64로 표시되는 프라이머 세트 32; 서열번호 65 및 66으로 표시되는 프라이머 세트 33; 서열번호 67 및 68로 표시되는 프라이머 세트 34; 서열번호 69 및 70으로 표시되는 프라이머 세트 35; 서열번호 71 및 72로 표시되는 프라이머 세트 36; 서열번호 73 및 74로 표시되는 프라이머 세트 37; 서열번호 75 및 76으로 표시되는 프라이머 세트 38; 서열번호 77 및 78로 표시되는 프라이머 세트 39; 서열번호 79 및 80으로 표시되는 프라이머 세트 40; 서열번호 81 및 82로 표시되는 프라이머 세트 41; 서열번호 83 및 84로 표시되는 프라이머 세트 42; 서열번호 85 및 86으로 표시되는 프라이머 세트 43; 서열번호 87 및 88로 표시되는 프라이머 세트 44; 서열번호 89 및 90으로 표시되는 프라이머 세트 45; 서열번호 91 및 92로 표시되는 프라이머 세트 46; 서열번호 93 및 94로 표시되는 프라이머 세트 47; 서열번호 95 및 96으로 표시되는 프라이머 세트 48; 서열번호 97 및 98로 표시되는 프라이머 세트 49; 서열번호 99 및 100으로 표시되는 프라이머 세트 50; 서열번호 101 및 102로 표시되는 프라이머 세트 51; 서열번호 103 및 104로 표시되는 프라이머 세트 52; 서열번호 105 및 106으로 표시되는 프라이머 세트 53; 서열번호 107 및 108로 표시되는 프라이머 세트 54; 서열번호 109 및 110으로 표시되는 프라이머 세트 55; 서열번호 111 및 112로 표시되는 프라이머 세트 56; 서열번호 113 및 114로 표시되는 프라이머 세트 57; 및 서열번호 115 및 116으로 표시되는 프라이머 세트 58을 포함하는, 들깨 및 차조기 품종 판별용 EST-SSR(expressed sequence tags-simple sequence repeat) 프라이머 세트 조성물.
Primer set 1 represented by SEQ ID NOs: 1 and 2; primer set 2 represented by SEQ ID NOs: 3 and 4; primer set 3 represented by SEQ ID NOs: 5 and 6; primer set 4 represented by SEQ ID NOs: 7 and 8; primer set 5 represented by SEQ ID NOs: 9 and 10; Primer set 6 represented by SEQ ID NOs: 11 and 12; Primer set 7 represented by SEQ ID NOs: 13 and 14; primer set 8 represented by SEQ ID NOs: 15 and 16; primer set 9 represented by SEQ ID NOs: 17 and 18; Primer set 10 represented by SEQ ID NOs: 19 and 20; Primer set 11 represented by SEQ ID NOs: 21 and 22; Primer set 12 represented by SEQ ID NOs: 23 and 24; primer set 13 represented by SEQ ID NOs: 25 and 26; Primer set 14 represented by SEQ ID NOs: 27 and 28; Primer set 15 represented by SEQ ID NOs: 29 and 30; primer set 16 represented by SEQ ID NOs: 31 and 32; Primer set 17 represented by SEQ ID NOs: 33 and 34; Primer set 18 represented by SEQ ID NOs: 35 and 36; Primer set 19 represented by SEQ ID NOs: 37 and 38; Primer set 20 represented by SEQ ID NOs: 39 and 40; primer set 21 represented by SEQ ID NOs: 41 and 42; Primer set 22 represented by SEQ ID NOs: 43 and 44; Primer set 23 represented by SEQ ID NOs: 45 and 46; Primer set 24 represented by SEQ ID NOs: 47 and 48; Primer set 25 represented by SEQ ID NOs: 49 and 50; primer set 26 represented by SEQ ID NOs: 51 and 52; Primer set 27 represented by SEQ ID NOs: 53 and 54; Primer set 28 represented by SEQ ID NOs: 55 and 56; Primer set 29 represented by SEQ ID NOs: 57 and 58; Primer set 30 represented by SEQ ID NOs: 59 and 60; Primer set 31 represented by SEQ ID NOs: 61 and 62; Primer set 32 represented by SEQ ID NOs: 63 and 64; Primer set 33 represented by SEQ ID NOs: 65 and 66; Primer set 34 represented by SEQ ID NOs: 67 and 68; Primer set 35 represented by SEQ ID NOs: 69 and 70; Primer set 36 represented by SEQ ID NOs: 71 and 72; Primer set 37 represented by SEQ ID NOs: 73 and 74; primer set 38 represented by SEQ ID NOs: 75 and 76; Primer set 39 represented by SEQ ID NOs: 77 and 78; primer set 40 represented by SEQ ID NOs: 79 and 80; primer set 41 represented by SEQ ID NOs: 81 and 82; primer set 42 represented by SEQ ID NOs: 83 and 84; primer set 43 represented by SEQ ID NOs: 85 and 86; Primer set 44 represented by SEQ ID NOs: 87 and 88; Primer set 45 represented by SEQ ID NOs: 89 and 90; Primer set 46 represented by SEQ ID NOs: 91 and 92; Primer set 47 represented by SEQ ID NOs: 93 and 94; Primer set 48 represented by SEQ ID NOs: 95 and 96; Primer set 49 represented by SEQ ID NOs: 97 and 98; Primer set 50 represented by SEQ ID NOs: 99 and 100; Primer set 51 represented by SEQ ID NOs: 101 and 102; Primer set 52 represented by SEQ ID NOs: 103 and 104; Primer set 53 represented by SEQ ID NOs: 105 and 106; Primer set 54 represented by SEQ ID NOs: 107 and 108; Primer set 55 represented by SEQ ID NOs: 109 and 110; Primer set 56 represented by SEQ ID NOs: 111 and 112; Primer set 57 represented by SEQ ID NOs: 113 and 114; And comprising a primer set 58 represented by SEQ ID NOs: 115 and 116, EST-SSR (expressed sequence tags-simple sequence repeat) primer set composition for identifying perilla and perilla varieties.
 제1항에 있어서,
상기 들깨 또는 차조기 품종은 안티스페릴(Antisperill), 차조기 야생종(Wild type), IT 220380, IT 226692, IT 229043, IT 242083, IT 242256, IT 267741, IT 271306, IT 271317, IT 283645, IT 286213, IT 286246, IT 296762, IT 305302, IT 308494, IT 226670, IT 271310, IT 271311, IT 271319, IT 283597, IT 293400, IT 293402, IT 293403, IT 201764, IT 201765, IT 201771, IT 201773, IT 201780, IT 226471, IT 226486, IT 226573, IT 226664, IT 226671, IT 226672, IT 236930, IT 240108, IT 274215, IT 305543, IT 226663, IT 274210, IT 196391, IT 220659, IT 223670, IT 240105, IT 240106, IT 240107, IT 242623, IT 246853, IT 271259, IT 273794, IT 273827, IT 276486, IT 277881, IT 286191, IT 298992, PF08126, PF08145, IT 229026, PF09159, IT 302031, IT 213786, IT 226451, IT 220387, IT 220393, IT 220395, IT 220397, IT 226732, IT 226733, IT 226737, IT 226742, IT 226743, IT 226744, IT 260616, IT 271262, IT 274283, IT 274284, IT 274285, IT 274286, IT 274288, IT 274290, IT 274301, IT 274295, IT 200354, IT 226466, IT 274208, IT 226627, PF98075, PF11107, IT 162886, IT 175835, IT 175889, IT 177137, IT 180973, IT 185622 및 IT 185625로 이루어진 그룹으로부터 선택되는 것이며,
여기서, IT 번호는 농촌진흥청 농업유전자원센터 보유 유전자원이며, PF 번호는 강원대학교 보유 유전자원인, 들깨 및 차조기 품종 판별용 EST-SSR 프라이머 세트 조성물.
According to claim 1,
The perilla or perilla varieties are antisperill (Antisperill), perilla wild type (Wild type), IT 220380, IT 226692, IT 229043, IT 242083, IT 242256, IT 267741, IT 271306, IT 271317, IT 283645, IT 286213, IT 286246, IT 296762, IT 305302, IT 308494, IT 226670, IT 271310, IT 271311, IT 271319, IT 283597, IT 293400, IT 293402, IT 293403, IT 201764, IT 201765, IT 201771, IT 201773, IT 201780 , IT 226471, IT 226486, IT 226573, IT 226664, IT 226671, IT 226672, IT 236930, IT 240108, IT 274215, IT 305543, IT 226663, IT 274210, IT 196391, IT 220659, IT 223670, IT 240105, IT 240106, IT 240107, IT 242623, IT 246853, IT 271259, IT 273794, IT 273827, IT 276486, IT 277881, IT 286191, IT 298992, PF08126, PF08145, IT 229026, PF09159, IT 302031, IT 213786, IT 226451, IT 220387, IT 220393, IT 220395, IT 220397, IT 226732, IT 226733, IT 226737, IT 226742, IT 226743, IT 226744, IT 260616, IT 271262, IT 274283, IT 274284, IT 274285, IT 274286, IT 274288 , IT 274290, IT 274301, IT 274295, IT 200354, IT 226466, IT 274208, IT 226627, PF98075, PF111 07, IT 162886, IT 175835, IT 175889, IT 177137, IT 180973, IT 185622 and IT 185625,
Here, the IT number is the genetic resource owned by the Agricultural Genetic Resource Center of the Rural Development Administration, and the PF number is the genetic resource owned by Kangwon National University, the EST-SSR primer set composition for discrimination of perilla and perilla varieties.
 제1항 또는 제2항에 따른 들깨 및 차조기 품종 판별용 EST-SSR 프라이머 세트 조성물을 포함하는 들깨 및 차조기 품종 판별용 키트.
A kit for discrimination of perilla and perilla varieties comprising the EST-SSR primer set composition for discrimination of perilla and perilla according to claim 1 or 2.
 판별 대상인 들깨 및 차조기 품종의 게놈 DNA를 주형으로 하고, 제1항 또는 제2항의 프라이머 세트 조성물을 이용하여 PCR 증폭시키는 단계;
PCR 증폭산물의 증폭 유무 및 크기를 분석하는 단계; 및
상기 PCR 증폭산물의 증폭 유무 및 크기와 상기 프라이머 세트 조성물에 의한 들깨 및 차조기 품종 별 기준 증폭 유무 및 크기와의 상동성 동정을 통해 들깨 및 차조기 품종을 판별하는 단계를 포함하는, 들깨 및 차조기 품종의 유전자원 판별 방법.
Using the genomic DNA of perilla and perilla varieties to be discriminated as a template, and PCR amplifying using the primer set composition of claim 1 or 2;
analyzing the presence or absence and size of the PCR amplification product; and
Perilla and perilla varieties comprising the step of determining the presence or absence and size of the PCR amplification product and the homology identification of the presence and absence and size of standard amplification of perilla and perilla perilla by the primer set composition Methods for determining genetic resources.
 제4항에 있어서,
상기 들깨 및 차조기 품종별 기준 증폭 유무 및 크기는, 안티스페릴(Antisperill), 차조기 야생종(Wild type), IT 220380, IT 226692, IT 229043, IT 242083, IT 242256, IT 267741, IT 271306, IT 271317, IT 283645, IT 286213, IT 286246, IT 296762, IT 305302, IT 308494, IT 226670, IT 271310, IT 271311, IT 271319, IT 283597, IT 293400, IT 293402, IT 293403, IT 201764, IT 201765, IT 201771, IT 201773, IT 201780, IT 226471, IT 226486, IT 226573, IT 226664, IT 226671, IT 226672, IT 236930, IT 240108, IT 274215, IT 305543, IT 226663, IT 274210, IT 196391, IT 220659, IT 223670, IT 240105, IT 240106, IT 240107, IT 242623, IT 246853, IT 271259, IT 273794, IT 273827, IT 276486, IT 277881, IT 286191, IT 298992, PF08126, PF08145, IT 229026, PF09159, IT 302031, IT 213786, IT 226451, IT 220387, IT 220393, IT 220395, IT 220397, IT 226732, IT 226733, IT 226737, IT 226742, IT 226743, IT 226744, IT 260616, IT 271262, IT 274283, IT 274284, IT 274285, IT 274286, IT 274288, IT 274290, IT 274301, IT 274295, IT 200354, IT 226466, IT 274208, IT 226627, PF98075, PF11107, IT 162886, IT 175835, IT 175889, IT 177137, IT 180973, IT 185622 및 IT 185625로 이루어진 그룹으로부터 선택되는 1종 이상의 품종이 상기 프라이머 세트 조성물에 의해 증폭되는 결과이며, 여기서, IT 번호는 농촌진흥청 농업유전자원센터 보유 유전자원이며, PF 번호는 강원대학교 보유 유전자원인, 들깨 및 차조기 품종의 유전자원 판별 방법.
5. The method of claim 4,
The presence or absence and size of the standard amplification for each variety of perilla and perilla perilla, antisperill, wild type of perilla, IT 220380, IT 226692, IT 229043, IT 242083, IT 242256, IT 267741, IT 271306, IT 271317 , IT 283645, IT 286213, IT 286246, IT 296762, IT 305302, IT 308494, IT 226670, IT 271310, IT 271311, IT 271319, IT 283597, IT 293400, IT 293402, IT 293403, IT 201764, IT 201765, IT 201771, IT 201773, IT 201780, IT 226471, IT 226486, IT 226573, IT 226664, IT 226671, IT 226672, IT 236930, IT 240108, IT 274215, IT 305543, IT 226663, IT 274210, IT 196391, IT 220659, IT 223670, IT 240105, IT 240106, IT 240107, IT 242623, IT 246853, IT 271259, IT 273794, IT 273827, IT 276486, IT 277881, IT 286191, IT 298992, PF08126, PF08145, IT 229026, PF09159, IT 302031 , IT 213786, IT 226451, IT 220387, IT 220393, IT 220395, IT 220397, IT 226732, IT 226733, IT 226737, IT 226742, IT 226743, IT 226744, IT 260616, IT 271262, IT 274283, IT 274284, IT 274285, IT 274286, IT 274288, IT 274290, IT 274301, IT 274295, IT 200354, IT 226466, IT 274208, IT 226627, One or more varieties selected from the group consisting of PF98075, PF11107, IT 162886, IT 175835, IT 175889, IT 177137, IT 180973, IT 185622 and IT 185625 are the result of amplification by the primer set composition, wherein the IT number is the genetic resource owned by the Agricultural Genetic Resource Center of the Rural Development Administration, and the PF number is the genetic resource owned by Kangwon National University, and the genetic resource identification method of perilla and perilla varieties.
KR1020200023401A 2020-02-26 2020-02-26 EST-SSR primer set for identifying Perilla frutescens cultivar, kit for identifying Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same KR102276917B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020200023401A KR102276917B1 (en) 2020-02-26 2020-02-26 EST-SSR primer set for identifying Perilla frutescens cultivar, kit for identifying Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200023401A KR102276917B1 (en) 2020-02-26 2020-02-26 EST-SSR primer set for identifying Perilla frutescens cultivar, kit for identifying Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same

Publications (1)

Publication Number Publication Date
KR102276917B1 true KR102276917B1 (en) 2021-07-14

Family

ID=76863052

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200023401A KR102276917B1 (en) 2020-02-26 2020-02-26 EST-SSR primer set for identifying Perilla frutescens cultivar, kit for identifying Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same

Country Status (1)

Country Link
KR (1) KR102276917B1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060023378A (en) * 2004-09-09 2006-03-14 대한민국(강원대학교 총장) Method for producing a marker for detecting polymorphism in a plant
KR100781205B1 (en) * 2004-09-09 2007-12-03 강원대학교산학협력단 SSR primer isolated from Perilla spp. and use thereof
KR20190037609A (en) * 2017-09-29 2019-04-08 대한민국(농촌진흥청장) Molecular marker for identifying Perilla cultivars and Perilla wild species based on the information of chloroplast genomes and 45S nrDNAs sequence and uses thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20060023378A (en) * 2004-09-09 2006-03-14 대한민국(강원대학교 총장) Method for producing a marker for detecting polymorphism in a plant
KR100781205B1 (en) * 2004-09-09 2007-12-03 강원대학교산학협력단 SSR primer isolated from Perilla spp. and use thereof
KR20190037609A (en) * 2017-09-29 2019-04-08 대한민국(농촌진흥청장) Molecular marker for identifying Perilla cultivars and Perilla wild species based on the information of chloroplast genomes and 45S nrDNAs sequence and uses thereof

Similar Documents

Publication Publication Date Title
Gilmore et al. Short tandem repeat (STR) DNA markers are hypervariable and informative in Cannabis sativa: implications for forensic investigations
KR100823692B1 (en) Sequence-based dna markers for evaluation of phylogenetic relationships and cultivar identification in korean watermelon varieties
KR102062452B1 (en) Genetic maker for parentage and thereod in Turbot
KR102029016B1 (en) SSR primer set for discriminating Agaricus bisporus strain and uses thereof
KR20190135789A (en) Genetic maker for parentage and thereof in Olive flounder
KR101976974B1 (en) SSR molecular markers for discriminating grape cultivars and uses thereof
Ravishankar et al. Mining and characterization of SSRs from pomegranate (Punica granatum L.) by pyrosequencing
KR102634293B1 (en) Molecular marker based on mitochondrial genome sequence for discriminating Schisandra chinensis &#39;Cheongsun&#39; cultivar and uses thereof
Beser et al. Marker-assisted introgression of a broad-spectrum resistance gene, Pi40 improved blast resistance of two elite rice (Oryza sativa L.) cultivars of Turkey
KR102235298B1 (en) Marker for discrimination of resistance to tomato yellow leaf curl virus and discrimination method using the same marker
KR102276917B1 (en) EST-SSR primer set for identifying Perilla frutescens cultivar, kit for identifying Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same
KR101877532B1 (en) Primers for detecting SNP markers specific to Haryejosaeng and uses thereof
KR101144988B1 (en) SCAR markers for discrimination of apple cultivars and use thereof
KR101649589B1 (en) SSR primer derived from apple and use thereof
KR102111238B1 (en) Microsatellite marker composition for analysis Epinephelus bruneus genes and method of analysis using the same
KR101535925B1 (en) Microsatellite markers for identification of goats
KR101301863B1 (en) A method for identifying lettuce varieties using microsatellite primer set
KR101993289B1 (en) Molecular marker for discriminating purple color of Perilla leaf and uses thereof
KR20160057021A (en) HRM Primer sets for discriminating Korean and American ginseng and uses thereof
KR101684069B1 (en) Novel genomic marker for identifying Flammulina vehitipes and uses thereof
KR102369297B1 (en) Marker for discriminating foxglove aphid-resistant or sensitive soybean and uses thereof
KR102412793B1 (en) SNP genetic markers and primer sets for discriminating domestic wheat cultivar and uses thereof
KR102009627B1 (en) Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato
KR102540651B1 (en) SSR Marker Composition for Identification of Blade type of Pyropia yezoensis and Application thereof
KR101764629B1 (en) Primer sets for discriminating Kenaf, and method for discriminating Kenaf

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant