KR102009627B1 - Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato - Google Patents

Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato Download PDF

Info

Publication number
KR102009627B1
KR102009627B1 KR1020190088449A KR20190088449A KR102009627B1 KR 102009627 B1 KR102009627 B1 KR 102009627B1 KR 1020190088449 A KR1020190088449 A KR 1020190088449A KR 20190088449 A KR20190088449 A KR 20190088449A KR 102009627 B1 KR102009627 B1 KR 102009627B1
Authority
KR
South Korea
Prior art keywords
seq
nos
tomato
primer sets
primer
Prior art date
Application number
KR1020190088449A
Other languages
Korean (ko)
Other versions
KR20190089140A (en
Inventor
박순주
박승혜
김대헌
백소현
Original Assignee
원광대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 원광대학교산학협력단 filed Critical 원광대학교산학협력단
Priority to KR1020190088449A priority Critical patent/KR102009627B1/en
Publication of KR20190089140A publication Critical patent/KR20190089140A/en
Application granted granted Critical
Publication of KR102009627B1 publication Critical patent/KR102009627B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Abstract

본 발명은 야생종 토마토 및 재배종 토마토 판별용 토마토 삽입-결실 마커 프라이머 세트에 관한 것으로, 구체적으로 야생종 토마토인 솔라눔 핌피넬리포리움(S. pimpinellifolium)과 재배종 토마토인 솔라눔 리코퍼시쿰(S. lycopersicum)의 유전자 염기서열을 비교하여 12개의 토마토 염색체 각각에서 5개의 삽입-결실(Indel) 부위를 선별하였고, 상기 Indel 부위를 증폭하기 위한 프라이머를 이용하여 야생종 토마토 솔라눔 핌피넬리포리움과 재배종 토마토 솔라눔 리코퍼시쿰을 판별할 수 있음을 확인하였으므로, 본 발명의 토마토 삽입-결실 마커 프라이머 세트를 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum) 판별용 프라이머 세트로 이용할 수 있다.The present invention relates to a set of tomato indel marker primers for discriminating wild tomato and cultivated tomato, specifically, S. pimpinellifolium ( S. pimpinellifolium ), which is a wild tomato, and soloma lycopersicum ( S. lycopersicum ), which are cultivated tomato. 5 insertion-deletion sites were selected from each of 12 tomato chromosomes by comparing the gene sequencing), and wild tomato tomato solumum pinumelliporium and cultivated tomato sol using primers for amplifying the indel site. num Rico Percy evaluator has confirmed that the glutamicum can be determined, tomato insert of the present invention the marker deletion primer set for wild type tomato solar num pimpi Marinelli Four Solarium (Solanum pimpinellifolium) and cultivated tomato solar num Rico Percy glutamicum (Solanum lycopersicum ) can be used as a primer set for determination.

Description

야생종 토마토 및 재배종 토마토 판별용 토마토 삽입-결실 마커 프라이머 세트{Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato}Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato}

본 발명은 야생종 토마토 및 재배종 토마토 판별용 토마토 삽입-결실(Indel) 마커 프라이머 세트에 관한 것으로, 보다 구체적으로 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하기 위한 Indel 마커, 상기 마커를 증폭하기 위한 프라이머 세트에 관한 것이다.
The present invention relates to a tomato insertion-deletion (Indel) marker primer set for discriminating wild-type tomatoes and cultivar tomatoes, and more specifically, wild-type tomatoes Solanum Pimpinelliforium (Solanum pimpinellifolium ) and cultivar tomato Solanum lycopersicum Indel marker for discriminating, and a primer set for amplifying the marker.

농산물 시장 개방에 따라 어려움에 처해 있는 국내 농업의 발전과 식량안보 주권을 확립하기 위해서는 고품질 품종개발을 통한 종자산업 육성이 필요하다. 특히, 외국 도입 품종에 의존하고 있는 화훼, 관상, 과수, 기능성 특약용 작물 및 버섯 등 균류의 국산 품종개발 활용이 시급한 실정이다. 세계적인 환경파괴에 따른 생물 다양성의 감소와 국제식물신품종보호동맹 (UPOV) 가입에 따른 품종 로열티 강화 추세에 따라 국산 종자 및 유전자원 지적재산권 확보 필요성이 증대되고 있다. 주요 식물의 유전자 염기서열이 밝혀짐에 따라 유전자의 기능을 밝히는 기능유전체(functional genomics) 연구 소재용의 돌연변이 유전자원의 수요가 급속도로 증가하고 있어, 방사선 등을 이용한 돌연변이 육종기술로 대량의 유용 변이체의 창출과 공급이 필요한 상황이다.
In order to develop domestic agriculture and establish food security sovereignty, which is facing difficulties due to the opening of the agricultural product market, it is necessary to foster the seed industry through the development of high-quality varieties. In particular, it is urgent to develop domestic varieties of fungi such as flowers, ornamentals, fruit trees, crops for special medicines and mushrooms that depend on foreign varieties. The need to secure intellectual property rights for domestic seeds and genetic resources is increasing due to the decrease in biodiversity due to global environmental destruction and the trend of strengthening cultivar royalties due to joining the International New Plant Variety Protection Alliance (UPOV). As the gene sequences of major plants are revealed, the demand for mutant genetic resources for functional genomics research materials that reveal the function of genes is rapidly increasing, so a large amount of useful mutants using mutation breeding technology using radiation, etc. It is a situation in which the creation and supply of products are needed.

농산물 시장에서 토마토는 전세계적으로 경제적으로 가장 중요한 작물 중 하나로, 원예작물 중 생산량과 소비량이 1위인 작물이며, 연간 146백만 톤이 생산되고 있다(FAO 2010). 토마토(Solanum lycopersicum L.)는 2배체(2n=24) 작물로 가지과(Solanaceae family)에 속한다. 가지과는 약 90개의 속(genus)을 가지며 종류가 다양하다(D`Arcy 1979). 일반적으로 재배되고 있는 S. lycopersicum과 야생종 S. cheesmaniae, S. chilense, S. habrochaites, S. chmielewskii, S. parviflorum, S. peruvianum, S. pimpinellifolium 등이 알려져 있다(Peralata 2000; Rick 1976). 이처럼 다양한 토마토 종류가 있으나, 재배종 토마토 및 야생종 토마토를 판별하기 위한 연구가 부족한 실정이다.
In the agricultural market, tomatoes are one of the most economically important crops in the world, and are the number one crop among horticultural crops, with production and consumption of 146 million tons per year (FAO 2010). Tomato ( Solanum lycopersicum L.) is a diploid (2n=24) crop and belongs to the Solanaceae family. The eggplant family has about 90 genus, and the types are diverse (D`Arcy 1979). Commonly cultivated S. lycopersicum and wild species S. cheesmaniae , S. chilense , S. habrochaites , S. chmielewskii , S. parviflorum , S. peruvianum , S. pimpinellifolium, etc. are known (Peralata 2000; Rick 1976). As such, there are various types of tomatoes, but studies to discriminate cultivated tomatoes and wild tomatoes are insufficient.

최근 분자유전학이 발달하면서 작물의 육종에 이용되는 품종이나 유전자원의 유전적 다양성과 그들간의 유연관계 분석이 유전 변이의 확대와 품종 육성 효율성 증대에 매우 효과적으로 이용되고 있다. 과거에는 형태적 및 생화학적 특성에 의하여 유전적 다양성을 평가하여 왔으나 이러한 평가방법은 유전적 특성이 가까운 근연종간에는 사용이 매우 제한적이며, 대상형질이 환경의 영향을 받기 때문에 다양성의 평가가 어려운 실정이다.With the recent development of molecular genetics, genetic diversity of varieties or genetic resources used for breeding of crops and analysis of the relationship between them has been very effectively used to expand genetic variation and increase the efficiency of breeding. In the past, genetic diversity has been evaluated based on morphological and biochemical characteristics, but the use of this evaluation method is very limited among related species with close genetic characteristics, and it is difficult to evaluate diversity because the target trait is affected by the environment. to be.

이에 따라, 염색체 내 제한효소 인식부위의 변이의 의해 발생하는 염기서열 길이 차이를 이용한 RFLPs(Restriction Fragment Length Polymorphisms) 방법이 개발되었으나 이 방법은 방사선 동위원소를 사용해야 하는 번거로움이 있다. 이후 PCR(Polymerase Chain Reaction)을 이용한 핵산지문법(fingerprinting)으로서, RAPD(randomly amplified polymorphic DNA) 방법 등이 개발되었다. PCR 방법은 10~20여 개의 뉴클레오티드로 구성된 작은 올리고뉴클레오타이드(이하 프라이머)을 생물체의 DNA 또는 RNA와 결합(annealing)시킨 후, 내열성 DNA 중합 효소(Tag DNA Polymerase)를 첨가하여 합성반응이 반복적으로 이루어지게 하는 방법이다. 이것은 다른 방법에 비해 소량의 DNA(1-50ng)만을 요구하며, 간편하고 빠르게 결과를 확인할 수 있다는 장점을 갖고 있다. PCR 방법으로 분석하는 상기 방법 중 RAPD 방법은 비특이적 PCR 산물이 증폭되므로 재현성이 떨어지는 단점이 있고, AFLP(Amplified Fragment Length polymorphism) 방법은 높은 DNA 다형성(polymorphism) 검출로 각광을 받고 있지만 재현성이 떨어지는 밴드의 출현과 분석이 복잡하다는 단점이 있다. 또한, SSR (single sequence repeat) 방법은 DNA 반복배열인 초위성체(microsatellite) 영역의 염기배열 정보를 근거로 PCR 프라이머를 제작하여 개체 내의 초위성체를 분석하는 방법으로 상기 단순염기서열의 반복수는 품종 간 또는 개체 간에 다르게 때문에 이 부분을 PCR 반응으로 증폭하였을 때 다형화 현상이 나타나게 되며 이를 동물과 식물의 유전 연구에 활발히 이용하고 있으나 고밀도 유전자 지도 제작에는 충분하지 않는 단점이 있다.Accordingly, the RFLPs (Restriction Fragment Length Polymorphisms) method using the difference in nucleotide sequence length caused by the mutation of the restriction enzyme recognition site in the chromosome has been developed, but this method is cumbersome to use radioactive isotopes. Since then, as a nucleic acid fingerprinting method using PCR (Polymerase Chain Reaction), a randomly amplified polymorphic DNA (RAPD) method has been developed. The PCR method involves annealing a small oligonucleotide (hereinafter referred to as primer) composed of 10 to 20 nucleotides with DNA or RNA of an organism, and then adding a heat-resistant DNA polymerase to repeat the synthesis reaction. It's a way to make it happen. Compared to other methods, this requires only a small amount of DNA (1-50ng), and has the advantage of being able to check the results easily and quickly. Among the above methods analyzed by the PCR method, the RAPD method has a disadvantage of poor reproducibility because non-specific PCR products are amplified, and the AFLP (Amplified Fragment Length polymorphism) method is in the spotlight for detection of high DNA polymorphism, but the band with low reproducibility. The disadvantage is that the emergence and analysis are complicated. In addition, the SSR (single sequence repeat) method is a method of analyzing the supersatellite in an individual by producing a PCR primer based on the nucleotide sequence information of the DNA repeat sequence of the microsatellite region. Because of differences between livers or individuals, polymorphism occurs when this part is amplified by PCR reaction, and it is actively used for genetic studies of animals and plants, but it has a disadvantage that it is not sufficient for high-density genetic mapping.

이에 반해 삽입-결실(insertion　or deletion: Indel) 마커를 이용한 방법은 특정 위치에 있는 DNA의 염기서열 분석을 통해 품종간 염기서열의 삽입 또는 결실을 기반으로 PCR 프라이머를 제작하는 방법으로 PCR 반응으로 증폭하였을 때 다형화 현상이 나타나게 하는 장점을 유지하며 고밀도 유전자지도 제작도 가능하게 한다.
On the other hand, the method using an insertion or deletion (Indel) marker is a method of making PCR primers based on the insertion or deletion of nucleotide sequences between varieties through nucleotide sequence analysis of DNA at a specific position, amplified by PCR reaction. When doing so, it maintains the advantage of causing polymorphism and makes it possible to produce high-density genetic maps.

한편, 토마토 품종 판별을 위한 마커와 관련하여, 토마토의 SSR 마커가 미국(Broun and Tanksley. 1996), 네덜란드(Smulders et al. 1997), 독일(Areshchenkova and Ganal. 1999), 이스라엘(Suliman-pollatchek et al. 2002), 캐나다(He et al. 2003)에서 이미 개발되어 분자 육종 연구에 활용해 오고 있으며, 최근에 국제가지과 식물 유전체 컨소시엄이 조직되면서 608개 이상의 SSR 마커를 개발하여 그 결과를 공개하고 있다(Http://www.sgn.cornell.edu/). 특히 네덜란드에서는 20개의 SSR 마커를 이용하여 토마토 521 품종을 분석하여 이를 데이터베이스화한 바 있고(Bredemeijer et al. 2002), 영국에서는 토마토 품종보호 출원품종의 균일성 분석에 SSR 마커의 이용 가능성을 제시한 바 있으나(Cook et al. 2003), 이들 마커의 염기서열 자체는 공개되어 있지 않고 있는 실정이다. 우리나라의 경우 토마토의 조직배양이나 형질전환 기법에 대한 다양한 연구가 수행되어 왔으나(park et al. 2002), 분자표지인자를 이용한 품종식별에 대한 연구결과는 거의 없는 실정이다.
On the other hand, with respect to markers for identifying tomato varieties, the SSR markers of tomatoes are the United States (Broun and Tanksley. 1996), the Netherlands (Smulders et al. 1997), Germany (Areshchenkova and Ganal. 1999), and Israel (Suliman-pollatchek et al. al. 2002) and Canada (He et al. 2003) have already been developed and used for molecular breeding research, and recently, as an international eggplant genome consortium was organized, more than 608 SSR markers have been developed and the results are disclosed. (Http://www.sgn.cornell.edu/). In particular, in the Netherlands, 521 varieties of tomatoes were analyzed using 20 SSR markers, and the database was made (Bredemeijer et al. 2002), and in the UK, the possibility of using SSR markers was suggested for the homogeneity analysis of varieties applied for protection of tomato varieties. Although it has been (Cook et al. 2003), the nucleotide sequence of these markers has not been disclosed. In Korea, various studies on tissue culture and transformation techniques of tomatoes have been conducted (park et al. 2002), but there are few research results on cultivar identification using molecular markers.

이에, 본 발명자들은 토마토 품종을 구별하기 위해 효율적으로 이용될 수 있는 분자표지인자를 개발하기 위해 노력한 결과, 야생종 토마토인 솔라눔 핌피넬리포리움(Solanum pimpinellifolium LA1854)과 재배종 토마토인 솔라눔 리코퍼시쿰(Solanum lycopersicum cv Heinz 1706)의 유전자 염기서열을 비교하여 12개의 토마토 염색체 각각에서 5개의 삽입-결실(Indel) 부위를 선별하였고, 상기 Indel 부위를 증폭하기 위한 프라이머를 이용하여 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum cv M82)을 판별할 수 있음을 밝힘으로써, 본 발명을 완성하였다.
Accordingly, the present inventors have tried to develop molecular markers that can be efficiently used to distinguish tomato varieties, as a result of which, as a result of which the wild-type tomato, Solanum pimpinellifolium LA1854, and the cultivated tomato, Solanum lycopersicum. By comparing the gene sequence of (Solanum lycopersicum cv Heinz 1706), five indel sites were selected from each of 12 tomato chromosomes, and a primer for amplifying the Indel site was used to amplify the wild species tomato Solanum pimpinelli. Forium ( Solanum pimpinellifolium ) and cultivar tomato Solanum lycopersicum (Solanum lycopersicum cv M82) by revealing that can be discriminated, the present invention was completed.

본 발명의 목적은 토마토 삽입-결실(Indel) 마커 프라이머 세트를 포함하는 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하기 위한 프라이머 세트를 제공하기 위한 것이다.An object of the present invention is tomato indel (Indel) wild species tomato Solanum Pimpinelliforium containing a marker primer set (Solanum pimpinellifolium ) and cultivar tomato Solanum lycopersicum to provide a primer set for discriminating.

본 발명의 다른 목적은 토마토 삽입-결실(Indel) 마커 프라이머 세트를 이용하여 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하는 방법을 제공하기 위한 것이다.Another object of the present invention is a tomato insertion-deletion (Indel) marker primer set using a wild species tomato Solanum Pimpinelliforium (Solanum pimpinellifolium ) and cultivar tomato Solanum lycopersicum (Solanum lycopersicum) to provide a method for discriminating.

본 발명의 또 다른 목적은 토마토 삽입-결실(Indel) 마커 프라이머 세트를 포함하는 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하기 위한 키트를 제공하기 위한 것이다.
Another object of the present invention is a tomato indel (Indel) wild species tomato Solanum Pimpinelliforium containing a marker primer set (Solanum pimpinellifolium ) and cultivar tomato Solanum lycopersicum (Solanum lycopersicum) to provide a kit for discriminating.

본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 13 및 14로 이루어진 프라이머 세트; 서열번호 15 및 16으로 이루어진 프라이머 세트; 서열번호 21 및 22로 이루어진 프라이머 세트; 서열번호 27 및 28로 이루어진 프라이머 세트; 서열번호 39 및 40으로 이루어진 프라이머 세트; 서열번호 43 및 44로 이루어진 프라이머 세트; 서열번호 53 및 54로 이루어진 프라이머 세트; 서열번호 55 및 56으로 이루어진 프라이머 세트; 서열번호 57 및 58로 이루어진 프라이머 세트; 서열번호 59 및 60으로 이루어진 프라이머 세트; 서열번호 61 및 62로 이루어진 프라이머 세트; 서열번호 119 및 120으로 이루어진 프라이머 세트; 서열번호 123 및 124로 이루어진 프라이머 세트; 및 서열번호 125 및 126으로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 포함하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하기 위한 프라이머 세트를 제공한다.In order to achieve the object of the present invention, the present invention is a primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOs: 15 and 16; A primer set consisting of SEQ ID NOs: 21 and 22; A primer set consisting of SEQ ID NOs: 27 and 28; A primer set consisting of SEQ ID NOs: 39 and 40; A primer set consisting of SEQ ID NOs: 43 and 44; A primer set consisting of SEQ ID NOs: 53 and 54; A primer set consisting of SEQ ID NOs: 55 and 56; A primer set consisting of SEQ ID NOs: 57 and 58; A primer set consisting of SEQ ID NOs: 59 and 60; A primer set consisting of SEQ ID NOs: 61 and 62; A primer set consisting of SEQ ID NOs: 119 and 120; A primer set consisting of SEQ ID NOs: 123 and 124; And SEQ ID NO: 125 and 126, including any one or more primers selected from the group consisting of a primer set consisting of, a wild tomato solar num pimpi Marinelli Four Solarium (Solanum pimpinellifolium) and cultivated tomato solar num Rico Percy glutamicum (Solanum lycopersicum ) provides a set of primers for discriminating.

또한, 본 발명은 서열번호 1 및 2로 이루어진 프라이머 세트; 서열번호 3 및 4로 이루어진 프라이머 세트; 서열번호 5 및 6으로 이루어진 프라이머 세트; 서열번호 7 및 8로 이루어진 프라이머 세트; 서열번호 9 및 10으로 이루어진 프라이머 세트; 서열번호 17 및 18로 이루어진 프라이머 세트; 서열번호 23 및 24로 이루어진 프라이머 세트; 서열번호 25 및 26으로 이루어진 프라이머 세트; 서열번호 31 및 32로 이루어진 프라이머 세트; 서열번호 41 및 42로 이루어진 프라이머 세트; 서열번호 63 및 64로 이루어진 프라이머 세트; 서열번호 65 및 66으로 이루어진 프라이머 세트; 서열번호 67 및 68로 이루어진 프라이머 세트; 서열번호 69 및 70으로 이루어진 프라이머 세트; 서열번호 71 및 72로 이루어진 프라이머 세트; 서열번호 73 및 74로 이루어진 프라이머 세트; 서열번호 75 및 76으로 이루어진 프라이머 세트; 서열번호 77 및 78로 이루어진 프라이머 세트; 서열번호 79 및 80으로 이루어진 프라이머 세트; 서열번호 81 및 82로 이루어진 프라이머 세트; 서열번호 85 및 86으로 이루어진 프라이머 세트; 서열번호 87 및 88로 이루어진 프라이머 세트; 서열번호 91 및 92로 이루어진 프라이머 세트; 서열번호 93 및 94로 이루어진 프라이머 세트; 서열번호 95 및 96으로 이루어진 프라이머 세트; 서열번호 97 및 98로 이루어진 프라이머 세트; 서열번호 101 및 102로 이루어진 프라이머 세트; 서열번호 121 및 122로 이루어진 프라이머 세트; 및 서열번호 127 및 128로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 추가로 포함하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하기 위한 프라이머 세트를 제공한다.In addition, the present invention is a primer set consisting of SEQ ID NOs: 1 and 2; A primer set consisting of SEQ ID NOs: 3 and 4; A primer set consisting of SEQ ID NOs: 5 and 6; A primer set consisting of SEQ ID NOs: 7 and 8; A primer set consisting of SEQ ID NOs: 9 and 10; A primer set consisting of SEQ ID NOs: 17 and 18; A primer set consisting of SEQ ID NOs: 23 and 24; A primer set consisting of SEQ ID NOs: 25 and 26; A primer set consisting of SEQ ID NOs: 31 and 32; A primer set consisting of SEQ ID NOs: 41 and 42; A primer set consisting of SEQ ID NOs: 63 and 64; A primer set consisting of SEQ ID NOs: 65 and 66; A primer set consisting of SEQ ID NOs: 67 and 68; A primer set consisting of SEQ ID NOs: 69 and 70; A primer set consisting of SEQ ID NOs: 71 and 72; A primer set consisting of SEQ ID NOs: 73 and 74; A primer set consisting of SEQ ID NOs: 75 and 76; A primer set consisting of SEQ ID NOs: 77 and 78; A primer set consisting of SEQ ID NOs: 79 and 80; A primer set consisting of SEQ ID NOs: 81 and 82; A primer set consisting of SEQ ID NOs: 85 and 86; A primer set consisting of SEQ ID NOs: 87 and 88; A primer set consisting of SEQ ID NOs: 91 and 92; A primer set consisting of SEQ ID NOs: 93 and 94; A primer set consisting of SEQ ID NOs: 95 and 96; A primer set consisting of SEQ ID NOs: 97 and 98; A primer set consisting of SEQ ID NOs: 101 and 102; A primer set consisting of SEQ ID NOs: 121 and 122; And any one or more primer sets selected from the group consisting of a primer set consisting of SEQ ID NOs: 127 and 128 are further added. Including, it provides a primer set for discriminating wild species tomato solanum pimpinellifolium (Solanum pimpinellifolium) and cultivar tomato solanum lycopersicum (Solanum lycopersicum).

또한, 본 발명은 In addition, the present invention

1) 대상 시료에서 게놈 DNA를 분리하는 단계;1) separating genomic DNA from the target sample;

2) 상기 단계 1)에서 분리한 게놈 DNA를 주형으로 하고, 상기 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및2) using the genomic DNA isolated in step 1) as a template and performing an amplification reaction using the primer set to amplify the target sequence; And

3) 상기 단계 2)에서 증폭한 산물을 검출하는 단계를 포함하는,야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하는 방법을 제공한다.3) comprising the step of detecting the product amplified in step 2), Wild tomato Solanum Pimpinelliforium (Solanum pimpinellifolium ) and cultivar tomato Solanum lycopersicum (Solanum lycopersicum) to provide a method for determining.

아울러, 본 발명은 상기 프라이머 세트를 포함하는 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하기 위한 키트를 제공한다.
In addition, the present invention provides a kit for discriminating wild type tomato solanum pimpinellifolium and cultivar tomato solanum lycopersicum including the primer set.

본 발명의 삽입-결실(Indel) 마커 및 상기 마커를 증폭하는 프라이머를 이용하는 경우, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum) 의 판별이 가능하며, 특정 표현형의 원인이 되는 변이 유전자의 위치의 예측이 가능하다.
Insert of the present invention - deletion (Indel) markers, and the case of using the primer for amplifying the marker, wild tomato solar num pimpi Marinelli Four Solarium (Solanum pimpinellifolium) and cultivated tomato solar num Rico Percy glutamicum (Solanum lycopersicum ) can be identified, and the location of the mutant gene that causes a specific phenotype can be predicted.

도 1은 12개의 토마토 염색체상에서 본 연구에 사용한 삽입-결실(Indel) 마커의 분포를 나타낸 것이다.
도 2는 Indel 마커 프라이머를 이용한 야생종 토마토 솔라눔 핌피넬리포리움(S. pimpinellifolium) 및 재배종 토마토 솔라눔 리코퍼시쿰(S. lycopersicum cv M82)의 Indel 마커 증폭 결과를 나타낸 것으로, Indel 마커의 증폭에 주형(template)으로 사용한 게놈 DNA는 다음과 같다:
p: 야생종 토마토 S. pimpinellifolium의 게놈 DNA;
m: 야생종 토마토 S. pimpinellifolium의 게놈 DNA와 재배종 토마토 S. lycopersicum cv M82의 게놈 DNA 혼합물; 및
c: 재배종 토마토 S. lycopersicum cv M82의 게놈 DNA.
도 3은 Indel 마커 프라이머를 이용한 야생종 토마토 S. pimpinellifolium, 재배종 토마토 S. lycopersicum cv M82 및 재배종 토마토 마이크로-톰(Micro-Tom)의 Indel 마커 증폭 결과를 나타낸 것으로, Indel 마커의 증폭에 주형으로 사용한 게놈 DNA는 다음과 같다:
μ: 재배종 토마토 Micro-Tom의 게놈 DNA;
M8: 재배종 토마토 S. lycopersicum cv M82의 게놈 DNA; 및
p: 야생종 토마토 S. pimpinellifolium의 게놈 DNA.1 shows the distribution of indel markers used in this study on 12 tomato chromosomes.
Figure 2 is a wild type tomato solanum pimpinellifolium (S. pimpinellifolium) and cultivar tomato solanum lycopersicum (S. lycopersicum) using Indel marker primers. cv M82) shows the results of Indel marker amplification, genomic DNA used as a template for the amplification of Indel markers is as follows:
p: genomic DNA of wild tomato S. pimpinellifolium;
m: a mixture of genomic DNA of wild tomato S. pimpinellifolium and genomic DNA of cultivar tomato S. lycopersicum cv M82; And
c: cultivar tomato S. lycopersicum Genomic DNA of cv M82.
Figure 3 is a wild tomato S. pimpinellifolium , cultivar tomato S. lycopersicum using Indel marker primers cv M82 and cultivar Tomato Micro-Tom shows the results of amplification of Indel markers. The genomic DNA used as a template for the amplification of Indel markers is as follows:
μ: genomic DNA of the cultivar tomato Micro-Tom;
M8: cultivar tomato S. lycopersicum genomic DNA of cv M82; And
p: Genomic DNA of wild tomato S. pimpinellifolium.

이하, 본 발명을 상세히 설명한다.
Hereinafter, the present invention will be described in detail.

본 발명은 서열번호 13 및 14로 이루어진 프라이머 세트; 서열번호 15 및 16으로 이루어진 프라이머 세트; 서열번호 21 및 22로 이루어진 프라이머 세트; 서열번호 27 및 28로 이루어진 프라이머 세트; 서열번호 39 및 40으로 이루어진 프라이머 세트; 서열번호 43 및 44로 이루어진 프라이머 세트; 서열번호 53 및 54로 이루어진 프라이머 세트; 서열번호 55 및 56으로 이루어진 프라이머 세트; 서열번호 57 및 58로 이루어진 프라이머 세트; 서열번호 59 및 60으로 이루어진 프라이머 세트; 서열번호 61 및 62로 이루어진 프라이머 세트; 서열번호 119 및 120으로 이루어진 프라이머 세트; 서열번호 123 및 124로 이루어진 프라이머 세트; 및 서열번호 125 및 126으로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 포함하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하기 위한 프라이머 세트를 제공한다.The present invention is a primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOs: 15 and 16; A primer set consisting of SEQ ID NOs: 21 and 22; A primer set consisting of SEQ ID NOs: 27 and 28; A primer set consisting of SEQ ID NOs: 39 and 40; A primer set consisting of SEQ ID NOs: 43 and 44; A primer set consisting of SEQ ID NOs: 53 and 54; A primer set consisting of SEQ ID NOs: 55 and 56; A primer set consisting of SEQ ID NOs: 57 and 58; A primer set consisting of SEQ ID NOs: 59 and 60; A primer set consisting of SEQ ID NOs: 61 and 62; A primer set consisting of SEQ ID NOs: 119 and 120; A primer set consisting of SEQ ID NOs: 123 and 124; And SEQ ID NO: 125 and 126 comprising any one or more primer sets selected from the group consisting of a primer set, wild species tomato solanum pimpinellifolium (Solanum pimpinellifolium) and cultivar tomato solanum lycopersicum (Solanum lycopersicum ) discrimination It provides a set of primers for the following.

본 발명에서, 상기 솔라눔 리코퍼시쿰을 판별하기 위하여, 서열번호 1 및 2로 이루어진 프라이머 세트; 서열번호 3 및 4로 이루어진 프라이머 세트; 서열번호 5 및 6으로 이루어진 프라이머 세트; 서열번호 7 및 8로 이루어진 프라이머 세트; 서열번호 9 및 10으로 이루어진 프라이머 세트; 서열번호 17 및 18로 이루어진 프라이머 세트; 서열번호 23 및 24로 이루어진 프라이머 세트; 서열번호 25 및 26으로 이루어진 프라이머 세트; 서열번호 31 및 32로 이루어진 프라이머 세트; 서열번호 41 및 42로 이루어진 프라이머 세트; 서열번호 63 및 64로 이루어진 프라이머 세트; 서열번호 65 및 66으로 이루어진 프라이머 세트; 서열번호 67 및 68로 이루어진 프라이머 세트; 서열번호 69 및 70으로 이루어진 프라이머 세트; 서열번호 71 및 72로 이루어진 프라이머 세트; 서열번호 73 및 74로 이루어진 프라이머 세트; 서열번호 75 및 76으로 이루어진 프라이머 세트; 서열번호 77 및 78로 이루어진 프라이머 세트; 서열번호 79 및 80으로 이루어진 프라이머 세트; 서열번호 81 및 82로 이루어진 프라이머 세트; 서열번호 85 및 86으로 이루어진 프라이머 세트; 서열번호 87 및 88로 이루어진 프라이머 세트; 서열번호 91 및 92로 이루어진 프라이머 세트; 서열번호 93 및 94로 이루어진 프라이머 세트; 서열번호 95 및 96으로 이루어진 프라이머 세트; 서열번호 97 및 98로 이루어진 프라이머 세트; 서열번호 101 및 102로 이루어진 프라이머 세트; 서열번호 121 및 122로 이루어진 프라이머 세트; 및 서열번호 127 및 128로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 추가로 포함할 수 있다.In the present invention, in order to determine the solanum lycopersicum, a primer set consisting of SEQ ID NOs: 1 and 2; A primer set consisting of SEQ ID NOs: 3 and 4; A primer set consisting of SEQ ID NOs: 5 and 6; A primer set consisting of SEQ ID NOs: 7 and 8; A primer set consisting of SEQ ID NOs: 9 and 10; A primer set consisting of SEQ ID NOs: 17 and 18; A primer set consisting of SEQ ID NOs: 23 and 24; A primer set consisting of SEQ ID NOs: 25 and 26; A primer set consisting of SEQ ID NOs: 31 and 32; A primer set consisting of SEQ ID NOs: 41 and 42; A primer set consisting of SEQ ID NOs: 63 and 64; A primer set consisting of SEQ ID NOs: 65 and 66; A primer set consisting of SEQ ID NOs: 67 and 68; A primer set consisting of SEQ ID NOs: 69 and 70; A primer set consisting of SEQ ID NOs: 71 and 72; A primer set consisting of SEQ ID NOs: 73 and 74; A primer set consisting of SEQ ID NOs: 75 and 76; A primer set consisting of SEQ ID NOs: 77 and 78; A primer set consisting of SEQ ID NOs: 79 and 80; A primer set consisting of SEQ ID NOs: 81 and 82; A primer set consisting of SEQ ID NOs: 85 and 86; A primer set consisting of SEQ ID NOs: 87 and 88; A primer set consisting of SEQ ID NOs: 91 and 92; A primer set consisting of SEQ ID NOs: 93 and 94; A primer set consisting of SEQ ID NOs: 95 and 96; A primer set consisting of SEQ ID NOs: 97 and 98; A primer set consisting of SEQ ID NOs: 101 and 102; A primer set consisting of SEQ ID NOs: 121 and 122; And any one or more primer sets selected from the group consisting of a primer set consisting of SEQ ID NOs: 127 and 128 are further added. Can include.

상기 프라이머 세트는 본 발명의 상세한 설명의 표 1에 표시된 재배종 토마토 판별을 위한 삽입-결실(Indel) 마커를 증폭시키기 위한 프라이머 세트에 해당한다.The primer set corresponds to a primer set for amplifying an indel marker for discriminating cultivar tomatoes shown in Table 1 of the detailed description of the present invention.

본 발명에서 용어, "삽입-결실 마커" 또는 "Indel(Insertion/deletion) 마커"는 DNA의 염기서열에서 일부 염기가 중간에 삽입되거나(insertion) 결실된(deletion) 변이를 총칭한다. 상기 Indel 마커는 표준유전체와 실험에 사용된 품종의 유전체 정보를 비교 분석하는 방법을 통해 표준유전체보다 삽입(insertion) 또는 결실(deletion)된 영역을 탐색하고 그 정보를 바탕으로 프라이머를 제작한다. 따라서 그 증폭 결과는 표준유전체와 비교하여 밴드크기가 큰 경우(insertion)와 작은 경우(deletion)의 두 종류 타입을 나타낼 수 있다.In the present invention, the term "insertion-deletion marker" or "Indel (Insertion/deletion) marker" refers to a mutation in which some bases are inserted or deleted in the nucleotide sequence of DNA. The Indel marker searches for an insertion or deletion region than the standard genome through a method of comparing and analyzing the genome information of the standard genome and the variety used in the experiment, and a primer is prepared based on the information. Therefore, the amplification result can show two types of band sizes: large (insertion) and small (deletion) band size compared to the standard genome.

본 발명에서 용어. "표준유전체"는 본 발명의 재배종 토마토 또는 변이된 왜성 토마토를 판별함에 있어 기준이 되는 야생종 토마토 유전체를 의미한다.Terms in the present invention. The "standard genome" refers to a wild-type tomato genome that is a reference in determining the cultivated tomato or mutated dwarf tomato of the present invention.

본 발명에서 용어, "프라이머(primer)"는 짧은 자유 3' 말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 주형(template)와 염기쌍(base pair)을 형성할 수 있고 주형의 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용해야 하며, 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도(complexity)뿐만 아니라, 온도 및 이온 강도와 같은 이용 조건에 의존할 것이다. 구체적 예로, 프라이머의 구체적인 길이 및 서열은 구아닌 및 시토신의 함량(GC contents), GC배열, 어닐링(annealing) 온도 및 이온 강도 등 여러 조건을 고려하여 결정해야 한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트(dNTPs)의 존재 하에서 DNA 합성을 개시할 수 있다.In the present invention, the term "primer" is a nucleic acid sequence having a short free 3'terminal hydroxyl group, which can form a complementary template and a base pair, and copy the template. It refers to a short nucleic acid sequence that functions as a starting point for. The length and sequence of the primers should allow the synthesis of the extension product to begin, and the specific length and sequence of the primers depend not only on the complexity of the required DNA or RNA target, but also on the conditions of use such as temperature and ionic strength. something to do. As a specific example, the specific length and sequence of the primer should be determined in consideration of various conditions such as guanine and cytosine content (GC contents), GC sequence, annealing temperature and ionic strength. Primers can initiate DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates (dNTPs) at an appropriate buffer and temperature.

본 발명에서, 상기 프라이머 세트는, 표적 서열의 증폭을 위하여 사용될 수 있으며, 바람직하게는 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum) 판별을 위한 삽입-결실(Indel) 마커의 증폭을 위하여 사용될 수 있다.
In the present invention, the primer set may be used for amplification of the target sequence, and preferably, it may be used for amplification of an indel marker for discrimination of cultivar tomato Solanum lycopersicum. .

본 발명의 구체적인 실시예에서, 본 발명자들은 솔라눔 핌피넬리포리움(Solanum pimpinellifolium (LA1584), S. pimpinellifolium (LA1584)) 및 재배종 토마토인 솔라눔 리코퍼시쿰(Solanum lycopersicum (cv Heinz 1706), S. lycopersicum (cv Heinz 1706))의 유전자 염기서열을 비교하여 12개의 토마토 염색체 각각에서 5개의 삽입-결실(Indel) 부위를 선별하고 표 1에 나타낸 바와 같이 상기 Indel 부위를 증폭하기 위한 64개의 프라이머 세트를 제작하였다.In a particular embodiment of the present invention, the inventors solar num pimpi Marinelli Four Solarium (Solanum pimpinellifolium (LA1584), S. pimpinellifolium (LA1584)) and the cultivar Solanum lycopersicum (Solanum lycopersicum (cv Heinz 1706), S. lycopersicum (cv Heinz 1706)) by comparing the gene sequence of each of the 12 tomato chromosomes, 5 indel sites were selected, and the Indel site as shown in Table 1 A set of 64 primers were prepared to amplify.

또한, 상기 제작한 프라이머 세트 중 43개의 프라이머 세트를 이용하여 야생종 토마토 S. pimpinellifolium 및 재배종 토마토 S. lycopersicum cv M82를 판별할 수 있음을 확인하였다(표 4). In addition, wild tomato S. pimpinellifolium and cultivar tomato S. lycopersicum were used using 43 primer sets among the prepared primer sets. It was confirmed that cv M82 can be discriminated (Table 4).

따라서, 본 발명의 프라이머 세트를 야생종 토마토 S. pimpinellifolium와 재배종 토마토 S. lycopersicum를 판별하기 위한 Indel 마커 프라이머 세트로 이용할 수 있다.
Therefore, the primer set of the present invention can be used as an Indel marker primer set for discriminating wild tomato S. pimpinellifolium and cultivar tomato S. lycopersicum.

또한, 본 발명은 In addition, the present invention

1) 대상 시료에서 게놈 DNA를 분리하는 단계;1) separating genomic DNA from the target sample;

2) 상기 단계 1)에서 분리한 게놈 DNA를 주형으로 하고, 서열번호 13 및 14로 이루어진 프라이머 세트; 서열번호 15 및 16으로 이루어진 프라이머 세트; 서열번호 21 및 22로 이루어진 프라이머 세트; 서열번호 27 및 28로 이루어진 프라이머 세트; 서열번호 39 및 40으로 이루어진 프라이머 세트; 서열번호 43 및 44로 이루어진 프라이머 세트; 서열번호 53 및 54로 이루어진 프라이머 세트; 서열번호 55 및 56으로 이루어진 프라이머 세트; 서열번호 57 및 58로 이루어진 프라이머 세트; 서열번호 59 및 60으로 이루어진 프라이머 세트; 서열번호 61 및 62로 이루어진 프라이머 세트; 서열번호 119 및 120으로 이루어진 프라이머 세트; 서열번호 123 및 124로 이루어진 프라이머 세트; 및 서열번호 125 및 126으로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및2) Using the genomic DNA isolated in step 1) as a template, a primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOs: 15 and 16; A primer set consisting of SEQ ID NOs: 21 and 22; A primer set consisting of SEQ ID NOs: 27 and 28; A primer set consisting of SEQ ID NOs: 39 and 40; A primer set consisting of SEQ ID NOs: 43 and 44; A primer set consisting of SEQ ID NOs: 53 and 54; A primer set consisting of SEQ ID NOs: 55 and 56; A primer set consisting of SEQ ID NOs: 57 and 58; A primer set consisting of SEQ ID NOs: 59 and 60; A primer set consisting of SEQ ID NOs: 61 and 62; A primer set consisting of SEQ ID NOs: 119 and 120; A primer set consisting of SEQ ID NOs: 123 and 124; And performing an amplification reaction using one or more primer sets selected from the group consisting of a primer set consisting of SEQ ID NOs: 125 and 126 to amplify a target sequence. And

3) 상기 단계 2)에서 증폭한 산물을 검출하는 단계를 포함하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하는 방법을 제공한다. 3) Wild tomato Solanum Pimpinelliforium (Solanum) comprising the step of detecting the product amplified in step 2). pimpinellifolium ) and cultivar tomato Solanum lycopersicum (Solanum lycopersicum) to provide a method for determining.

본 발명의 방법에 있어서, 상기 단계 1)은 대상 시료에서 게놈 DNA를 분리하는 단계로, 상기 대상 시료는 품종을 판별하기 위한 토마토라면 제한 없이 사용할 수 있다.In the method of the present invention, step 1) is a step of separating genomic DNA from a target sample, and the target sample may be used without limitation if it is a tomato for determining a variety.

상기 게놈 DNA의 추출은 당업계에 공지된 통상적인 방법에 의해 수행할 수 있으며, 예를 들어, 페놀/클로로포름 추출법, SDS 추출법 (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB 분리법(Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980), 또는 상업적으로 판매되는 DNA 추출 키트를 이용하여 수행할 수 있으나, 이에 제한되지 않는다.Extraction of the genomic DNA can be performed by conventional methods known in the art, for example, phenol/chloroform extraction method, SDS extraction method (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303 , 1990), CTAB separation (Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980), or a commercially available DNA extraction kit, but is not limited thereto.

본 발명의 방법에 있어서, 상기 단계 2)는 판별하고자 하는 토마토의 게놈 DNA에 대하여 상기 프라이머 세트를 사용하여 표적 서열을 증폭시키는 단계로, 상기 "표적 서열"은 변이 영역에 특이적인 Indel 마커를 의미한다.In the method of the present invention, step 2) is a step of amplifying a target sequence using the primer set with respect to the genomic DNA of a tomato to be identified, and the "target sequence" refers to an Indel marker specific to the mutant region. do.

상기 단계 2)에서 증폭 반응은 중합효소연쇄반응(PCR), 리가아제 연쇄반응(ligase chain reaction), 핵산 서열 기재 증폭(nucleic acid sequence-based amplification), 전사 기재 증폭 시스템(transcription-based amplification system), 가닥 치환 증폭(strand displacement amplification) 및 Qβ 복제효소(replicase)를 통한 증폭 또는 당업계에 알려진 핵산 분자를 증폭하기 위한 적당한 방법을 제한 없이 사용할 수 있다.
The amplification reaction in step 2) is a polymerase chain reaction (PCR), a ligase chain reaction, a nucleic acid sequence-based amplification, and a transcription-based amplification system. , Strand displacement amplification and amplification through Qβ replicating enzyme (replicase) or any suitable method for amplifying nucleic acid molecules known in the art may be used without limitation.

본 발명의 방법에 있어서, 상기 솔라눔 리코퍼시쿰을 판별하기 위하여, 상기 단계 2)에서 서열번호 1 및 2로 이루어진 프라이머 세트; 서열번호 3 및 4로 이루어진 프라이머 세트; 서열번호 5 및 6으로 이루어진 프라이머 세트; 서열번호 7 및 8로 이루어진 프라이머 세트; 서열번호 9 및 10으로 이루어진 프라이머 세트; 서열번호 17 및 18로 이루어진 프라이머 세트; 서열번호 23 및 24로 이루어진 프라이머 세트; 서열번호 25 및 26으로 이루어진 프라이머 세트; 서열번호 31 및 32로 이루어진 프라이머 세트; 서열번호 41 및 42로 이루어진 프라이머 세트; 서열번호 63 및 64로 이루어진 프라이머 세트; 서열번호 65 및 66으로 이루어진 프라이머 세트; 서열번호 67 및 68로 이루어진 프라이머 세트; 서열번호 69 및 70으로 이루어진 프라이머 세트; 서열번호 71 및 72로 이루어진 프라이머 세트; 서열번호 73 및 74로 이루어진 프라이머 세트; 서열번호 75 및 76으로 이루어진 프라이머 세트; 서열번호 77 및 78로 이루어진 프라이머 세트; 서열번호 79 및 80으로 이루어진 프라이머 세트; 서열번호 81 및 82로 이루어진 프라이머 세트; 서열번호 85 및 86으로 이루어진 프라이머 세트; 서열번호 87 및 88로 이루어진 프라이머 세트; 서열번호 91 및 92로 이루어진 프라이머 세트; 서열번호 93 및 94로 이루어진 프라이머 세트; 서열번호 95 및 96으로 이루어진 프라이머 세트; 서열번호 97 및 98로 이루어진 프라이머 세트; 서열번호 101 및 102로 이루어진 프라이머 세트; 서열번호 121 및 122로 이루어진 프라이머 세트; 및 서열번호 127 및 128로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 추가적으로 이용하여 증폭 반응을 수행하여 표적 서열을 증폭할 수 있다.
In the method of the present invention, in order to determine the solanum lycopersicum, a primer set consisting of SEQ ID NOs: 1 and 2 in step 2); A primer set consisting of SEQ ID NOs: 3 and 4; A primer set consisting of SEQ ID NOs: 5 and 6; A primer set consisting of SEQ ID NOs: 7 and 8; A primer set consisting of SEQ ID NOs: 9 and 10; A primer set consisting of SEQ ID NOs: 17 and 18; A primer set consisting of SEQ ID NOs: 23 and 24; A primer set consisting of SEQ ID NOs: 25 and 26; A primer set consisting of SEQ ID NOs: 31 and 32; A primer set consisting of SEQ ID NOs: 41 and 42; A primer set consisting of SEQ ID NOs: 63 and 64; A primer set consisting of SEQ ID NOs: 65 and 66; A primer set consisting of SEQ ID NOs: 67 and 68; A primer set consisting of SEQ ID NOs: 69 and 70; A primer set consisting of SEQ ID NOs: 71 and 72; A primer set consisting of SEQ ID NOs: 73 and 74; A primer set consisting of SEQ ID NOs: 75 and 76; A primer set consisting of SEQ ID NOs: 77 and 78; A primer set consisting of SEQ ID NOs: 79 and 80; A primer set consisting of SEQ ID NOs: 81 and 82; A primer set consisting of SEQ ID NOs: 85 and 86; A primer set consisting of SEQ ID NOs: 87 and 88; A primer set consisting of SEQ ID NOs: 91 and 92; A primer set consisting of SEQ ID NOs: 93 and 94; A primer set consisting of SEQ ID NOs: 95 and 96; A primer set consisting of SEQ ID NOs: 97 and 98; A primer set consisting of SEQ ID NOs: 101 and 102; A primer set consisting of SEQ ID NOs: 121 and 122; And by additionally using any one or more primer sets selected from the group consisting of a primer set consisting of SEQ ID NOs: 127 and 128, the target sequence may be amplified by performing an amplification reaction.

본 발명의 방법에 있어서, 상기 단계 3)은 상기 증폭한 산물을 검출 및 분석하는 단계로, 상기 증폭한 산물의 분석은 DNA 칩, 전기영동, 방사성 측정, 형광 측정 또는 인광 측정 방법으로 수행될 수 있으나, 이에 제한되지 않는다. 증폭 산물을 검출하는 방법 중의 하나로서, 모세관 전기영동을 수행할 수 있다. 모세관 전기영동은 예를 들면, ABi Sequencer를 이용할 수 있다. 또한, 겔 전기영동을 수행할 수 있으며, 겔 전기영동은 증폭 산물의 크기에 따라 아가로스 겔 전기영동 또는 아크릴아미드 겔 전기영동을 이용할 수 있다. 또한, 형광 측정 방법은 프라이머의 5'-말단에 Cy-5 또는 Cy-3를 표지하여 PCR을 수행하면 표적 서열이 검출 가능한 형광 표지 물질로 표지되며, 이렇게 표지된 형광은 형광 측정기를 이용하여 측정할 수 있다. 또한, 방사성 측정 방법은 PCR 수행 시 32P 또는 35S 등과 같은 방사성 동위원소를 PCR 반응액에 첨가하여 증폭 산물을 표지한 후, 방사성 측정기구, 예를 들면, 가이거 계수기(Geiger counter) 또는 액체섬광계수기(liquid scintillation counter)를 이용하여 방사성을 측정할 수 있다. 또한, 은염색 키트(Bioneer, Daejeon, Korea)를 사용하여 가시화될 수 있다.
In the method of the present invention, step 3) is a step of detecting and analyzing the amplified product, and the analysis of the amplified product may be performed by a DNA chip, electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement method. However, it is not limited thereto. As one of the methods for detecting amplification products, capillary electrophoresis may be performed. For capillary electrophoresis, for example, an ABi sequencer can be used. In addition, gel electrophoresis may be performed, and gel electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplified product. In addition, when performing PCR by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the fluorescence measurement method is labeled with a detectable fluorescent labeling material, and the thus labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactivity measurement method includes labeling the amplified product by adding a radioactive isotope such as 32 P or 35 S to the PCR reaction solution when performing PCR, and then using a radioactivity measuring instrument such as a Geiger counter or liquid scintillation. Radioactivity can be measured using a liquid scintillation counter. In addition, it can be visualized using a silver dyeing kit (Bioneer, Daejeon, Korea).

또한, 본 발명은 서열번호 13 및 14로 이루어진 프라이머 세트; 서열번호 15 및 16으로 이루어진 프라이머 세트; 서열번호 21 및 22로 이루어진 프라이머 세트; 서열번호 27 및 28로 이루어진 프라이머 세트; 서열번호 39 및 40으로 이루어진 프라이머 세트; 서열번호 43 및 44로 이루어진 프라이머 세트; 서열번호 53 및 54로 이루어진 프라이머 세트; 서열번호 55 및 56으로 이루어진 프라이머 세트; 서열번호 57 및 58로 이루어진 프라이머 세트; 서열번호 59 및 60으로 이루어진 프라이머 세트; 서열번호 61 및 62로 이루어진 프라이머 세트; 서열번호 119 및 120으로 이루어진 프라이머 세트; 서열번호 123 및 124로 이루어진 프라이머 세트; 및 서열번호 125 및 126으로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 포함하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하기 위한 키트를 제공한다.In addition, the present invention is a primer set consisting of SEQ ID NOs: 13 and 14; A primer set consisting of SEQ ID NOs: 15 and 16; A primer set consisting of SEQ ID NOs: 21 and 22; A primer set consisting of SEQ ID NOs: 27 and 28; A primer set consisting of SEQ ID NOs: 39 and 40; A primer set consisting of SEQ ID NOs: 43 and 44; A primer set consisting of SEQ ID NOs: 53 and 54; A primer set consisting of SEQ ID NOs: 55 and 56; A primer set consisting of SEQ ID NOs: 57 and 58; A primer set consisting of SEQ ID NOs: 59 and 60; A primer set consisting of SEQ ID NOs: 61 and 62; A primer set consisting of SEQ ID NOs: 119 and 120; A primer set consisting of SEQ ID NOs: 123 and 124; And SEQ ID NO: 125 and 126 comprising any one or more primer sets selected from the group consisting of a primer set, wild species tomato solanum pimpinellifolium (Solanum pimpinellifolium) and cultivar tomato solanum lycopersicum (Solanum lycopersicum ) discrimination Kits are provided for doing this.

본 발명에서, 상기 솔라눔 리코퍼시쿰을 판별하기 위하여, 서열번호 1 및 2로 이루어진 프라이머 세트; 서열번호 3 및 4로 이루어진 프라이머 세트; 서열번호 5 및 6으로 이루어진 프라이머 세트; 서열번호 7 및 8로 이루어진 프라이머 세트; 서열번호 9 및 10으로 이루어진 프라이머 세트; 서열번호 17 및 18로 이루어진 프라이머 세트; 서열번호 23 및 24로 이루어진 프라이머 세트; 서열번호 25 및 26으로 이루어진 프라이머 세트; 서열번호 31 및 32로 이루어진 프라이머 세트; 서열번호 41 및 42로 이루어진 프라이머 세트; 서열번호 63 및 64로 이루어진 프라이머 세트; 서열번호 65 및 66으로 이루어진 프라이머 세트; 서열번호 67 및 68로 이루어진 프라이머 세트; 서열번호 69 및 70으로 이루어진 프라이머 세트; 서열번호 71 및 72로 이루어진 프라이머 세트; 서열번호 73 및 74로 이루어진 프라이머 세트; 서열번호 75 및 76으로 이루어진 프라이머 세트; 서열번호 77 및 78로 이루어진 프라이머 세트; 서열번호 79 및 80으로 이루어진 프라이머 세트; 서열번호 81 및 82로 이루어진 프라이머 세트; 서열번호 85 및 86으로 이루어진 프라이머 세트; 서열번호 87 및 88로 이루어진 프라이머 세트; 서열번호 91 및 92로 이루어진 프라이머 세트; 서열번호 93 및 94로 이루어진 프라이머 세트; 서열번호 95 및 96으로 이루어진 프라이머 세트; 서열번호 97 및 98로 이루어진 프라이머 세트; 서열번호 101 및 102로 이루어진 프라이머 세트; 서열번호 121 및 122로 이루어진 프라이머 세트; 및 서열번호 127 및 128로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 추가로 포함할 수 있다.In the present invention, in order to determine the solanum lycopersicum, a primer set consisting of SEQ ID NOs: 1 and 2; A primer set consisting of SEQ ID NOs: 3 and 4; A primer set consisting of SEQ ID NOs: 5 and 6; A primer set consisting of SEQ ID NOs: 7 and 8; A primer set consisting of SEQ ID NOs: 9 and 10; A primer set consisting of SEQ ID NOs: 17 and 18; A primer set consisting of SEQ ID NOs: 23 and 24; A primer set consisting of SEQ ID NOs: 25 and 26; A primer set consisting of SEQ ID NOs: 31 and 32; A primer set consisting of SEQ ID NOs: 41 and 42; A primer set consisting of SEQ ID NOs: 63 and 64; A primer set consisting of SEQ ID NOs: 65 and 66; A primer set consisting of SEQ ID NOs: 67 and 68; A primer set consisting of SEQ ID NOs: 69 and 70; A primer set consisting of SEQ ID NOs: 71 and 72; A primer set consisting of SEQ ID NOs: 73 and 74; A primer set consisting of SEQ ID NOs: 75 and 76; A primer set consisting of SEQ ID NOs: 77 and 78; A primer set consisting of SEQ ID NOs: 79 and 80; A primer set consisting of SEQ ID NOs: 81 and 82; A primer set consisting of SEQ ID NOs: 85 and 86; A primer set consisting of SEQ ID NOs: 87 and 88; A primer set consisting of SEQ ID NOs: 91 and 92; A primer set consisting of SEQ ID NOs: 93 and 94; A primer set consisting of SEQ ID NOs: 95 and 96; A primer set consisting of SEQ ID NOs: 97 and 98; A primer set consisting of SEQ ID NOs: 101 and 102; A primer set consisting of SEQ ID NOs: 121 and 122; And any one or more primer sets selected from the group consisting of a primer set consisting of SEQ ID NOs: 127 and 128 are further added. Can include.

본 발명에서, 상기 키트에는 증폭 반응을 수행하기 위한 시약 및 필요에 따라 제한효소를 포함할 수 있으며, 상기 증폭 반응을 수행하기 위한 시약은 DNA 중합효소, dNTPs 및 반응완충액을 포함할 수 있다. 또한, 본 발명의 키트는 최적의 반응 수행 조건을 기재한 사용자 설명서를 추가로 포함할 수 있다.
In the present invention, the kit may include a reagent for performing the amplification reaction and a restriction enzyme as necessary, and the reagent for performing the amplification reaction may include a DNA polymerase, dNTPs, and a reaction buffer. In addition, the kit of the present invention may further include a user's manual describing the optimum reaction performance conditions.

이하, 본 발명을 실시예 및 실험예에 의해 상세히 설명한다.Hereinafter, the present invention will be described in detail by examples and experimental examples.

단, 하기 실시예 및 실험예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예 및 실험예에 한정되는 것은 아니다.
However, the following Examples and Experimental Examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following Examples and Experimental Examples.

<< 실시예Example 1> 야생종 토마토 및 1> wild tomatoes and 재배종Cultivar 토마토 판별용For tomato identification 삽입-결실( Insertion-deletion ( IndelIndel ) ) 마커Marker 선별 Selection

본 발명의 마커 선별을 위하여, 야생종 토마토인 솔라눔 핌피넬리포리움 LA1584(Solanum pimpinellifolium LA1584, S. pimpinellifolium LA1584) 및 재배종 토마토인 솔라눔 리코퍼시쿰 cv Heinz 1706(Solanum lycopersicum cv Heinz 1706, S. lycopersicum cv Heinz 1706)의 유전자 염기서열을 비교하여 12개의 토마토 염색체 각각에서 5개의 삽입-결실(Indel) 부위를 선별하고 상기 Indel 부위를 증폭하기 위한 프라이머를 제작하였다.For the selection of the markers of the present invention, the wild-type tomato Solanum pimpinellifolium LA1584 (S. pimpinellifolium LA1584) and the cultivar Solanum lycopersicum cv Heinz 1706 (Solanum lycopersicum cv Heinz 1706, S. lycopersicum cv Heinz 1706) by comparing the gene sequences of each of the 12 tomato chromosomes, 5 indel sites were selected, and primers for amplifying the Indel site were prepared.

구체적으로, 기존에 구축된 데이터베이스(https://solgenomics.net/organism/Solanum_lycopersicum/tomato_150)로부터 제공되는 재배종 토마토와 야생종 토마토의 유전체 염기서열로서 S. lycopersicum cv Heinz 1706 유전체 염기서열과 S. pimpinellifolium LA1584 유전체 염기서열 비교정보상에 나타나는 Indel 위치정보(ftp://ftp.solgenomics.net/genomes/tomato_150/)들을 이용하여 12개의 토마토 염색체에서 Indel 위치를 확인하였으며 데이터베이스상에서 유추되는 삽입 또는 결실 염기쌍의 길이를 크기별로 분류하였고, 염색체 위치별 Indel 사이즈가 25염기쌍 이상되는 것을 선별하였다. 그리고 Indel 위치 위아래 염기서열의 150염기쌍 이내에 프라이머를 제작하였다. 도 1에 나타낸 바와 같이 적절한 간격을 두고 각 염색체에서 5개의 Indel 마커를 선별하였다. 또한, 상기 선별한 Indel 마커 부위를 증폭할 수 있는 프라이머 제작하여 하기 표 1에 나타내었다.
 Specifically, S. lycopersicum cv Heinz 1706 genome sequence and S. pimpinellifolium LA1584 as the genome sequence of cultivated tomato and wild tomato provided from the previously established database (https://solgenomics.net/organism/Solanum_lycopersicum/tomato_150). Indel location information (ftp://ftp.solgenomics.net/genomes/tomato_150/) shown on the genome sequence comparison information was used to identify the location of Indel in 12 tomato chromosomes, and the length of the insertion or deletion base pair inferred in the database. They were classified by size, and those with an Indel size of 25 base pairs or more by chromosome location were selected. And primers were prepared within 150 base pairs of base sequences above and below the Indel position. As shown in Fig. 1, five Indel markers were selected from each chromosome at appropriate intervals. In addition, primers capable of amplifying the selected Indel marker region were prepared and shown in Table 1 below.

Chromo-
some
locationChromo-
some
location Forward primer
(5'→3')
Forward primer
(5'→3')
 서열번호Sequence number Reverse primer
(5'→3')
Reverse primer
(5'→3')
 서열번호Sequence number InDel
size (bp)InDel
size (bp) 1번 염색체Chromosome 1 1-16Mb1-16Mb CCTCTTTGTGACTCGTTATCCACCTCTTTGTGACTCGTTATCCA 1One CCCGCAGACACAGTGATTAGCCCGCAGACACAGTGATTAG 22 29 -29- 1-32Mb1-32Mb TGCAACATAGGGTTCTGCTGTGCAACATAGGGTTCTGCTG 33 TGATAGCAATGGCGTTCAAGTGATAGCAATGGCGTTCAAG 44 70 +70+ 1-49Mb1-49Mb GAGTTCAAACTTCAATGGAGTCGAGTTCAAACTTCAATGGAGTC 55 CCCCGTAATTATGTGGTCGTCCCCGTAATTATGTGGTCGT 66 40 +40+ 1-64Mb1-64Mb CGATAGCCATGAAAAAGCAACGATAGCCATGAAAAAGCAA 77 TGAGGTGAAGGTCCAATGTGTGAGGTGAAGGTCCAATGTG 88 35 -35- 1-82Mb1-82Mb GGCATTGAATGGTGACCCTAGGCATTGAATGGTGACCCTA 99 TGCAAAACGGTCTAATCACGTGCAAAACGGTCTAATCACG 1010 34 -34- 2번 염색체Chromosome 2 2-3Mb2-3Mb CAAGACAGACGGTCAGACGACAAGACAGACGGTCAGACGA 1111 GTGTGTTGCCAAAGGGCTATGTGTGTTGCCAAAGGGCTAT 1212 53 +53 + 2-15Mb2-15Mb GCTCCCATCAGAGATGCAATGCTCCCATCAGAGATGCAAT 1313 AGCTTCCATGCCTGGAGTTAAGCTTCCATGCCTGGAGTTA 1414 45 +45+ 2-25Mb2-25Mb AACGACGTGTTCCAGTGTCAAACGACGTGTTCCAGTGTCA 1515 CTTGGACGATGTCACCTGACCTTGGACGATGTCACCTGAC 1616 48 +48 + 2-33Mb2-33Mb TCAAACCCCGATTTGAGATTTCAAACCCCGATTTGAGATT 1717 GGTTAGGTATGGTCTTGGATCGGGTTAGGTATGGTCTTGGATCG 1818 55 or 18 +55 or 18 + 2-41Mb2-41Mb GATCCCACACGCATACACACGATCCCACACGCATACACAC 1919 TCAAAAGTCCCACATTGGTGTCAAAAGTCCCACATTGGTG 2020 26 -26- 3번 염색체Chromosome 3 3-11Mb3-11Mb CTGCTCACTTGGAGACCTGACTGCTCACTTGGAGACCTGA 2121 GAACCCTTCCAATGTGATGCGAACCCTTCCAATGTGATGC 2222 36 -36- 3-23Mb3-23Mb ATGACGCCATCCCTTCCTATATGACGCCATCCCTTCCTAT 2323 GGGACGACCATGAGTTCAGAGGGACGACCATGAGTTCAGA 2424 33 -33- 3-35Mb3-35Mb TTTCCCCCTCTCCCTAGTGTTTTCCCCCTCTCCCTAGTGT 2525 ATTCGCCAAGCTTGTTTTTGATTCGCCAAGCTTGTTTTTG 2626 34 -34- 3-47Mb3-47Mb TTTTTGAACCATGCCAAAGGTTTTTGAACCATGCCAAAGG 2727 GGCATATCGACATTGGCTTTGGCATATCGACATTGGCTTT 2828 35 +35+ 3-58Mb3-58Mb AAAGCCTTTCACGACATTGAAAAGCCTTTCACGACATTGA 2929 CGAACAACCCCGAGAGTAAACGAACAACCCCGAGAGTAAA 3030 42 -42- 4번 염색체Chromosome 4 4-7Mb4-7Mb TCAAAATAGGAATAAAGCTGATGATCAAAATAGGAATAAAGCTGATGA 3131 CCTAACAACGATCGGTGAGGCCTAACAACGATCGGTGAGG 3232 58 -58- 4-23Mb4-23Mb TGACTACATGGTTTATGGAGACTTGTGACTACATGGTTTATGGAGACTTG 3333 GAAAGGGAACGTTGATTCCAGAAAGGGAACGTTGATTCCA 3434 40 -40- 4-31Mb4-31Mb AAGGCCCCGTTTAATTTTTGAAGGCCCCGTTTAATTTTTG 3535 CATGTTCCGATCATCCCACTCATGTTCCGATCATCCCACT 3636 28 +28 + 4-44Mb4-44Mb AATCCCCATGCAAGAAAAGAAATCCCCATGCAAGAAAAGA 3737 AGGATTAGGCCATGGGATTTAGGATTAGGCCATGGGATTT 3838 66 -66- 4-56Mb4-56Mb GGAGCACGTGAGACTTTTGCGGAGCACGTGAGACTTTTGC 3939 GCACTGCAGTTTTCTCTTGCTGCACTGCAGTTTTCTCTTGCT 4040 69 -69- 5번 염색체Chromosome 5 5-5Mb5-5Mb TGAGCTTCCTAGGACTTGAAGGGATGAGCTTCCTAGGACTTGAAGGGA 4141 TCCATTTTCACATGCTACTCCAACATCCATTTTCACATGCTACTCCAACA 4242 80 -80- 5-24Mb5-24Mb CGAATCGCAATTGAGCCAAACGAATCGCAATTGAGCCAAA 4343 TGACGATCTTATATGCGGTAGGATGACGATCTTATATGCGGTAGGA 4444 60 -60- 5-29Mb5-29Mb TTTGTTCAAGCAGCCAGATGTTTGTTCAAGCAGCCAGATG 4545 GACACAAGTAGCACTGCAAACAGACACAAGTAGCACTGCAAACA 4646 33 +33 + 5-35Mb5-35Mb TGCATGGAGGGTGTGTTCTTGTCCTGCATGGAGGGTGTGTTCTTGTCC 4747 TGAGCTATGAATGTTGAGGCTTGAGCTATGAATGTTGAGGCT 4848 78 +78 + 5-47Mb5-47Mb AAACATTTGGGTACGACTCGCCAAAACATTTGGGTACGACTCGCCA 4949 GACATCCCAACCCACGCCCCGACATCCCAACCCACGCCCC 5050 62 -62- 5-48Mb5-48Mb TGTTGGGCGGAATAACTCTTTGTTGGGCGGAATAACTCTT 5151 CAAATAGGACTTATCTAGGGACCAAATAGGACTTATCTAGGGAC 5252 50 +50+ 5-61Mb5-61Mb TCAAGAGAACATTCTCCTCCGTTCAAGAGAACATTCTCCTCCGT 5353 TTAGATGAGTTTGATGTGATCTTTTTTAGATGAGTTTGATGTGATCTTTT 5454 85 -85- 6번 염색체Chromosome 6 6-9Mb6-9Mb GAAAACGGGGTTAGCACTCAGAAAACGGGGTTAGCACTCA 5555 TCATGGTTTCAAGTGTGTTGGTCATGGTTTCAAGTGTGTTGG 5656 43 -43- 6-16Mb6-16Mb CCTTGGTTTCCTTGACCTTGCCTTGGTTTCCTTGACCTTG 5757 ACATGCGTGAGGAGAGGACTACATGCGTGAGGAGAGGACT 5858 32 +32+ 6-26Mb6-26Mb CATTTCGGTAATCCATGCAACATTTCGGTAATCCATGCAA 5959 TTGAACCAACCAATGCAAGATTGAACCAACCAATGCAAGA 6060 44 -44- 6-33Mb6-33Mb ATATCCTTGGCCTGTGCATCATATCCTTGGCCTGTGCATC 6161 TCTTCAGTTTTTCCCCCAGATCTTCAGTTTTTCCCCCAGA 6262 67 +67 + 6-41Mb6-41Mb CTATGTTGCTCGGGCTCTTCCTATGTTGCTCGGGCTCTTC 6363 CAGAAGTGCCAGAAGGGATTCAGAAGTGCCAGAAGGGATT 6464 66 +66 + 7번 염색체Chromosome 7 7-11Mb7-11Mb CGCTAAGACCAAAAGCATCCCGCTAAGACCAAAAGCATCC 6565 GGCAACCAAAGGAGAACATCGGCAACCAAAGGAGAACATC 6666 31 -31- 7-22Mb7-22Mb TATTACCCCCGAAACAATCGTATTACCCCCGAAACAATCG 6767 GGGAGGTCGAGTTGTGGTAAGGGAGGTCGAGTTGTGGTAA 6868 64 +64 + 7-34Mb7-34Mb TCCCTCCTTACCACTCGAAATCCCTCCTTACCACTCGAAA 6969 CCTTATGCTCGAGCTCTGCTCCTTATGCTCGAGCTCTGCT 7070 59 +59 + 7-45Mb7-45Mb ATTCCCATCTGAGGCACTGTATTCCCATCTGAGGCACTGT 7171 ATGCACCGTGGAACTCTAGCATGCACCGTGGAACTCTAGC 7272 38 +38 + 7-56Mb7-56Mb GGACCATTGTTGGACTTTGGGGACCATTGTTGGACTTTGG 7373 AAACAATAAAGCGCGACGATAAACAATAAAGCGCGACGAT 7474 42 -42- 8번 염색체Chromosome 8 8-10Mb8-10Mb AAGGCAAGGGCATTAAGAGGAAGGCAAGGGCATTAAGAGG 7575 GGCAAACTAAATCGCCAAGTGGCAAACTAAATCGCCAAGT 7676 49 +49 + 8-21Mb8-21Mb TCAAATGAAGAAGCGAGCACTCAAATGAAGAAGCGAGCAC 7777 ATCGGCCTTCTTCAAAATCCATCGGCCTTCTTCAAAATCC 7878 75 +75 + 8-33Mb8-33Mb TCATTTAACCGAGCCTATGAGTCATTTAACCGAGCCTATGAG 7979 TGGCTTTGCGAAGTGATTCTTGGCTTTGCGAAGTGATTCT 8080 47 +47 + 8-42Mb8-42Mb GCAAAATGCAGAAGGAGCTAGCAAAATGCAGAAGGAGCTA 8181 GTCATGATCCGGGGAAACTAGTCATGATCCGGGGAAACTA 8282 49 -49- 8-55Mb8-55Mb TCACCAGTTCTCCCCTATCAATCACCAGTTCTCCCCTATCAA 8383 TCATTCTCTATTGGCTCGAGATTTCATTCTCTATTGGCTCGAGATT 8484 79 -79- 9번 염색체Chromosome 9 9-7Mb9-7Mb AACTCCCGGACTTGGTCTCTAACTCCCGGACTTGGTCTCT 8585 TTAATCATCCCCGGAATCAATTAATCATCCCCGGAATCAA 8686 32 -32- 9-18Mb9-18Mb CTTCATCGTCATGAAACACACACTTCATCGTCATGAAACACACA 8787 TTGTGAAAAATAGGGCCTCATTGTGAAAAATAGGGCCTCA 8888 42 -42- 9-31Mb9-31Mb GGCTTTTTGTGGACTATTCTGAGGCTTTTTGTGGACTATTCTGA 8989 TTGAATGTGTTTGGCCTAGGTATTGAATGTGTTTGGCCTAGGTA 9090 59 +59 + 9-41Mb9-41Mb TCAAAAATGTTAAAGACAAGCTTCATCAAAAATGTTAAAGACAAGCTTCA 9191 CCCTCCTTCATGTTTAGGAAGACCCTCCTTCATGTTTAGGAAGA 9292 30 +30+ 9-57Mb9-57Mb GGGGTTTGGGCTAAAATCATGGGGTTTGGGCTAAAATCAT 9393 ATGGAGATTTGGGAGGAGGTATGGAGATTTGGGAGGAGGT 9494 26 +26 + 10번 염색체Chromosome 10 10-9Mb10-9Mb ACGACCTCACAGACTAAGAGACGACCTCACAGACTAAGAG 9595 ACACAAGTGTGGGCGTCACAACACAAGTGTGGGCGTCACA 9696 32 +32+ 10-19Mb10-19Mb CAGACAAAGGGTTCGCTTGCAGACAAAGGGTTCGCTTG 9797 TCGGGAAGAGGAAAACTTGATCGGGAAGAGGAAAACTTGA 9898 84 -84- 10-31Mb10-31Mb CTAAAGACACCATCCTCCCCTCTAAAGACACCATCCTCCCCT 9999 GGTTGTCGAGATTGGGTGTTGGTTGTCGAGATTGGGTGTT 100100 34 -34- 10-39Mb10-39Mb GAGTCGTGGTGGAGGTCATTGAGTCGTGGTGGAGGTCATT 101101 AGTTTGGTGCCAAATCAAGGAGTTTGGTGCCAAATCAAGG 102102 18 or 25 +18 or 25 + 10-49Mb10-49Mb CCAGCAGTTGAGGGAGTGACCAGCAGTTGAGGGAGTGA 103103 GGTTGAAATGGCCAGACCTAGGTTGAAATGGCCAGACCTA 104104 37 +37 + 11번 염색체Chromosome 11 11-1Mb11-1Mb TGGGTACTCTACCTTCCATTCAATGGGTACTCTACCTTCCATTCAA 105105 TCCGGCTGCCATGGAGCAATTCCGGCTGCCATGGAGCAAT 106106 81 -81- 11-5Mb11-5Mb ACTTACGGTACTCTTTACGTAGTACTTACGGTACTCTTTACGTAGT 107107 TCATATGGCCCATTGCTCGTTCATATGGCCCATTGCTCGT 108108 72-72- 11-7Mb11-7Mb TATCACGAGCTCGGTTCAAATATCACGAGCTCGGTTCAAA 109109 GGTGGCACCTCTACAACCATGGTGGCACCTCTACAACCAT 110110 55/22/19 -55/22/19- 11-15Mb11-15Mb TTGCACAGGCTAAGCATCACTTGCACAGGCTAAGCATCAC 111111 AGTTGGGGATCATGTGGTTGAGTTGGGGATCATGTGGTTG 112112 38 +38 + 11-22Mb11-22Mb TGAATTTGGTGCTTCGTTCATGAATTTGGTGCTTCGTTCA 113113 CAGTTTTGCGCACATAGAGGCAGTTTTGCGCACATAGAGG 114114 34 -34- 11-30Mb11-30Mb TGGGCGGATATACAAAAAGGTGGGCGGATATACAAAAAGG 115115 TGCACAAAATCGAGACCAAG TGCACAAAATCGAGACCAAG 116116 72 -72- 11-37Mb11-37Mb CCTTCGATCCTTGATCTCCACCTTCGATCCTTGATCTCCA 117117 TGAGACGCACTGTAGGAGCATGAGACGCACTGTAGGAGCA 118118 51 +51 + 12번 염색체Chromosome 12 12-14Mb12-14Mb CCCCCAGCTCATACATCTCTATCCCCCCAGCTCATACATCTCTATC 119119 TTTTTAGGAGGGTTATATGCACCTGTTTTTTAGGAGGGTTATATGCACCTGT 120120 41 +41 + 12-25Mb12-25Mb CCCAACTTAACATACTTGATAGACCCAACTTAACATACTTGATAGA 121121 GTGTGCACTGGAAGTCCAAATAGTGTGCACTGGAAGTCCAAATA 122122 29 -29- 12-35Mb12-35Mb CAAATCCTCAAAACTCGTTCGCAAATCCTCAAAACTCGTTCG 123123 TGTCGATGTTAATTGGTGCTCTGTCGATGTTAATTGGTGCTC 124124 32 -32- 12-46Mb12-46Mb GCGTCAAATATCAAATGTCCACGCGTCAAATATCAAATGTCCAC 125125 ATCTACCGCATCGAATTTGCATCTACCGCATCGAATTTGC 126126 77 -77- 12-54Mb12-54Mb TGGTGAATGGTTTTGATGATGTGGTGAATGGTTTTGATGATG 127127 TGTACGTGCACTTCCTACGCTGTACGTGCACTTCCTACGC 128128 80 +80+

<< 실시예Example 2> 삽입-결실( 2> Insertion-deletion ( IndelIndel ) ) 마커를Marker 이용한 야생종 토마토 Used wild tomatoes S.S. pimpinellifoliumpimpinellifolium 및 And 재배종Cultivar 토마토 tomato S. S. lycopersicumlycopersicum 판별Discrimination

상기 <실시예 1>에서 선별한 Indel 마커를 이용하여 야생종 토마토 S. pimpinellifolium 및 재배종 토마토 S. lycopersicum을 판별할 수 있는지 알아보기 위하여, 야생종 토마토 S. pimpinellifolium 및 재배종 토마토 S. lycopersicum의 게놈 DNA(genomic DNA) 분리하고 상기 <실시예 1>에서 제조한 Indel 마커 프라이머를 이용하여 PCR을 수행하였다.In order to find out whether wild tomato S. pimpinellifolium and cultivar tomato S. lycopersicum can be discriminated using the Indel marker selected in <Example 1>, genomic DNA (genomic DNA of wild tomato S. pimpinellifolium and cultivar tomato S. lycopersicum) DNA) was isolated and PCR was performed using the Indel marker primer prepared in Example 1 above.

구체적으로, 유전형 분석(genotyping)을 위한 게놈 DNA 분리를 위하여, 야생종 토마토 S. pimpinellifolium 및 재배종 토마토 S. lycopersicum cv M82 식물체의 어린잎 2~3장을 수확한 후 액체 질소를 처리하여 동결하고 분말화하였다. 상기 어린잎 분말에 700 ㎕의 마이크로프렙 버퍼(microprep buffer)를 첨가하고 65℃에 15분간 배양하면서 5분 간격으로 혼합하였다. 그 다음, 700 ㎕의 클로로포름:이소아밀알코올(chloroform:isoamylalcohol = 24:1)을 첨가하고 1분간 혼합한 후 11,000 rpm으로 15분간 원심분리하여 상층액을 획득하였다. 분리한 상측액에 약 60% 부피의 이소프로판올(isopropanol)을 첨가하고 DNA가 응축될 때까지 혼합한 후, 13,000 rpm에서 5분간 원심분리하고 상층액을 제거하여 DNA 펠렛(pellet)를 획득하였다. 상기 획득한 DNA 펠렛을 70% 에탄올로 세척 및 건조한 후, RNaseA가 50 mg/L 첨가된 1xTE 버퍼 50 ㎕를 첨가하고 37℃에서 120분간 두어 DNA 펠렛 내 포함된 RNA를 제거하여 야생종 토마토 및 재배종 토마토 DNA 각각을 획득하였다. 그 후, 증폭 반응에 주형(template)으로 사용하기 위하여 상기 야생종 토마토 및 재배종 토마토 DNA 각각의 농도를 측정하고 약 100 ng/㎕가 되도록 희석하였다. Specifically, in order to isolate genomic DNA for genotyping, wild tomato S. pimpinellifolium and cultivar tomato S. lycopersicum After harvesting 2-3 young leaves of the cv M82 plant, they were treated with liquid nitrogen, frozen, and powdered. 700 µl of microprep buffer was added to the young leaf powder, followed by incubation at 65° C. for 15 minutes, followed by mixing at intervals of 5 minutes. Then, 700 µl of chloroform:isoamyl alcohol (chloroform:isoamylalcohol = 24:1) was added, mixed for 1 minute, and centrifuged at 11,000 rpm for 15 minutes to obtain a supernatant. About 60% volume of isopropanol was added to the separated supernatant and mixed until the DNA was condensed, followed by centrifugation at 13,000 rpm for 5 minutes, and the supernatant was removed to obtain a DNA pellet. After washing and drying the obtained DNA pellet with 70% ethanol, 50 µl of 1xTE buffer to which 50 mg/L of RNaseA was added was added and left at 37° C. for 120 minutes to remove RNA contained in the DNA pellet to remove wild tomatoes and cultivated tomatoes. Each of the DNA was obtained. Then, in order to use as a template in the amplification reaction, the concentrations of each of the wild tomato and cultivated tomato DNA were measured and diluted to about 100 ng/µl.

그 다음, Indel 마커를 증폭하기 위하여 상기 획득한 야생종 토마토 DNA (p), 재배종 토마토 DNA (c), 및 상기 야생종 토마토 DNA 및 재배종 토마토 DNA를 1:1로 혼합한 혼합물 (m) 각각을 주형으로 하여 상기 <실시예 1>에서 제조한 Indel 마커 프라이머(표 1)를 이용하여 PCR을 수행하였다. PCR을 위하여 하기 [표 2]에 기재된 반응물 조성으로 PCR 반응물을 구성하였고, 하기 [표 3]의 조건으로 PCR을 수행하여 증폭된 Indel 마커 산물을 획득하였다. 그 다음, 상기 증폭된 Indel 마커 산물은 2.5% 아가로오스 겔(agarose gel)에 로딩하고, 100V에서 50-60분간 전기영동하여 증폭 밴드를 확인하였고, 상기 증폭 밴드를 비교하여 야생종 토마토와 구분되는 재배종 토마토의 Indel 마커를 확인하여 [표 4]에 나타내었다.
Then, in order to amplify the Indel marker, the obtained wild tomato DNA (p), cultivated tomato DNA (c), and a mixture (m) of 1:1 mixture of the wild tomato DNA and cultivated tomato DNA were used as a template. Thus, PCR was performed using the Indel marker primer (Table 1) prepared in <Example 1>. For PCR, a PCR reaction product was constructed with the reaction product composition shown in the following [Table 2], and PCR was performed under the conditions of the following [Table 3] to obtain an amplified Indel marker product. Then, the amplified Indel marker product was loaded on a 2.5% agarose gel, electrophoresed at 100V for 50-60 minutes to confirm the amplification band, and the amplification band was compared to distinguish it from wild tomatoes. Indel markers of cultivated tomatoes were confirmed and shown in [Table 4].

PCR 반응물 성분PCR reactant components 함량(㎕)Content (µl) template genomic DNAtemplate genomic DNA 1 (=100 ng)1 (=100 ng) 10x PCR buffer10x PCR buffer 22 dNTP mix (2.5mM each)dNTP mix (2.5mM each) 1One Forward primerForward primer 1One Reverse primerReverse primer 1One Taq polymeraseTaq polymerase 0.20.2 pure waterpure water 13.813.8 totaltotal 2020

PCR 조건PCR conditions 95℃, 3분95℃, 3 minutes 1 cycle1 cycle 95℃, 20초95℃, 20 seconds
35 cycle
35 cycle
 58℃, 30초58℃, 30 seconds 72℃, 1분72℃, 1 minute 72℃, 5분72℃, 5 minutes 1 cycle1 cycle 보관 4-12℃Storage 4-12℃

그 결과, 도 2 및 표 4에 나타낸 바와 같이, 특정 Indel 마커 프라이머를 이용한 경우, 야생종 토마토 S. pimpinellifolium와 재배종 토마토 S. lycopersicum cv M82에서 각각 특이적인 밴드를 증폭하는 것을 확인하였다. 따라서, 표 4에 나타낸 본 발명의 특정 Indel 마커를 이용하여 야생종 토마토 S. pimpinellifolium와 재배종 토마토 S. lycopersicum의 구분이 가능함을 확인하였다.
As a result, as shown in Fig. 2 and Table 4, when using a specific Indel marker primer, wild tomato S. pimpinellifolium and cultivar tomato S. lycopersicum It was confirmed that each specific band was amplified in cv M82. Therefore, it was confirmed that the wild type tomato S. pimpinellifolium and the cultivar tomato S. lycopersicum can be distinguished using the specific Indel marker of the present invention shown in Table 4.

Chromosome
locationChromosome
location M82
구분 여부M82
Classification Chromosome
locationChromosome
location M82
구분 여부M82
Classification 1번 염색체Chromosome 1 7번 염색체Chromosome 7 1-16Mb1-16Mb ○○ 7-11Mb7-11Mb ○○ 1-32Mb1-32Mb ○○ 7-22Mb7-22Mb ○○ 1-49Mb1-49Mb ○○ 7-34Mb7-34Mb ○○ 1-64Mb1-64Mb ○○ 7-45Mb7-45Mb ○○ 1-82Mb1-82Mb ○○ 7-56Mb7-56Mb ○○ 2번 염색체Chromosome 2 8번 염색체Chromosome 8 2-3Mb2-3Mb ×× 8-10Mb8-10Mb ○○ 2-15Mb2-15Mb ○○ 8-21Mb8-21Mb ○○ 2-25Mb2-25Mb ○○ 8-33Mb8-33Mb ○○ 2-33Mb2-33Mb ○○ 8-42Mb8-42Mb ○○ 2-41Mb2-41Mb ×× 8-55Mb8-55Mb ×× 3번 염색체Chromosome 3 9번 염색체Chromosome 9 3-11Mb3-11Mb ○○ 9-7Mb9-7Mb ○○ 3-23Mb3-23Mb ○○ 9-18Mb9-18Mb ○○ 3-35Mb3-35Mb ○○ 9-31Mb9-31Mb ×× 3-47Mb3-47Mb ○○ 9-41Mb9-41Mb ○○ 3-58Mb3-58Mb ×× 9-57Mb9-57Mb ○○ 4번 염색체Chromosome 4 10번 염색체Chromosome 10 4-7Mb4-7Mb ○○ 10-9Mb10-9Mb ○○ 4-23Mb4-23Mb ×× 10-19Mb10-19Mb ○○ 4-31Mb4-31Mb ×× 10-31Mb10-31Mb ×× 4-44Mb4-44Mb ×× 10-39Mb10-39Mb ○○ 4-56Mb4-56Mb ○○ 10-49Mb10-49Mb ×× 5번 염색체Chromosome 5 11번 염색체Chromosome 11 5-5Mb5-5Mb ○○ 11-7Mb11-7Mb ×× 5-24Mb5-24Mb ○○ 11-15Mb11-15Mb ×× 5-29Mb5-29Mb ×× 11-22Mb11-22Mb ×× 5-48Mb5-48Mb ×× 11-30Mb11-30Mb ×× 5-61Mb5-61Mb ○○ 11-37Mb11-37Mb ×× 6번 염색체Chromosome 6 12번 염색체Chromosome 12 6-9Mb6-9Mb ○○ 12-14Mb12-14Mb ○○ 6-16Mb6-16Mb ○○ 12-25Mb12-25Mb ○○ 6-26Mb6-26Mb ○○ 12-35Mb12-35Mb ○○ 6-33Mb6-33Mb ○○ 12-46Mb12-46Mb ○○ 6-41Mb6-41Mb ○○ 12-54Mb12-54Mb ○○

<< 실시예Example 3> 삽입-결실( 3> Insertion-deletion ( IndelIndel ) ) 마커를Marker 이용한 야생종 토마토 Used wild tomatoes S.S. pimpinellifolium pimpinellifolium 및 And 재배종Cultivar 토마토 Micro-Tom 판별 Tomato Micro-Tom Discrimination

Micro-Tom은 일반 토마토 육종과정에서 파생된 왜형토마토의 품종으로 줄기마디와 잎이 짧아서 좁은 공간과 실내에서 재배가 가능하며, 열매는 일반 방울토마토 크기이다. 특히, 이 품종은 왜성 크기의 장점으로 토마토 유전연구 및 돌연변이 육종에 많이 쓰이고 있으며, 최근에서는 관상용 토마토의 소재로 많이 쓰이고 있다. 이에, 상기 <실시예 1>에서 선별한 Indel 마커를 이용하여 야생종 토마토 S. pimpinellifolium 및 재배종 토마토 Micro-Tom를 판별할 수 있는지 알아보기 위하여, 야생종 토마토 S. pimpinellifolium 및 재배종 토마토 Micro-Tom의 게놈 DNA(genomic DNA)를 분리하고 상기 <실시예 1>에서 제조한 Indel 마커 프라이머를 이용하여 PCR을 수행하였다.Micro-Tom is a cultivar of dwarf tomato derived from the normal tomato breeding process. The stem and leaves are short, so it can be cultivated in a narrow space and indoors, and the fruit is the size of a normal cherry tomato. In particular, this variety is widely used in tomato genetic research and mutant breeding due to its advantage of dwarf size, and in recent years, it is widely used as a material for ornamental tomatoes. Thus, in order to find out whether wild tomato S. pimpinellifolium and cultivar tomato Micro-Tom can be discriminated using the Indel marker selected in <Example 1>, genomic DNA of wild tomato S. pimpinellifolium and cultivar tomato Micro-Tom can be identified. (Genomic DNA) was isolated and PCR was performed using the Indel marker primer prepared in <Example 1>.

구체적으로, 유전형 분석(genotyping)을 위한 게놈 DNA 분리를 위하여, 재배종 토마토 Micro-Tom 식물체의 어린잎 2~3장을 수확한 후 액체 질소를 처리하여 동결하고 분말화하였다. 그 후, 상기 <실시예 2>에 기재된 방법과 동일한 방법으로 DNA를 획득하고 약 100 ng/㎕가 되도록 희석하였다. Specifically, in order to isolate genomic DNA for genotyping, 2-3 young leaves of cultivated tomato Micro-Tom plants were harvested, treated with liquid nitrogen, and frozen and powdered. Thereafter, DNA was obtained in the same manner as described in <Example 2> and diluted to about 100 ng/µl.

그 다음, Indel 마커를 증폭하기 위하여 상기 획득한 Micro-Tom (μ), 상기 <실시예 2>에서 획득한 야생종 토마토 DNA (p), 및 상기 <실시예 2>에서 획득한 재배종 토마토 DNA (M8) 각각을 주형으로 하여 상기 <실시예 1>에서 제조한 Indel 마커 프라이머(표 1)를 이용하여 상기 <실시예 2>에 기재된 방법과 동일한 방법으로 PCR을 수행하였다. 그 다음, 증폭된 Indel 마커 산물은 2.5% 아가로오스 겔에 로딩하고, 100V에서 50-60분간 전기영동하여 증폭 밴드를 확인하였고, 상기 증폭 밴드를 비교하여 야생종 토마토 S. pimpinellifolium와 구분되는 재배종 토마토 Micro-Tom의 Indel 마커를 확인하여 [표 5]에 나타내었다.Then, in order to amplify the Indel marker, the obtained Micro-Tom (μ), the wild tomato DNA obtained in <Example 2> (p), and the cultivated tomato DNA obtained in <Example 2> (M8 ) PCR was performed in the same manner as described in <Example 2> using the Indel marker primers (Table 1) prepared in <Example 1> above using each as a template. Then, the amplified Indel marker product was loaded onto a 2.5% agarose gel, electrophoresed at 100V for 50-60 minutes to confirm the amplification band, and the amplification band was compared to compare the amplification band, and the cultivar tomato differentiated from the wild tomato S. pimpinellifolium. Micro-Tom Indel markers were identified and shown in [Table 5].

그 결과, 도 3 및 표 5에 나타낸 바와 같이, 특정 Indel 마커 프라이머를 이용한 경우, 야생종 토마토 S. pimpinellifolium와 재배종 토마토 Micro-Tom에서 각각 특이적인 밴드를 증폭하는 것을 확인하였다. 따라서, 표 5에 나타낸 본 발명의 특정 Indel 마커를 이용하여 야생종 토마토 S. pimpinellifolium와 재배종 토마토 Micro-Tom의 구분이 가능함을 확인하였다.
As a result, as shown in Fig. 3 and Table 5, when a specific Indel marker primer was used, it was confirmed that specific bands were amplified in each of the wild tomato S. pimpinellifolium and the cultivar tomato Micro-Tom. Therefore, it was confirmed that it was possible to distinguish between wild tomato S. pimpinellifolium and cultivated tomato Micro-Tom using the specific Indel marker of the present invention shown in Table 5.

Chromosome
locationChromosome
location Micro-Tom
구분 여부Micro-Tom
Classification Chromosome
locationChromosome
location Micro-Tom
구분 여부Micro-Tom
Classification 1번 염색체Chromosome 1 7번 염색체Chromosome 7 1-16Mb1-16Mb ○○ 7-11Mb7-11Mb ○○ 1-32Mb1-32Mb ○○ 7-22Mb7-22Mb ○○ 1-49Mb1-49Mb ○○ 7-34Mb7-34Mb ○○ 1-64Mb1-64Mb ○○ 7-45Mb7-45Mb ○○ 1-82Mb1-82Mb ○○ 7-56Mb7-56Mb ○○ 2번 염색체Chromosome 2 8번 염색체Chromosome 8 2-3Mb2-3Mb ×× 8-10Mb8-10Mb ○○ 2-15Mb2-15Mb ×× 8-21Mb8-21Mb ○○ 2-25Mb2-25Mb ×× 8-33Mb8-33Mb ○○ 2-33Mb2-33Mb ○○ 8-42Mb8-42Mb ○○ 2-41Mb2-41Mb ○○ 8-55Mb8-55Mb ×× 3번 염색체Chromosome 3 9번 염색체Chromosome 9 3-11Mb3-11Mb ×× 9-7Mb9-7Mb ○○ 3-23Mb3-23Mb ○○ 9-18Mb9-18Mb ○○ 3-35Mb3-35Mb ○○ 9-31Mb9-31Mb ×× 3-47Mb3-47Mb ×× 9-41Mb9-41Mb ○○ 3-58Mb3-58Mb ○○ 9-57Mb9-57Mb ○○ 4번 염색체Chromosome 4 10번 염색체Chromosome 10 4-7Mb4-7Mb ○○ 10-9Mb10-9Mb ○○ 4-23Mb4-23Mb ×× 10-19Mb10-19Mb ○○ 4-31Mb4-31Mb ○○ 10-31Mb10-31Mb ×× 4-44Mb4-44Mb ○○ 10-39Mb10-39Mb ○○ 4-56Mb4-56Mb ×× 10-49Mb10-49Mb ×× 5번 염색체Chromosome 5 11번 염색체Chromosome 11 5-5Mb5-5Mb ○○ 11-7Mb11-7Mb ○○ 5-24Mb5-24Mb ×× 11-15Mb11-15Mb ○○ 5-29Mb5-29Mb ×× 11-22Mb11-22Mb ×× 5-48Mb5-48Mb ×× 11-30Mb11-30Mb ×× 5-61Mb5-61Mb ×× 11-37Mb11-37Mb ×× 6번 염색체Chromosome 6 12번 염색체Chromosome 12 6-9Mb6-9Mb ×× 12-14Mb12-14Mb ×× 6-16Mb6-16Mb ×× 12-25Mb12-25Mb ○○ 6-26Mb6-26Mb ×× 12-35Mb12-35Mb ×× 6-33Mb6-33Mb ×× 12-46Mb12-46Mb ×× 6-41Mb6-41Mb ○○ 12-54Mb12-54Mb ○○

<110> Industry-academic cooperation foundation wonkwang university <120> Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato <130> PB2019-126 <150> KR 10-2017-0041779 <151> 2017-03-31 <160> 128 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 1-16Mb forward primer <400> 1 cctctttgtg actcgttatc ca 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-16Mb reverse primer <400> 2 cccgcagaca cagtgattag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-32Mb forward primer <400> 3 tgcaacatag ggttctgctg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-32Mb reverse primer <400> 4 tgatagcaat ggcgttcaag 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 1-49Mb forward primer <400> 5 gagttcaaac ttcaatggag tc 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-49Mb reverse primer <400> 6 ccccgtaatt atgtggtcgt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-64Mb forward primer <400> 7 cgatagccat gaaaaagcaa 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-64Mb reverse primer <400> 8 tgaggtgaag gtccaatgtg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-82Mb forward primer <400> 9 ggcattgaat ggtgacccta 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-82Mb reverse primer <400> 10 tgcaaaacgg tctaatcacg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-3Mb forward primer <400> 11 caagacagac ggtcagacga 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-3Mb reverse primer <400> 12 gtgtgttgcc aaagggctat 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-15Mb forward primer <400> 13 gctcccatca gagatgcaat 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-15Mb reverse primer <400> 14 agcttccatg cctggagtta 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-25Mb forward primer <400> 15 aacgacgtgt tccagtgtca 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-25Mb reverse primer <400> 16 cttggacgat gtcacctgac 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-33Mb forward primer <400> 17 tcaaaccccg atttgagatt 20 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 2-33Mb reverse primer <400> 18 ggttaggtat ggtcttggat cg 22 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-41Mb forward primer <400> 19 gatcccacac gcatacacac 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-41Mb reverse primer <400> 20 tcaaaagtcc cacattggtg 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-11Mb forward primer <400> 21 ctgctcactt ggagacctga 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-11Mb reverse primer <400> 22 gaacccttcc aatgtgatgc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-23Mb forward primer <400> 23 atgacgccat cccttcctat 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-23Mb reverse primer <400> 24 gggacgacca tgagttcaga 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-35Mb forward primer <400> 25 tttccccctc tccctagtgt 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-35Mb reverse primer <400> 26 attcgccaag cttgtttttg 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-47Mb forward primer <400> 27 tttttgaacc atgccaaagg 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-47Mb reverse primer <400> 28 ggcatatcga cattggcttt 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-58Mb forward primer <400> 29 aaagcctttc acgacattga 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-58Mb reverse primer <400> 30 cgaacaaccc cgagagtaaa 20 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 4-7Mb forward primer <400> 31 tcaaaatagg aataaagctg atga 24 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-7Mb reverse primer <400> 32 cctaacaacg atcggtgagg 20 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 4-23Mb forward primer <400> 33 tgactacatg gtttatggag acttg 25 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-23Mb reverse primer <400> 34 gaaagggaac gttgattcca 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-31Mb forward primer <400> 35 aaggccccgt ttaatttttg 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-31Mb reverse primer <400> 36 catgttccga tcatcccact 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-44Mb forward primer <400> 37 aatccccatg caagaaaaga 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-44Mb reverse primer <400> 38 aggattaggc catgggattt 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-56Mb forward primer <400> 39 ggagcacgtg agacttttgc 20 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 4-56Mb reverse primer <400> 40 gcactgcagt tttctcttgc t 21 <210> 41 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 5-5Mb forward primer <400> 41 tgagcttcct aggacttgaa ggga 24 <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5-5Mb reverse primer <400> 42 tccattttca catgctactc caaca 25 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-24Mb forward primer <400> 43 cgaatcgcaa ttgagccaaa 20 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 5-24Mb reverse primer <400> 44 tgacgatctt atatgcggta gga 23 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-29Mb forward primer <400> 45 tttgttcaag cagccagatg 20 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 5-29Mb reverse primer <400> 46 gacacaagta gcactgcaaa ca 22 <210> 47 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 5-35Mb forward primer <400> 47 tgcatggagg gtgtgttctt gtcc 24 <210> 48 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 5-35Mb reverse primer <400> 48 tgagctatga atgttgaggc t 21 <210> 49 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 5-47Mb forward primer <400> 49 aaacatttgg gtacgactcg cca 23 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-47Mb reverse primer <400> 50 gacatcccaa cccacgcccc 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-48Mb forward primer <400> 51 tgttgggcgg aataactctt 20 <210> 52 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 5-48Mb reverse primer <400> 52 caaataggac ttatctaggg ac 22 <210> 53 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 5-61Mb forward primer <400> 53 tcaagagaac attctcctcc gt 22 <210> 54 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5-61Mb reverse primer <400> 54 ttagatgagt ttgatgtgat ctttt 25 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-9Mb forward primer <400> 55 gaaaacgggg ttagcactca 20 <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 6-9Mb reverse primer <400> 56 tcatggtttc aagtgtgttg g 21 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-16Mb forward primer <400> 57 ccttggtttc cttgaccttg 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-16Mb reverse primer <400> 58 acatgcgtga ggagaggact 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-26Mb forward primer <400> 59 catttcggta atccatgcaa 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-26Mb reverse primer <400> 60 ttgaaccaac caatgcaaga 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-33Mb forward primer <400> 61 atatccttgg cctgtgcatc 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-33Mb reverse primer <400> 62 tcttcagttt ttcccccaga 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-41Mb forward primer <400> 63 ctatgttgct cgggctcttc 20 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-41Mb reverse primer <400> 64 cagaagtgcc agaagggatt 20 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-11Mb forward primer <400> 65 cgctaagacc aaaagcatcc 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-11Mb reverse primer <400> 66 ggcaaccaaa ggagaacatc 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-22Mb forward primer <400> 67 tattaccccc gaaacaatcg 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-22Mb reverse primer <400> 68 gggaggtcga gttgtggtaa 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-34Mb forward primer <400> 69 tccctcctta ccactcgaaa 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-34Mb reverse primer <400> 70 ccttatgctc gagctctgct 20 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-45Mb forward primer <400> 71 attcccatct gaggcactgt 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-45Mb reverse primer <400> 72 atgcaccgtg gaactctagc 20 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-56Mb forward primer <400> 73 ggaccattgt tggactttgg 20 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-56Mb reverse primer <400> 74 aaacaataaa gcgcgacgat 20 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-10Mb forward primer <400> 75 aaggcaaggg cattaagagg 20 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-10Mb reverse primer <400> 76 ggcaaactaa atcgccaagt 20 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-21Mb forward primer <400> 77 tcaaatgaag aagcgagcac 20 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-21Mb reverse primer <400> 78 atcggccttc ttcaaaatcc 20 <210> 79 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 8-33Mb forward primer <400> 79 tcatttaacc gagcctatga g 21 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-33Mb reverse primer <400> 80 tggctttgcg aagtgattct 20 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-42Mb forward primer <400> 81 gcaaaatgca gaaggagcta 20 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-42Mb reverse primer <400> 82 gtcatgatcc ggggaaacta 20 <210> 83 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 8-55Mb forward primer <400> 83 tcaccagttc tcccctatca a 21 <210> 84 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 8-55Mb reverse primer <400> 84 tcattctcta ttggctcgag att 23 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-7Mb forward primer <400> 85 aactcccgga cttggtctct 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-7Mb reverse primer <400> 86 ttaatcatcc ccggaatcaa 20 <210> 87 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-18Mb forward primer <400> 87 cttcatcgtc atgaaacaca ca 22 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-18Mb reverse primer <400> 88 ttgtgaaaaa tagggcctca 20 <210> 89 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-31Mb forward primer <400> 89 ggctttttgt ggactattct ga 22 <210> 90 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-31Mb reverse primer <400> 90 ttgaatgtgt ttggcctagg ta 22 <210> 91 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 9-41Mb forward primer <400> 91 tcaaaaatgt taaagacaag cttca 25 <210> 92 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-41Mb reverse primer <400> 92 ccctccttca tgtttaggaa ga 22 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-57Mb forward primer <400> 93 ggggtttggg ctaaaatcat 20 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-57Mb reverse primer <400> 94 atggagattt gggaggaggt 20 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-9Mb forward primer <400> 95 acgacctcac agactaagag 20 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-9Mb reverse primer <400> 96 acacaagtgt gggcgtcaca 20 <210> 97 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 10-19Mb forward primer <400> 97 cagacaaagg gttcgcttg 19 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-19Mb reverse primer <400> 98 tcgggaagag gaaaacttga 20 <210> 99 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 10-31Mb forward primer <400> 99 ctaaagacac catcctcccc t 21 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-31Mb reverse primer <400> 100 ggttgtcgag attgggtgtt 20 <210> 101 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-39Mb forward primer <400> 101 gagtcgtggt ggaggtcatt 20 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-39Mb reverse primer <400> 102 agtttggtgc caaatcaagg 20 <210> 103 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 10-49Mb forward primer <400> 103 ccagcagttg agggagtga 19 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-49Mb reverse primer <400> 104 ggttgaaatg gccagaccta 20 <210> 105 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 11-1Mb forward primer <400> 105 tgggtactct accttccatt caa 23 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-1Mb reverse primer <400> 106 tccggctgcc atggagcaat 20 <210> 107 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 11-5Mb forward primer <400> 107 acttacggta ctctttacgt agt 23 <210> 108 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-5Mb reverse primer <400> 108 tcatatggcc cattgctcgt 20 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-7Mb forward primer <400> 109 tatcacgagc tcggttcaaa 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-7Mb reverse primer <400> 110 ggtggcacct ctacaaccat 20 <210> 111 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-15Mb forward primer <400> 111 ttgcacaggc taagcatcac 20 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-15Mb reverse primer <400> 112 agttggggat catgtggttg 20 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-22Mb forward primer <400> 113 tgaatttggt gcttcgttca 20 <210> 114 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-22Mb reverse primer <400> 114 cagttttgcg cacatagagg 20 <210> 115 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-30Mb forward primer <400> 115 tgggcggata tacaaaaagg 20 <210> 116 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-30Mb reverse primer <400> 116 tgcacaaaat cgagaccaag 20 <210> 117 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-37Mb forward primer <400> 117 ccttcgatcc ttgatctcca 20 <210> 118 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-37Mb reverse primer <400> 118 tgagacgcac tgtaggagca 20 <210> 119 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 12-14Mb forward primer <400> 119 cccccagctc atacatctct atc 23 <210> 120 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 12-14Mb reverse primer <400> 120 tttttaggag ggttatatgc acctgt 26 <210> 121 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 12-25Mb forward primer <400> 121 cccaacttaa catacttgat aga 23 <210> 122 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 12-25Mb reverse primer <400> 122 gtgtgcactg gaagtccaaa ta 22 <210> 123 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 12-35Mb forward primer <400> 123 caaatcctca aaactcgttc g 21 <210> 124 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 12-35Mb reverse primer <400> 124 tgtcgatgtt aattggtgct c 21 <210> 125 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 12-46Mb forward primer <400> 125 gcgtcaaata tcaaatgtcc ac 22 <210> 126 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 12-46Mb reverse primer <400> 126 atctaccgca tcgaatttgc 20 <210> 127 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 12-54Mb forward primer <400> 127 tggtgaatgg ttttgatgat g 21 <210> 128 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 12-54Mb reverse primer <400> 128 tgtacgtgca cttcctacgc 20 <110> Industry-academic cooperation foundation wonkwang university <120> Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato <130> PB2019-126 <150> KR 10-2017-0041779 <151> 2017-03-31 <160> 128 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 1-16Mb forward primer <400> 1 cctctttgtg actcgttatc ca 22 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-16Mb reverse primer <400> 2 cccgcagaca cagtgattag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-32Mb forward primer <400> 3 tgcaacatag ggttctgctg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-32Mb reverse primer <400> 4 tgatagcaat ggcgttcaag 20 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 1-49Mb forward primer <400> 5 gagttcaaac ttcaatggag tc 22 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-49Mb reverse primer <400> 6 ccccgtaatt atgtggtcgt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-64Mb forward primer <400> 7 cgatagccat gaaaaagcaa 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-64Mb reverse primer <400> 8 tgaggtgaag gtccaatgtg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-82Mb forward primer <400> 9 ggcattgaat ggtgacccta 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1-82Mb reverse primer <400> 10 tgcaaaacgg tctaatcacg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-3Mb forward primer <400> 11 caagacagac ggtcagacga 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-3Mb reverse primer <400> 12 gtgtgttgcc aaagggctat 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-15Mb forward primer <400> 13 gctcccatca gagatgcaat 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-15Mb reverse primer <400> 14 agcttccatg cctggagtta 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-25Mb forward primer <400> 15 aacgacgtgt tccagtgtca 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-25Mb reverse primer <400> 16 cttggacgat gtcacctgac 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-33Mb forward primer <400> 17 tcaaaccccg atttgagatt 20 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 2-33Mb reverse primer <400> 18 ggttaggtat ggtcttggat cg 22 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-41Mb forward primer <400> 19 gatcccacac gcatacacac 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2-41Mb reverse primer <400> 20 tcaaaagtcc cacattggtg 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-11Mb forward primer <400> 21 ctgctcactt ggagacctga 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-11Mb reverse primer <400> 22 gaacccttcc aatgtgatgc 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-23Mb forward primer <400> 23 atgacgccat cccttcctat 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-23Mb reverse primer <400> 24 gggacgacca tgagttcaga 20 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-35Mb forward primer <400> 25 tttccccctc tccctagtgt 20 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-35Mb reverse primer <400> 26 attcgccaag cttgtttttg 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-47Mb forward primer <400> 27 tttttgaacc atgccaaagg 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-47Mb reverse primer <400> 28 ggcatatcga cattggcttt 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-58Mb forward primer <400> 29 aaagcctttc acgacattga 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 3-58Mb reverse primer <400> 30 cgaacaaccc cgagagtaaa 20 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 4-7Mb forward primer <400> 31 tcaaaatagg aataaagctg atga 24 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-7Mb reverse primer <400> 32 cctaacaacg atcggtgagg 20 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 4-23Mb forward primer <400> 33 tgactacatg gtttatggag acttg 25 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-23Mb reverse primer <400> 34 gaaagggaac gttgattcca 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-31Mb forward primer <400> 35 aaggccccgt ttaatttttg 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-31Mb reverse primer <400> 36 catgttccga tcatcccact 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-44Mb forward primer <400> 37 aatccccatg caagaaaaga 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-44Mb reverse primer <400> 38 aggattaggc catgggattt 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 4-56Mb forward primer <400> 39 ggagcacgtg agacttttgc 20 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 4-56Mb reverse primer <400> 40 gcactgcagt tttctcttgc t 21 <210> 41 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 5-5Mb forward primer <400> 41 tgagcttcct aggacttgaa ggga 24 <210> 42 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5-5Mb reverse primer <400> 42 tccattttca catgctactc caaca 25 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-24Mb forward primer <400> 43 cgaatcgcaa ttgagccaaa 20 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 5-24Mb reverse primer <400> 44 tgacgatctt atatgcggta gga 23 <210> 45 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-29Mb forward primer <400> 45 tttgttcaag cagccagatg 20 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 5-29Mb reverse primer <400> 46 gacacaagta gcactgcaaa ca 22 <210> 47 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 5-35Mb forward primer <400> 47 tgcatggagg gtgtgttctt gtcc 24 <210> 48 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 5-35Mb reverse primer <400> 48 tgagctatga atgttgaggc t 21 <210> 49 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 5-47Mb forward primer <400> 49 aaacatttgg gtacgactcg cca 23 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-47Mb reverse primer <400> 50 gacatcccaa cccacgcccc 20 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 5-48Mb forward primer <400> 51 tgttgggcgg aataactctt 20 <210> 52 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 5-48Mb reverse primer <400> 52 caaataggac ttatctaggg ac 22 <210> 53 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 5-61Mb forward primer <400> 53 tcaagagaac attctcctcc gt 22 <210> 54 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 5-61Mb reverse primer <400> 54 ttagatgagt ttgatgtgat ctttt 25 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-9Mb forward primer <400> 55 gaaaacgggg ttagcactca 20 <210> 56 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 6-9Mb reverse primer <400> 56 tcatggtttc aagtgtgttg g 21 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-16Mb forward primer <400> 57 ccttggtttc cttgaccttg 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-16Mb reverse primer <400> 58 acatgcgtga ggagaggact 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-26Mb forward primer <400> 59 catttcggta atccatgcaa 20 <210> 60 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-26Mb reverse primer <400> 60 ttgaaccaac caatgcaaga 20 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-33Mb forward primer <400> 61 atatccttgg cctgtgcatc 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-33Mb reverse primer <400> 62 tcttcagttt ttcccccaga 20 <210> 63 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-41Mb forward primer <400> 63 ctatgttgct cgggctcttc 20 <210> 64 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 6-41Mb reverse primer <400> 64 cagaagtgcc agaagggatt 20 <210> 65 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-11Mb forward primer <400> 65 cgctaagacc aaaagcatcc 20 <210> 66 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-11Mb reverse primer <400> 66 ggcaaccaaa ggagaacatc 20 <210> 67 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-22Mb forward primer <400> 67 tattaccccc gaaacaatcg 20 <210> 68 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-22Mb reverse primer <400> 68 gggaggtcga gttgtggtaa 20 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-34Mb forward primer <400> 69 tccctcctta ccactcgaaa 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-34Mb reverse primer <400> 70 ccttatgctc gagctctgct 20 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-45Mb forward primer <400> 71 attcccatct gaggcactgt 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-45Mb reverse primer <400> 72 atgcaccgtg gaactctagc 20 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-56Mb forward primer <400> 73 ggaccattgt tggactttgg 20 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 7-56Mb reverse primer <400> 74 aaacaataaa gcgcgacgat 20 <210> 75 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-10Mb forward primer <400> 75 aaggcaaggg cattaagagg 20 <210> 76 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-10Mb reverse primer <400> 76 ggcaaactaa atcgccaagt 20 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-21Mb forward primer <400> 77 tcaaatgaag aagcgagcac 20 <210> 78 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-21Mb reverse primer <400> 78 atcggccttc ttcaaaatcc 20 <210> 79 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 8-33Mb forward primer <400> 79 tcatttaacc gagcctatga g 21 <210> 80 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-33Mb reverse primer <400> 80 tggctttgcg aagtgattct 20 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-42Mb forward primer <400> 81 gcaaaatgca gaaggagcta 20 <210> 82 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8-42Mb reverse primer <400> 82 gtcatgatcc ggggaaacta 20 <210> 83 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 8-55Mb forward primer <400> 83 tcaccagttc tcccctatca a 21 <210> 84 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 8-55Mb reverse primer <400> 84 tcattctcta ttggctcgag att 23 <210> 85 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-7Mb forward primer <400> 85 aactcccgga cttggtctct 20 <210> 86 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-7Mb reverse primer <400> 86 ttaatcatcc ccggaatcaa 20 <210> 87 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-18Mb forward primer <400> 87 cttcatcgtc atgaaacaca ca 22 <210> 88 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-18Mb reverse primer <400> 88 ttgtgaaaaa tagggcctca 20 <210> 89 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-31Mb forward primer <400> 89 ggctttttgt ggactattct ga 22 <210> 90 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-31Mb reverse primer <400> 90 ttgaatgtgt ttggcctagg ta 22 <210> 91 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> 9-41Mb forward primer <400> 91 tcaaaaatgt taaagacaag cttca 25 <210> 92 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 9-41Mb reverse primer <400> 92 ccctccttca tgtttaggaa ga 22 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-57Mb forward primer <400> 93 ggggtttggg ctaaaatcat 20 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 9-57Mb reverse primer <400> 94 atggagattt gggaggaggt 20 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-9Mb forward primer <400> 95 acgacctcac agactaagag 20 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-9Mb reverse primer <400> 96 acacaagtgt gggcgtcaca 20 <210> 97 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 10-19Mb forward primer <400> 97 cagacaaagg gttcgcttg 19 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-19Mb reverse primer <400> 98 tcgggaagag gaaaacttga 20 <210> 99 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 10-31Mb forward primer <400> 99 ctaaagacac catcctcccc t 21 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-31Mb reverse primer <400> 100 ggttgtcgag attgggtgtt 20 <210> 101 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-39Mb forward primer <400> 101 gagtcgtggt ggaggtcatt 20 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-39Mb reverse primer <400> 102 agtttggtgc caaatcaagg 20 <210> 103 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 10-49Mb forward primer <400> 103 ccagcagttg agggagtga 19 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 10-49Mb reverse primer <400> 104 ggttgaaatg gccagaccta 20 <210> 105 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 11-1Mb forward primer <400> 105 tgggtactct accttccatt caa 23 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-1Mb reverse primer <400> 106 tccggctgcc atggagcaat 20 <210> 107 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 11-5Mb forward primer <400> 107 acttacggta ctctttacgt agt 23 <210> 108 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-5Mb reverse primer <400> 108 tcatatggcc cattgctcgt 20 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-7Mb forward primer <400> 109 tatcacgagc tcggttcaaa 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-7Mb reverse primer <400> 110 ggtggcacct ctacaaccat 20 <210> 111 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-15Mb forward primer <400> 111 ttgcacaggc taagcatcac 20 <210> 112 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-15Mb reverse primer <400> 112 agttggggat catgtggttg 20 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-22Mb forward primer <400> 113 tgaatttggt gcttcgttca 20 <210> 114 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-22Mb reverse primer <400> 114 cagttttgcg cacatagagg 20 <210> 115 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-30Mb forward primer <400> 115 tgggcggata tacaaaaagg 20 <210> 116 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-30Mb reverse primer <400> 116 tgcacaaaat cgagaccaag 20 <210> 117 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-37Mb forward primer <400> 117 ccttcgatcc ttgatctcca 20 <210> 118 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 11-37Mb reverse primer <400> 118 tgagacgcac tgtaggagca 20 <210> 119 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 12-14Mb forward primer <400> 119 cccccagctc atacatctct atc 23 <210> 120 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 12-14Mb reverse primer <400> 120 tttttaggag ggttatatgc acctgt 26 <210> 121 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 12-25Mb forward primer <400> 121 cccaacttaa catacttgat aga 23 <210> 122 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 12-25Mb reverse primer <400> 122 gtgtgcactg gaagtccaaa ta 22 <210> 123 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 12-35Mb forward primer <400> 123 caaatcctca aaactcgttc g 21 <210> 124 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 12-35Mb reverse primer <400> 124 tgtcgatgtt aattggtgct c 21 <210> 125 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> 12-46Mb forward primer <400> 125 gcgtcaaata tcaaatgtcc ac 22 <210> 126 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 12-46Mb reverse primer <400> 126 atctaccgca tcgaatttgc 20 <210> 127 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 12-54Mb forward primer <400> 127 tggtgaatgg ttttgatgat g 21 <210> 128 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 12-54Mb reverse primer <400> 128 tgtacgtgca cttcctacgc 20

Claims (6)

서열번호 13 및 14로 이루어진 프라이머 세트; 서열번호 15 및 16으로 이루어진 프라이머 세트; 서열번호 21 및 22로 이루어진 프라이머 세트; 서열번호 27 및 28로 이루어진 프라이머 세트; 서열번호 39 및 40으로 이루어진 프라이머 세트; 서열번호 43 및 44로 이루어진 프라이머 세트; 서열번호 53 및 54로 이루어진 프라이머 세트; 서열번호 55 및 56으로 이루어진 프라이머 세트; 서열번호 57 및 58로 이루어진 프라이머 세트; 서열번호 59 및 60으로 이루어진 프라이머 세트; 서열번호 61 및 62로 이루어진 프라이머 세트; 서열번호 119 및 120으로 이루어진 프라이머 세트; 서열번호 123 및 124로 이루어진 프라이머 세트; 및 서열번호 125 및 126으로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 포함하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하기 위한 프라이머 세트.
Primer sets consisting of SEQ ID NOs: 13 and 14; Primer sets consisting of SEQ ID NOs: 15 and 16; Primer sets consisting of SEQ ID NOs: 21 and 22; Primer sets consisting of SEQ ID NOs: 27 and 28; Primer sets consisting of SEQ ID NOs: 39 and 40; Primer sets consisting of SEQ ID NOs: 43 and 44; Primer sets consisting of SEQ ID NOs: 53 and 54; Primer sets consisting of SEQ ID NOs: 55 and 56; Primer sets consisting of SEQ ID NOs: 57 and 58; Primer sets consisting of SEQ ID NOs: 59 and 60; Primer sets consisting of SEQ ID NOs: 61 and 62; Primer sets consisting of SEQ ID NOs: 119 and 120; Primer sets consisting of SEQ ID NOs: 123 and 124; And a wild tomato Tomato Solanum pimpinellifolium and a cultivar Tomato Solanum lycopersicum comprising any one or more primer sets selected from the group consisting of a primer set consisting of SEQ ID NOs: 125 and 126. Primer set to
제 1항에 있어서, 서열번호 1 및 2로 이루어진 프라이머 세트; 서열번호 3 및 4로 이루어진 프라이머 세트; 서열번호 5 및 6으로 이루어진 프라이머 세트; 서열번호 7 및 8로 이루어진 프라이머 세트; 서열번호 9 및 10으로 이루어진 프라이머 세트; 서열번호 17 및 18로 이루어진 프라이머 세트; 서열번호 23 및 24로 이루어진 프라이머 세트; 서열번호 25 및 26으로 이루어진 프라이머 세트; 서열번호 31 및 32로 이루어진 프라이머 세트; 서열번호 41 및 42로 이루어진 프라이머 세트; 서열번호 63 및 64로 이루어진 프라이머 세트; 서열번호 65 및 66으로 이루어진 프라이머 세트; 서열번호 67 및 68로 이루어진 프라이머 세트; 서열번호 69 및 70으로 이루어진 프라이머 세트; 서열번호 71 및 72로 이루어진 프라이머 세트; 서열번호 73 및 74로 이루어진 프라이머 세트; 서열번호 75 및 76으로 이루어진 프라이머 세트; 서열번호 77 및 78로 이루어진 프라이머 세트; 서열번호 79 및 80으로 이루어진 프라이머 세트; 서열번호 81 및 82로 이루어진 프라이머 세트; 서열번호 85 및 86으로 이루어진 프라이머 세트; 서열번호 87 및 88로 이루어진 프라이머 세트; 서열번호 91 및 92로 이루어진 프라이머 세트; 서열번호 93 및 94로 이루어진 프라이머 세트; 서열번호 95 및 96으로 이루어진 프라이머 세트; 서열번호 97 및 98로 이루어진 프라이머 세트; 서열번호 101 및 102로 이루어진 프라이머 세트; 서열번호 121 및 122로 이루어진 프라이머 세트; 및 서열번호 127 및 128로 이루어진 프라이머 세트로 구성된 군으로부터 선택된 어느 하나 이상의 프라이머 세트를 추가로 포함하는 것을 특징으로 하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하기 위한 프라이머 세트.
The method of claim 1, wherein the primer set consisting of SEQ ID NO: 1 and 2; Primer sets consisting of SEQ ID NOs: 3 and 4; Primer sets consisting of SEQ ID NOs: 5 and 6; Primer sets consisting of SEQ ID NOs: 7 and 8; Primer sets consisting of SEQ ID NOs: 9 and 10; Primer sets consisting of SEQ ID NOs: 17 and 18; Primer sets consisting of SEQ ID NOs: 23 and 24; Primer sets consisting of SEQ ID NOs: 25 and 26; Primer sets consisting of SEQ ID NOs: 31 and 32; Primer sets consisting of SEQ ID NOs: 41 and 42; Primer sets consisting of SEQ ID NOs: 63 and 64; Primer sets consisting of SEQ ID NOs: 65 and 66; Primer sets consisting of SEQ ID NOs: 67 and 68; Primer sets consisting of SEQ ID NOs: 69 and 70; Primer sets consisting of SEQ ID NOs: 71 and 72; Primer sets consisting of SEQ ID NOs: 73 and 74; Primer sets consisting of SEQ ID NOs: 75 and 76; Primer sets consisting of SEQ ID NOs: 77 and 78; Primer sets consisting of SEQ ID NOs: 79 and 80; Primer sets consisting of SEQ ID NOs: 81 and 82; Primer sets consisting of SEQ ID NOs: 85 and 86; Primer sets consisting of SEQ ID NOs: 87 and 88; Primer sets consisting of SEQ ID NOs: 91 and 92; Primer sets consisting of SEQ ID NOs: 93 and 94; Primer sets consisting of SEQ ID NOs: 95 and 96; Primer sets consisting of SEQ ID NOs: 97 and 98; Primer sets consisting of SEQ ID NOs: 101 and 102; Primer sets consisting of SEQ ID NOs: 121 and 122; And at least one primer set selected from the group consisting of a primer set consisting of SEQ ID NOs: 127 and 128. Characterized by comprising, wild species tomato solum pumfinelliporium ( Solanum pimpinellifolium ) and cultivated tomato solanum lycopersicum .
1) 대상 시료에서 게놈 DNA를 분리하는 단계;
2) 상기 단계 1)에서 분리한 게놈 DNA를 주형으로 하고, 제 1항 또는 제 2항의 프라이머 세트를 이용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 및
3) 상기 단계 2)에서 증폭한 산물을 검출하는 단계를 포함하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하는 방법.
1) separating genomic DNA from the subject sample;
2) amplifying a target sequence by using the genomic DNA isolated in step 1) as a template and performing an amplification reaction using the primer set of claim 1 or 2; And
3) wild-type tomato solanum pimfinelliporium ( Solanum ) comprising the step of detecting the product amplified in step 2) pimpinellifolium ) and cultivated tomato Solanum lycopersicum .
제 3항에 있어서, 상기 단계 2)에서 증폭 반응은 중합효소연쇄반응(PCR), 리가아제 연쇄반응(ligase chain reaction), 핵산 서열 기재 증폭(nucleic acid sequence-based amplification), 전사 기재 증폭 시스템(transcription-based amplification system), 가닥 치환 증폭(strand displacement amplification) 및 Qβ 복제효소(replicase)를 통한 증폭으로 이루어진 군으로부터 선택되는 것을 특징으로 하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하는 방법.
The method of claim 3, wherein the amplification reaction in step 2) is a polymerase chain reaction (PCR), a ligase chain reaction (ligase chain reaction), nucleic acid sequence-based amplification, transcription-based amplification system ( Wild tomato Solanum pimpinellifolium and cultivar, characterized in that it is selected from the group consisting of transcription-based amplification system, strand displacement amplification and amplification via Qβ replicase . Tomato solanum lycopiscum lycopersicum ).
제 1항 또는 제 2항의 프라이머 세트를 포함하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하기 위한 키트.
A kit for determining the wild tomato Solanum pimpinellifolium and the cultivated tomato Solanum lycopersicum , comprising the primer set of claim 1 .
제 5항에 있어서, 상기 키트에는 DNA 중합효소, dNTPs 및 반응완충액을 추가로 포함하는 것을 특징으로 하는, 야생종 토마토 솔라눔 핌피넬리포리움(Solanum pimpinellifolium)과 재배종 토마토 솔라눔 리코퍼시쿰(Solanum lycopersicum)을 판별하기 위한 키트.
According to claim 5, The kit is characterized in that it further comprises DNA polymerase, dNTPs and reaction buffer, wild tomato tomato solanum pumfinelliporium ( Solanum pimpinellifolium ) and cultivated tomato Solanum lycopersicum .
KR1020190088449A 2019-07-22 2019-07-22 Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato KR102009627B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190088449A KR102009627B1 (en) 2019-07-22 2019-07-22 Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190088449A KR102009627B1 (en) 2019-07-22 2019-07-22 Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020170137334A Division KR102004479B1 (en) 2017-03-31 2017-10-23 Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato

Publications (2)

Publication Number Publication Date
KR20190089140A KR20190089140A (en) 2019-07-30
KR102009627B1 true KR102009627B1 (en) 2019-08-09

Family

ID=67473492

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190088449A KR102009627B1 (en) 2019-07-22 2019-07-22 Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato

Country Status (1)

Country Link
KR (1) KR102009627B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101493978B1 (en) 2013-10-08 2015-02-17 대한민국 Indel marker for discrimination of soybean cultivar
US20150096076A1 (en) 2012-04-19 2015-04-02 Vilmorin & Cie High yield tomato plants

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120102568A (en) * 2009-06-17 2012-09-18 몬산토 인베스트 엔.브이. Tomato plants resulting from the introgression of a trait from solanum pennellii into s. lycopersicum and having an increased yield
EP2292774A1 (en) * 2009-08-17 2011-03-09 Syngenta Participations AG. Disease resistant tomato plants
KR101604831B1 (en) * 2014-03-24 2016-03-18 안동대학교 산학협력단 Primer set to judge tomato resitant to verticillium wilt, Method to judge tomato resitant to verticillium wilt using the same, and Kit to judge tomato resitant to verticillium wilt using the same

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150096076A1 (en) 2012-04-19 2015-04-02 Vilmorin & Cie High yield tomato plants
KR101493978B1 (en) 2013-10-08 2015-02-17 대한민국 Indel marker for discrimination of soybean cultivar

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DNA Research, (2014), Vol..21, pp429-438. 1부.*

Also Published As

Publication number Publication date
KR20190089140A (en) 2019-07-30

Similar Documents

Publication Publication Date Title
Agarwal et al. Advances in molecular marker techniques and their applications in plant sciences
KR100823692B1 (en) Sequence-based dna markers for evaluation of phylogenetic relationships and cultivar identification in korean watermelon varieties
KR101912192B1 (en) Molecular marker and primer set for discriminating Platycodon grandiflorum cultivar and uses thereof
KR101912196B1 (en) Molecular marker and primer set for discriminating Paeonia suffruticosa and Paeonia lactiflora and uses thereof
KR102198566B1 (en) Tetra primers ARMS-PCR molecular marker for discriminating cultivars of sweet potato and uses thereof
KR101905458B1 (en) CAPS markers for discriminating of apple cultivars and uses thereof
KR20140039866A (en) Ssr primer sets for discrimination of oriental melon line or cultivar and uses thereof
KR102010279B1 (en) Molecular marker for discriminating Codonopsis lanceolata among genus Codonopsis and uses thereof
KR101778877B1 (en) Markers for discrimination of Whangkeumbae and Minibae
KR102298723B1 (en) Marker for discrimination of resistance to tomato yellow leaf curl virus and discrimination method using the same marker
KR102283638B1 (en) Random Amplified Polymorphic DNA primer for discrimination of tobacco cultivars
KR20130102032A (en) Primer sets for discrimination of grape cultivars and use thereof
KR102009627B1 (en) Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato
KR101783347B1 (en) CAPS marker for discriminating presence or absence of pollen in pear and uses thereof
KR101144988B1 (en) SCAR markers for discrimination of apple cultivars and use thereof
KR102458440B1 (en) Primer set for selecting Phytophthora blight resistant pepper and selection method using the same primer set
KR102142010B1 (en) Marker for discriminating Hongro apple and its bud mutation cultivar and use thereof
KR101649589B1 (en) SSR primer derived from apple and use thereof
KR102004479B1 (en) Primer set of tomato InDel marker for detection of wild-type tomato and cultivated-type tomato
KR20130091434A (en) Primer for selecting variety resistant to rice stripe disease containing stv-bi gene and the selecting method thereof
KR101359542B1 (en) Microsatellite primer sets for discriminating cultivars of peach and uses thereof
KR20100079527A (en) Ssr primer derived from azuki-bean and use thereof
KR101144990B1 (en) PCR-based method of discriminating ginseng cultivars using STS primers
KR20190055442A (en) Composition for distinguishing rice cultivar and method for distinguishing rice cultivar using the same
KR102535529B1 (en) SINGLE NUCLEOTIDE POLYMORPHISM MARKER SET FOR LINE PURITY CHECKING AND EARLY FIXED LINE SELECTING IN WATERMELON (Citrullus lanatus)

Legal Events

Date Code Title Description
A107 Divisional application of patent
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant