KR20190055442A - Composition for distinguishing rice cultivar and method for distinguishing rice cultivar using the same - Google Patents

Abstract

A composition for distinguishing rice varieties and a method for distinguishing rice varieties using the same are disclosed. The composition for distinguishing rice varieties according to one embodiment of the present invention may include at least one primer set selected from the group consisting of primer sets of SEQ ID NOS: 1 to 48.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a composition for distinguishing rice varieties and a method for distinguishing rice varieties using the same.

The present invention relates to a primer for distinguishing rice varieties and a method for distinguishing rice varieties using the primer. More particularly, the present invention relates to a rice varieties comprising at least one primer selected from the group consisting of nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 48 A kit for distinguishing rice varieties, and a method for distinguishing rice varieties using the same.

Rice is the second largest food crop after wheat and more than half of the world's population is rice, which is produced in more than 90% of Asia and most of it is consumed in Asia. In Korea, rice is a stock and 15-20 varieties of new varieties are cultivated and distributed every year. However, most of the varieties that are supplied domestically are dominated by certain varieties (Ichiban, Juanam, Dongjin 1). Most of domestic consumers can not confirm these varieties. In addition, some distributors supply mixed rice to domestic or imported domestic rice according to the opening of import and export. In order to prevent such illegal circulation, the government has institutionalized the marking of origin, but in the case of false identification of origin, And it is very difficult to carry out complicated procedures such as tracking and confirming the origin. In addition, since more scientific investigation techniques are needed for accusations and accusations related to rice varieties, such as theft of harvests in some rural areas, a method of quickly and easily discriminating rice varieties grown and cultivated in the country And the establishment of technology.

On the other hand, researches on the development of biometrics technology for identification of the human being have been actively conducted with the development of the information communication industry in recent years. Biometrics include methods of using physical features such as iris, fingerprint, and DNA, and methods of using behavioral characteristics such as signature, voice, and gait. On the other hand, in the case of crops, the process of securing the rights of developed varieties through strengthening of intellectual property rights is becoming important, and development of technology for discrimination of varieties such as the identification of people is urgently needed.

Accordingly, molecular markers are widely used for the purpose of searching for useful traits, identification of species of organisms, identification of breeds, and analysis of the relationship of population groups in a molecular breeding system. Pigment sarcoma using molecular markers is advantageous in that it can analyze large amounts of resources accurately and quickly because it can detect traits in young periods without being influenced by environmental variation.

First, RFLPs (Restriction Fragment Length Length Polymorphisms) method based on the difference in nucleotide sequence length caused by mutation of restriction enzyme recognition sites in chromosomes have been developed, but this method is troublesome to use radioactive isotopes. Thereafter, a randomly amplified polymorphic DNA (RAPD) method has been developed as a nucleic acid fingerprinting method using PCR (Polymerase Chain Reaction). In the PCR method, a small oligonucleotide composed of 10 to 20 nucleotides (hereinafter referred to as a "primer") is annealed with DNA or RNA of an organism, and then a heat-resistant DNA polymerase It is a way to lose. This requires only a small amount of DNA (1-50 ng) compared to other methods, and has the advantage of being able to confirm the results easily and quickly. Among these methods, the RAPD method has the disadvantage that the reproducibility is low because the nonspecific PCR product is amplified. The AFLP (Amplified Fragment Length Polymorphism) method is a method for detecting a high DNA polymorphism, The SSR (Single Sequence Repeat) method is a method for analyzing a supersampler in an individual by preparing a PCR primer based on nucleotide sequence information in a microsatellite region, which is a DNA repeat sequence, The number of SSR markers developed in rice plants has been increasingly used as a marker for high density gene mapping There is a disadvantage that it is not sufficient for production.

Under these circumstances, the present inventors have conducted studies on molecular markers that can be efficiently used for differentiating rice varieties, maintain the advantage of exhibiting polymorphism when amplified by PCR reaction, and are sufficient for high density gene mapping We have developed an Indel (insertion / deletion) marker that complements the disadvantages of non-SSR markers.

One embodiment of the present invention is to provide a composition for distinguishing rice varieties.

Another embodiment of the present invention is to provide a kit for distinguishing rice varieties.

Another embodiment of the present invention is to provide a method for distinguishing rice varieties.

The composition for distinguishing rice varieties according to an embodiment of the present invention may include one or more primer sets selected from the group consisting of primer sets represented by the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 48.

The composition comprises a primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2, a primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4, a primer set consisting of SEQ ID NO: 5 and SEQ ID NO: 6, A primer set consisting of SEQ ID NO: 9 and SEQ ID NO: 10, a primer set consisting of SEQ ID NO: 11 and SEQ ID NO: 12, a primer set consisting of SEQ ID NO: 13 and SEQ ID NO: 14, a SEQ ID NO: A primer set consisting of SEQ ID NO: 17 and SEQ ID NO: 18, a primer set consisting of SEQ ID NO: 19 and SEQ ID NO: 20, a primer set consisting of SEQ ID NO: 21 and SEQ ID NO: 22, a primer set consisting of SEQ ID NO: And SEQ ID NO: 24, a primer set consisting of SEQ ID NO: 25 and SEQ ID NO: 26, a primer set consisting of SEQ ID NO: 27 and SEQ ID NO: 28 A primer set consisting of SEQ ID NO: 29 and SEQ ID NO: 30, a primer set consisting of SEQ ID NO: 31 and SEQ ID NO: 32, a primer set consisting of SEQ ID NO: 33 and SEQ ID NO: 34, A primer set consisting of SEQ ID NO: 37 and SEQ ID NO: 38, a primer set consisting of SEQ ID NO: 39 and SEQ ID NO: 40, a primer set consisting of SEQ ID NO: 41 and SEQ ID NO: 42, , A primer set consisting of SEQ ID NO: 45 and SEQ ID NO: 46, and a primer set consisting of SEQ ID NO: 47 and SEQ ID NO: 48.

The method for distinguishing rice according to an embodiment of the present invention includes amplifying a rice sample using one or more primers selected from the group consisting of nucleotide sequences of SEQ ID NOS: 1 to 48, using genomic DNA isolated from a rice sample as a template, Performing a reaction to amplify the target sequence, and detecting the amplification product.

Indel markers according to one embodiment of the present invention can compensate for the disadvantages of SSR markers which are not sufficient for high density gene mapping, while maintaining the advantage of exhibiting polymorphism when amplified by PCR reaction.

In addition, according to one embodiment of the present invention, it is possible to distinguish domestic rice from foreign rice, and to determine whether foreign rice is mixed in domestic rice.

In this specification, when an element is referred to as being on another element, it may be directly formed on another element, or a third element may be interposed therebetween. Further, in the drawings, the thicknesses of shapes and sizes are exaggerated for an effective description of the technical content.

Also, while the terms first, second, third, etc. in the various embodiments of the present disclosure are used to describe various components, these components should not be limited by these terms. These terms have only been used to distinguish one component from another. Thus, what is referred to as a first component in any one embodiment may be referred to as a second component in another embodiment. Each embodiment described and exemplified herein also includes its complementary embodiment. Also, in this specification, 'and / or' are used to include at least one of the front and rear components. The singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. It is also to be understood that the terms such as " comprises " or " having " are intended to specify the presence of stated features, integers, Should not be understood to exclude the presence or addition of one or more other elements, elements, or combinations thereof. Also, in this specification, the term " connection " is used to include both indirectly connecting and directly connecting a plurality of components.

In the following description of the present invention, a detailed description of known functions and configurations incorporated herein will be omitted when it may make the subject matter of the present invention rather unclear.

In the present invention, the term " mutation region " means a place where a change of a gene or a chromosome occurs, and in the present invention, it may be mixed with a Dense mutation block (DMB). That is, it may mean a region where there is a difference in gene between cultivars. In the present invention, it may mean a region where SNVs are dense. More specifically, the present invention defines mutation regions when the number of single base mutations (SNVs) that differ from standard dielectric genome information is four or more per 10 kb.

In the present invention, the term "single nucleotide variation" is also referred to as "SNP (single nucleotide polymorphism)", which means polymorphism in a single base. That is, in some groups, some bases in the entire genome exist in different chromosomes, and it is known that SNV exists in about 300 to 1000 bases, but is not limited thereto.

The term " Indel (insertion / deletion) marker " in the present invention collectively refers to a mutation in which some bases are inserted or deleted in the nucleotide sequence of DNA. The Indel marker searches for insertion or deletion regions of the standard dielectric by comparing and analyzing the genomic information of the genotypes used in the experiment and the primers based on the information. Therefore, the amplification result can show two types of insertion and deletion in comparison with the standard genome.

In the present invention, the term " marker " means a base sequence used as a reference point when identifying genetically unrelated loci, and the term " locus " means a position on a genetic map of a molecular marker.

The term in the present invention. &Quot; Standard dielectric " refers to the genome of a variety of crops that is a standard in recognizing the breeds of the present invention. Preferably, it may be a genome of domestic domestic " Hwangyoung " rice, but is not limited thereto.

The term " primer " as used herein refers to a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming a base pair with a complementary template, &Quot; means a short nucleic acid sequence functioning as a starting point for < / RTI > The length and sequence of the primer should allow for the start of the synthesis of the extension product and the specific length and sequence of the primer depends not only on the complexity of the desired DNA or RNA target but also on the conditions of use such as temperature and ionic strength something to do. As a specific example, the specific length and sequence of the primer should be determined in consideration of various conditions such as the contents of guanine and cytosine (GC contents), GC arrangement, annealing temperature and ionic strength. Primers can initiate DNA synthesis in the presence of reagents for polymerization (i. E., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates (dNTPs) at appropriate buffer solutions and temperatures.

The primer set for distinguishing rice varieties of the present invention can be used for amplification of a target sequence and can be preferably used for amplification of Indel markers for discriminating rice varieties.

Specifically, in one embodiment of the present invention, a primer set for distinguishing rice varieties may be a primer set described in Table 1 below.

Primer ID SEQ ID NO: Forward Primer SEQ ID NO: Reverse Primer KM_IND_102 One TCCCTTGTAGGCTCCTATCT 2 TTGGTACTTAACTACCAGAG KM_IND_104 3 CCATTATCATTCTGGACAAC 4 TGCACGATGTGGACAGAATA KM_IND_106 5 ACTTCACGCCATTCCACCTA 6 TCTCAAGTTTAGATCAAAGG KM_IND_109 7 GCATGTACTCTACCTTCAAA 8 TCATTCTGGCTTAAACTAGG KM_IND_117 9 ACACTGTCCTTCGTTACCGT 10 ATTCATTAGCTTCTAGATAC KM_IND_235 11 GCCTATTCTTACCATCTGCA 12 TTCACTGGAAGCATTATCAA KM_IND_237 13 AGTCGTCGCAATTACGTTTG 14 GCACTTATAGCAAGCATTTA KM_IND_254 15 TAATGCCACCATTGATTCGC 16 CACACTACTTTAGATCTTGA KM_IND_301 17 AACTGATCTCCCTATTTGAA 18 GTCACCGTGCCATTACGTGT KM_IND_401 19 ATGCAATGAACTTACTTAGT 20 AAGCATCAAGCATATCTAGT KM_IND_406 21 ACTTCACTCCTACACAATCC 22 TGCATTCATCTTGACTAGGC KM_IND_421 23 GATCAGATGGCTTGCACATC 24 TGTCACATTCAGTTTCACTG KM_IND_424 25 AAAACATCTCTAACGCAACT 26 TCGTCCTACCCAATCGTCTG KM_IND_518 27 ACAAATTCGGATTGCTAATT 28 ATGTCCTAATTCAGATTAGA KM_IND_619 29 TAGAAAGGCCTTTAAGATAG 30 CTTGGTTCAGCTTAAATCCG KM_IND_804 31 CATCGGATTAGTCATCGATA 32 ACCTAGCATTACTGCCACCT KM_IND_805 33 GCTAACAGTTTGACGTCTTG 34 ATTCCACACCCGTTTACTTG KM_IND_839 35 TCTACTTGAGTGCTTCAATA 36 AGAGATCATTTTTGACCTAG KM_IND_907 37 ATCTCGGTTCGGTATCCTTA 38 GTAATGATAGACATCCTTTG KM_IND_925 39 CTATGCTAGCTTCGATACAC 40 CATCTTATACATACCGTTGG KM_IND_1021 41 AAACACCTACACCCTTCTCG 42 TTATGCGAATGATGCATTGT KM_IND_1113 43 TTACTCCATCTAGTTAGCAG 44 TCCGGTTTAAATTAGCCAT KM_IND_1122 45 GGCTAAGTTCAAGCATCACC 46 CTTATGAGCATCTGCATATC KM_IND_1237 47 ATCACTCCTAGATGTCGATT 48 AGTCAAGTTCCACTGAGCGC

In one embodiment of the present invention, the rice varieties that can be recognized by the primer set described in Table 1 may be the varieties described in Table 2 below, but are not limited thereto.

mountainous district kind Brand name China japonica Kangrim Moon China japonica Gokrim-do Gate China japonica Tamiki China japonica The House of Representatives China japonica Fill in the House of Representatives China japonica Glossary of Terms China japonica Terms of Money China japonica Sea breeze China japonica US (this week's half of US) China japonica Incense of ten thousand euros Ecological pearl rice China japonica Gold Challenge Yuzu Lake China japonica Oho-quality lake export China japonica High-sea Northeast North America China japonica Identification of reclamation door Waste mine (weight) Australia japonica Sunrice Short grain, Sushi rice Australia japonica Sunrice Australian medium grain, White rice Australia japonica Sunrice Arborio, Risotto rice United States of America japonica Califonia Select (Calrose) United States of America japonica Akitaotome United States of America japonica Calrose Shirakiku Rice United States of America japonica Botan, Calrose-Musenmai rice United States of America japonica Nishiki Premium Grade Rice United States of America japonica Tamaki Gold Rice United States of America japonica Tamanishiki Super Premium Rice Vietnam japonica Super Korean Rice Vietnam japonica Japanese Rice Koshihikari Vietnam japonica Natural Premium Rice Vietnam japonica DS1 Vietnam japonica DS3 India indica indiagate, Basmati rice India indica indiagate, Basmati rice classic India indica Necklace, Basmati rice Thailand indica Sunlee Thailand indica Mah Boonkrong Rice Thailand indica Golden Phoenix China Aroma Gourmet Moon China Aroma Silica, sunlight Australia Aroma Sunrice Australian Topaz Jasmine rice United States of America Aroma Jasmine rice, Three Ladies Brand

In one embodiment of the present invention, an amplification reaction is performed using a genomic DNA isolated from a rice sample as a template and using any one or more primers selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 48, / RTI > And a step of detecting the amplification product.

The step of amplifying the target sequence may be a step of amplifying the target sequence using the primer set for the genomic DNA of the rice variety to be recognized.

The method of extracting the genomic DNA of rice can be carried out by a conventional method known in the art. For example, a CRAB method, a phenol / chloroform extraction method, an SDS extraction method, or the like can be used, or a commercially available DNA extraction kit can be used, but is not limited thereto.

In addition, in the step of amplifying the target sequence, the primer set is selected from the group consisting of 24 primer sets consisting of the nucleotide sequences of SEQ ID NOS: 1 to 48, capable of recognizing the rice varieties described in Table 2 by amplifying the target sequence Means a primer set. Here, " target sequence " means an Indel marker specific to a mutation region.

In addition, amplification of the genomic DNA in the step of amplifying the target sequence can be carried out by PCR, ligase chain reaction, nucleic acid sequence-based amplification, amplification through a transcription-based amplification system, strand displacement amplification or Qβ replicase, or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a primer set that specifically binds to a target nucleic acid using a polymerase. Such a PCR method is well known in the art, and a commercially available kit may be used. The PCR reaction mixture may include genomic DNA isolated from rice varieties, a primer set according to the present invention, an appropriate amount of DNA polymerase, dNTPs, PCR buffer solution and / or water, but is not limited thereto. The PCR buffer solution may include, but is not limited to, Tris-HCl, MgCl ₂ , KCl, and the like.

The step of detecting an amplification product is a step of detecting and / or analyzing the amplification product. Preferably, the analysis of the amplified product can be performed by DNA chip, electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement method, but is not limited thereto. As one method of detecting the amplification product, capillary electrophoresis can be performed. Capillary electrophoresis, for example, can use the ABi Sequencer. In addition, gel electrophoresis can be performed, and gel electrophoresis can utilize agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as 32P or 35S is added to the PCR reaction solution to mark the amplification product, and then the radioactivity is measured using a radioactive measuring device such as a Geiger counter or a liquid scintillation counter A liquid scintillation counter can be used to measure radioactivity. It can also be visualized using a silver salt kit (Bioneer, Daejeon, Korea).

The Indel marker of the present invention searches for an insertion or deletion region of a standard dielectric by comparing and analyzing the genomic information of the genotypes used in the experiment, and based on the information, generates a primer It is. Therefore, the amplification results show two types of bands when the band size is larger than the standard genome or other rice varieties.

Therefore, by using the Indel marker of the present invention, the rice varieties to be recognized exhibit intrinsic amplification results different from the standard genome or other rice varieties, so that the varieties can be recognized by comparing amplification products between them.

Hereinafter, the present invention will be described more specifically in the following examples. However, these examples are provided only to aid understanding of the present invention, and the present invention is not limited thereto.

<Rice DNA Extraction>

DNA extraction from rice of the varieties listed in Table 2 was carried out by the method of Saghai Maroof (1984). Powdered rice was further finely pulverized by adding 5 to 10 ml of CTAB (cetyl trimethyl ammonium bromide), and then put in a 15 ml centrifuge tube and shaken in a 60 ° C water bath for 2 hours or more. 10 ml of a solution of chloroform / isoamyl alcohol (24: 1) was added to each sample, mixed by hand, and centrifuged at 3200 rpm and 4 ° C for 15 minutes. The supernatant was transferred to a new tube and 10 μl (10 mg / ml) of RNase A was added. After 30 minutes, about 2/3 of isopropanol was added and mixed to precipitate the DNA. The precipitated pellet was taken out and added to 20 ml of 70 ° C ethanol and 10 mM NH ₄ OAc overnight. The DNA pellet was dried overnight, and 10 mM NH ₄ OAc and 0.25 M EDTA were added to 1 ml . The extracted DNA was identified on 1% agarose gel together with lambda DNA (100 ng / l) and quantitated at 20 ng / l.

Then, a DNA library was prepared for each of the cultivated DNAs extracted for the purpose of decoding the chromosomal nucleotide sequence, and the nucleotide sequence of each strain was determined according to a standard protocol in a HiSeq 2000 sequencer of Illumina Co., . The resulting 101-bp or 104-bp fragment sequence was used for bioinformatic analysis.

<Mutation area search>

In order to detect the mutation region, SNV (Single nucleotide variation) was detected by comparing the nucleotide sequence information of the variety to be analyzed with a standard genome (Korean domestic rice) in 10kb using a computer program. At this time, when the number of single base mutations (SNV) showing a difference from the standard dielectric genome information is 4 or more per 10 kb, the present invention defines it as a dense mutation block (DMB).

Specifically, when adjacent mutation areas immediately adjacent to each other are within the 90 kb interval, they are collectively indicated as one mutation area. Regions other than the mutation region are represented as a common region without mutation, and when the neighboring common region is within the 30 kb interval, the same region is displayed.

<Selection of Indel Markers Specific to Variation Region>

In order to select mutant region-specific Indel markers, the primer 3 program was designed in the region containing 5 bp or more Indel in the mutation region based on the nucleotide sequence analyzed above. The expected size of the amplified product was about 100 to 150 bp Respectively.

The PCR reaction mix was performed with 10 μl of 20 ng of genomic DNA, 0.4 pmoles of each primer and 5 μl of GoTaq Green Master Mix (Promega, Madison, WI, USA) . PCR amplification was carried out using a Biometra thermocycler (Biometra, Gottingen, Germany) for 5 min at 95 ° C for denaturation, denaturation at 95 ° C for 30 sec, annealing at 48 ° C for 30 sec , And extension at 72 ° C for 30 seconds. The amplification was finalized at 72 ° C for 10 minutes, and the PCR amplification was terminated at 4 ° C. The amplified PCR product was loaded on a 3% agarose gel and then run at 150V for 60 to 80 minutes. After electrophoresis, the band was stained with EtBr (Ethidium bromide), and the band was confirmed by UV.

The first 12,174 markers were designed based on the genome decode information to select the Indel marker specific to the mutation region. Based on the above information, 595 Indel marker primers were prepared. Twenty-four markers were selected to accurately amplify the two band types characteristic of Indel markers (Table 1).

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described examples are illustrative in all aspects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, as well as all changes or modifications derived from the meaning and scope of the appended claims and their equivalents.

Claims (3)

And at least one primer set selected from the group consisting of the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 48.
The method according to claim 1,
The composition comprises a primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2, a primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4, a primer set consisting of SEQ ID NO: 5 and SEQ ID NO: 6, A primer set consisting of SEQ ID NO: 9 and SEQ ID NO: 10, a primer set consisting of SEQ ID NO: 11 and SEQ ID NO: 12, a primer set consisting of SEQ ID NO: 13 and SEQ ID NO: 14, a SEQ ID NO: A primer set consisting of SEQ ID NO: 17 and SEQ ID NO: 18, a primer set consisting of SEQ ID NO: 19 and SEQ ID NO: 20, a primer set consisting of SEQ ID NO: 21 and SEQ ID NO: 22, a primer set consisting of SEQ ID NO: And SEQ ID NO: 24, a primer set consisting of SEQ ID NO: 25 and SEQ ID NO: 26, a primer set consisting of SEQ ID NO: 27 and SEQ ID NO: 28 A primer set consisting of SEQ ID NO: 29 and SEQ ID NO: 30, a primer set consisting of SEQ ID NO: 31 and SEQ ID NO: 32, a primer set consisting of SEQ ID NO: 33 and SEQ ID NO: 34, A primer set consisting of SEQ ID NO: 37 and SEQ ID NO: 38, a primer set consisting of SEQ ID NO: 39 and SEQ ID NO: 40, a primer set consisting of SEQ ID NO: 41 and SEQ ID NO: 42, , A primer set consisting of SEQ ID NO: 45 and SEQ ID NO: 46, and a primer set consisting of SEQ ID NO: 47 and SEQ ID NO: 48.
Amplifying the target sequence by performing amplification reaction using at least one primer selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 48, using the genomic DNA isolated from the rice sample as a template, and amplifying the target sequence; And
And detecting the amplification product.