KR102032502B1 - SNP markers for discriminating color of Flammulina velutipes and use thereof - Google Patents

Abstract

The present invention relates to an SNP primer set for identifying the color of Flammulina velutipes, comprising one or more primer sets selected from the group consisting of: a primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2; a primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4; a primer set consisting of SEQ ID NO: 5 and SEQ ID NO: 6; a primer set consisting of SEQ ID NO: 7 and SEQ ID NO: 8; and a primer set consisting of SEQ ID NO: 9 and SEQ ID NO: 10. In addition, the present invention relates to a kit for identifying the color of Flammulina velutipes, comprising the primer sets; a composition for HRM analysis; and a method for identifying the color of Flammulina velutipes. Accordingly, an SNP marker that is first confirmed in the present invention and a primer set capable of detecting the same can be used to identify the color of Flammulina velutipes in an accurate and effective manner, and thus can be utilized as a composition for identifying the color of Flammulina velutipes. Furthermore, in the process of cultivating Flammulina velutipes, without necessarily cultivating a particular variety and strain, the color thereof can be identified in advance at a hyphal growth step, thereby enabling an early selection, and the base research material for investigating color-associated genes can be provided.

Description

SNP markers for discriminating color of enoki mushroom and use thereof {SNP markers for discriminating color of Flammulina velutipes and use kind}

The present invention provides a primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2; A primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4; A primer set consisting of SEQ ID NO: 5 and SEQ ID NO: 6; A primer set consisting of SEQ ID NO: 7 and SEQ ID NO: 8; And it relates to the SNP primer set for determining the mushroom color, including any one or more primer sets selected from the group consisting of a primer set consisting of SEQ ID NO: 9 and SEQ ID NO: 10.

In addition, the present invention relates to a kit for determining the color of the mushrooms, the composition for HRM analysis and the color of the mushrooms, including the primer set.

Flammulina velutipes belongs to Agaricales mulberry ( Physalacriaceae ), which are used in Korea. Enoki mushrooms are also known as winter mushrooms, which are caused by the fruiting bodies of the enoki mushroom at low temperatures of 4-12 ° C and in the natural state during the winter months of November to April. Enoki mushrooms are called Enokitake in Japan and are cultivated in low temperature, especially in Asia. According to the Ministry of Agriculture, Food and Rural Affairs, Korea's production of top mushrooms in 2014 was 33,259 tons, the third highest after oysters and big oyster mushrooms. In 2014, mushroom exports were exported in the order of top, bird, zelkova, matsutake, shiitake, ganoderma lucidum, mushroom, tree, and others. The top exports of the top mushrooms (10,236 M / T, $ 18,131,000) indicate that the top mushrooms in Korea are industrially important. Until now, Korean oyster mushroom varieties have been mainly developed in Japan, and have been used to select the strains suitable for our growing conditions.

Molecular marker is a method of expressing polymorphism between individuals in the difference of DNA sequence, which is the essence of genetic phenomena, and is a marker using microsatellite or gene sequence consisting mainly of repetitive simple sequences, or RFLP (Restriction Fragment Length Polymorphism) Probes or SNP (Single Nucleotide Polymorphism) markers are used. In particular, the RAPD (Random-Amplified Polymorphic DNA) method is most commonly used because of the ease and simplicity of analysis among various analytical methods. However, the results may vary depending on reaction conditions, and thus it is difficult to expect reproducible experimental results. In order to solve this problem, using a rapidly developed sequencing technique, a method of preparing a new single nucleotide polymorphism (SNP) primer representing a polymorphism between varieties can be used to perform PCR. Since SNP markers are not affected by the environment such as reaction conditions, compared to other PCR markers, SNP markers can be used as more accurate and detailed molecular markers, and HRM (High Resolution Melting) method can be used to identify PCR products (agarose gel loading). Etc.) can be omitted.

Korean Patent Laid-Open Publication No. 10-2016-0106809 relates to an enoki mushroom variety specific gene marker and its use, and provides a composition that can distinguish Greenpeace F6 enoki mushroom. However, no research or description of a composition capable of distinguishing the color of the enoki mushroom using the SNP primer has been disclosed.

Accordingly, the present inventors can distinguish the color of the mushrooms by analyzing the genome single nucleotide polymorphisms (SNPs) of representative domestic and overseas strains of the genus of the mushroom family, based on the standard dielectric information of the mushrooms prepared for the first time in the present invention. It was confirmed that the present invention was completed.

Accordingly, an object of the present invention is a primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2; A primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4; A primer set consisting of SEQ ID NO: 5 and SEQ ID NO: 6; A primer set consisting of SEQ ID NO: 7 and SEQ ID NO: 8; And to provide a single Nucleotide Polymorphism (SNP) primer set for determining the mushroom color, including one or more primer sets selected from the group consisting of a primer set consisting of SEQ ID NO: 9 and SEQ ID NO: 10.

Still another object of the present invention is to provide a kit for determining a mushroom color, a composition for analyzing an HRM or a mushroom mushroom color, including the primer set.

In order to achieve the above object, the present invention is a primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2; A primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4; A primer set consisting of SEQ ID NO: 5 and SEQ ID NO: 6; A primer set consisting of SEQ ID NO: 7 and SEQ ID NO: 8; And it provides a single Nucleotide Polymorphism (SNP) primer set for determining the mushroom color, including any one or more primer sets selected from the group consisting of a primer set consisting of SEQ ID NO: 9 and SEQ ID NO: 10.

According to a preferred embodiment of the present invention, the top mushroom color may be white or brown.

The present invention also provides a kit for determining the color of the mushrooms, which includes the primer set.

According to a preferred embodiment of the present invention, the kit may be for high resolution melting (HRM) analysis.

According to a preferred embodiment of the present invention, the kit may further comprise a DNA polymerase, dNTPs and a PCR reaction buffer.

The present invention also provides a composition for HRM analysis for determining the color of the mushrooms containing the primer set.

According to a preferred embodiment of the present invention, the composition may further comprise a DNA polymerase, dNTPs and PCR reaction buffer.

The present invention also includes the steps of a) extracting genomic DNA (genomic DNA) from the top mushroom to determine the color;

b) amplifying DNA using the extracted genomic DNA as a template and performing PCR using the SNP primer set; And

c) high-resolution melting (HRM) analysis of the amplified DNA product; It provides a method for determining the color of the enoki mushroom comprising a.

According to a preferred embodiment of the present invention, the genomic DNA of step a) may comprise a sequence of any one or more sequence numbers selected from the group consisting of SEQ ID NO: 11 to 15.

According to a preferred embodiment of the present invention, d) HRM analysis of the SNP primer set of step b),

In the case of primer sets consisting of SEQ ID NO: 1 and SEQ ID NO: 2, the melting temperature (melting temperature) is determined as a white top if the melting temperature (78 ~ 79 ℃), brown top if 77.5 ~ 78.5 ℃;

In the case of the primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4, the melting temperature (melting temperature) is 81 ~ 83 ℃ to determine the white top, 82 ~ 84 ℃ to determine the brown top;

In the case of primer sets consisting of SEQ ID NO: 5 and SEQ ID NO: 6, the melting temperature (melting temperature) is determined as white top if the melting temperature (79.5 ~ 81 ℃), brown top if 78 ~ 80 ℃;

In the case of primer sets consisting of SEQ ID NO: 7 and SEQ ID NO: 8, the melting temperature is determined as a white top when the melting temperature is 81-83 ° C., and a brown top when 80-82 ° C .; And

If the primer set consisting of SEQ ID NO: 9 and SEQ ID NO: 10 is the melting temperature (melting temperature) is 84.5 ~ 86 ℃ white top, if the 84 ~ 85.5 ℃ to determine the brown top; may be additionally included.

Therefore, when utilizing the SNP marker first identified in the present invention and a primer set capable of detecting the same, it is possible to accurately and effectively determine the color of the mushroom, which can be utilized as a composition for determining the mushroom color. This enables early selection of the color at the mycelial growth stage without the need to cultivate certain varieties or strains in the enoki mushroom breeding process, and can provide basic research data for searching for color-related genes.

Figure 1 shows the chromosomes with homozygous SNPs of the recessive (aa) type of white enoki mushroom. Red portions indicate regions of white trait candidates, which were found to be concentrated on chromosomes 1, 4, 7 and 11.
Figure 2 shows the results of the general PCR of the primer sets of the present invention. Except for primer sets 1, 3, 4, 5, 19 and 29, the remaining 25 primer sets showed a single band.
Figure 3 shows the results of the color discrimination of the top mushrooms by HRM analysis using the finally selected primer sets 6, 10, 11, 15 and 16. The primer sets were able to clearly distinguish the color of the mushrooms.

Hereinafter, the present invention will be described in more detail.

As described above, in the prior art, a biomarker capable of effectively distinguishing the color of an enoki mushroom is not known, and biomarkers which are mainly used have a problem in that a discrimination result may vary depending on reaction conditions, thereby more precise and detailed molecular labeling. There is a need for research.

SNP composition to primer set for determining the color of the mushrooms according to the present invention can effectively determine the color of the mushrooms of white or brown, especially when used in conjunction with the HRM analysis can more easily and distinctly determine the color of the mushrooms It is effective as a composition for determining the color of mushrooms.

The SNP of the present invention may be all or part of a polynucleotide including the SNP region of the KACC 42780 (NCBI: 16873) gene, and more specifically, the base of any one or more sequence numbers selected from the group consisting of SEQ ID NOs: 11 to 15 It may be a polynucleotide comprising a sequence or an SNP marker for determining an enoki mushroom color including a complementary polynucleotide thereof. The color is a color of an enoki mushroom, preferably white or brown, but is not limited thereto. Specifically, the color discrimination may be to determine that the color of the top mushroom is white when the 299th base in the sequence of SEQ ID NO: 11 is C, brown in the case of A; Or the marker may be determined to be white when the 299 base is T in the sequence of SEQ ID NO: 12 and white when A is brown; Or the marker is white when the 299th base in the sequence of SEQ ID NO: 13 is C, and may be determined to be brown when T; Or the marker may be determined to be white when the 299th base in the sequence of SEQ ID NO: 14 is C and brown in T; Alternatively, the marker may be determined to be white when the 299th base in the sequence of SEQ ID NO: 15 is C, and brown when T is T.

As used herein, the term “SNP marker” refers to a single base polymorphic allele base pair on a DNA sequence used to identify an individual or species. SNPs are relatively frequent, stable and distributed throughout the genome, resulting in genetic diversity of individuals, so that SNP markers can serve as indicators of genetic proximity between individuals. SNP markers generally include a change in phenotype associated with single base polymorphism, but in some cases may not. In the case of the SNP marker of the present invention, it may represent a change in the phenotype of the individual such as a variation of the amino acid sequence or the color of the mushroom. In particular, the SNP of the white oyster mushroom is known to be recessive. In the SNP selection process of the present invention, the SNP of the white oyster mushroom is homozygous SNP (aa type), and the SNP of the brown oyster mushroom is homozygous or heterozygous SNP (AA or Aa type). Proceeded to be.

The term "individual" of the present invention refers to an enoki mushroom that is to be determined for color, and by using a sample obtained from the enoki mushroom, the color of the enoki mushroom can be determined by analyzing the genotype of the SNP marker. The sample may be, for example, spores, pods, mycelium (fruiting bodies), isolated tissues, or separated cells of the enoki mushroom, but is not limited thereto.

The agent capable of detecting or amplifying the SNP marker refers to a composition capable of determining the color of the fungus by detecting a polymorphic site of the gene through detection or amplification, and preferably, of the SNP marker. By primer sets or probes capable of specifically detecting or amplifying polynucleotides.

The primers used for amplifying the SNP markers are template-directed DNA under appropriate conditions (e.g., four other nucleoside triphosphates and polymerizers such as DNA, RNA polymerase or reverse transcriptase) in appropriate buffers and at appropriate temperatures. It can be a single stranded oligonucleotide that can act as a starting point for the synthesis. The appropriate length of the primer can vary depending on the intended use, but is typically 15 to 30 nucleotides. Short primer molecules generally require lower temperatures to form stable hybrids with the template. The primer sequence need not be completely complementary to the SNP marker, but should be sufficiently complementary to hybridize with the SNP marker. The primer provided in the present invention was intended to produce a primer size within the range of 18 ~ 24bp so that the size of the amplification product is in the range of 80 ~ 150bp, preferably any one or more sequence numbers selected from the group consisting of SEQ ID NO: 1 to 10 It may comprise a polynucleotide sequence consisting of the sequence of.

As used herein, the term "primer" refers to a base sequence having a short free 3 'hydroxyl group, capable of forming complementary templates and base pairs and starting for template strand copying. It refers to a short sequence that functions as a point and is mainly used in the form of a primer set that amplifies a specific section. Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures. At this time, the length of PCR conditions, sense and antisense primers can be modified based on what is known in the art.

Primer sets used in the present invention are SEQ ID NO: 1 and 2; Or SEQ ID NOs: 3 and 4; Or SEQ ID NOs: 5 and 6; Or SEQ ID NOs: 7 and 8; Or SEQ ID NOs: 9 and 10; It may be composed of the base sequence of.

As used herein, the term “probe” is a DNA or RNA nucleotide sequence of various lengths, labeled with a radiolabel or fluorescent label, and is composed of a single strand of nucleotide sequence and is specific to a single stranded DNA or RNA having a complementary sequence. It is characterized in that the hybridization by combining with each other, the target can be detected by a method of detecting the label signal of the hybridized probe.

Primers or probes of the invention can be chemically synthesized using phosphoamidite solid support methods, or other well known methods. Such nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, eg, uncharged linkages such as methyl phosphonate, phosphoester, phosphoro Amidate, carbamate, and the like) or charged linkers (eg, phosphorothioate, phosphorodithioate, etc.).

Accordingly, the present invention provides a primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2; A primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4; A primer set consisting of SEQ ID NO: 5 and SEQ ID NO: 6; A primer set consisting of SEQ ID NO: 7 and SEQ ID NO: 8; And it can provide a single nucleotide polymorphism (SNP) primer set for determining the mushroom color, including any one or more primer sets selected from the group consisting of a primer set consisting of SEQ ID NO: 9 and SEQ ID NO: 10.

The top mushroom color of the present invention is preferably white or brown, but is not limited thereto.

In another aspect, the present invention, it can provide a kit for determining the color of the mushrooms, including the primer set.

The kit of the present invention can be used without limitation as long as the kit can determine the color of the mushrooms by using the SNP marker of the present invention, it is preferable that the kit for HRM (High Resolution Melting) analysis.

The kit of the present invention preferably further comprises a DNA polymerase, dNTPs and a PCR reaction buffer, but is not limited thereto.

The HRM analysis kit can determine the color of the mushrooms by amplifying and reading the genotype of the SNP marker, which is a marker for identifying the mushroom color, or by detecting a small difference in the PCR dissociation curve. Specifically, the HRM analysis kit for determining the color of the mushrooms provided in the present invention is characterized by the difference in the degree of dissociation of the double strands according to some variation of all or part of the polynucleotide including the SNP region of the KACC 42780 (NCBI: 16873) gene. It may be a kit to detect and determine the genotype.

The "high resolution melting (HRM) analysis" technique is a relatively new post PCR analysis method used to identify variations in nucleic acid sequences, based on detecting small differences in PCR dissociation curves. do. This is made possible by the improved double stranded DNA (dsDNA) with the dye used in connection with the PCR instrument. The difference in the degree of dissociation with the temperature of dsDNA can be analyzed and processed using specially designed software for HRM analysis. In the present invention, HRM analysis was used to determine the color of the mushroom, and melting temperature (Melting temperature) is preferably viewed as a temperature at which the Fluoroscence value is halved.

In another aspect, the present invention, it can provide a composition for analysis of high resolution melting (HRM) for the determination of the color of the mushrooms containing the primer set.

Since the HRM analysis is the same as the HRM analysis of the kit for determining the color of the mushroom, the description is replaced by the description thereof.

The composition of the present invention preferably further comprises a DNA polymerase, dNTPs and a PCR reaction buffer, but is not limited thereto.

In addition, the present invention, a) extracting genomic DNA (genomic DNA) from the top mushroom to determine the color;

b) amplifying DNA using the extracted genomic DNA as a template and performing PCR using the SNP primer set; And

c) A method for determining the color of the mushrooms, including the step of high-resolution melting (HRM) analysis of the amplified DNA product.

The genomic DNA of step a) of the present invention preferably comprises a sequence of any one or more sequence numbers selected from the group consisting of SEQ ID NOs: 11 to 15.

The amplifying step b) may be any method known to those skilled in the art. For example, the target nucleic acid can be amplified by PCR and purified. Other ligase chain reactions (LCRs), transcription amplifications and self-sustained sequence replications and nucleic acid based sequence amplifications (NASBAs) can be used.

Since the HRM analysis is the same as the HRM analysis of the kit for determining the color of the mushroom, the description is replaced by the description thereof.

The color discrimination method of the present invention is d) HRM analysis, if the SNP primer set of step b) is a primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2 melting temperature (melting temperature) is 78 ~ 79 ℃ white top If, 77.5 ~ 78.5 ℃ is determined by the brown top; In the case of the primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4, the melting temperature (melting temperature) is 81 ~ 83 ℃ to determine the white top, 82 ~ 84 ℃ to determine the brown top; In the case of primer sets consisting of SEQ ID NO: 5 and SEQ ID NO: 6, the melting temperature (melting temperature) is determined as white top if the melting temperature (79.5 ~ 81 ℃), brown top if 78 ~ 80 ℃; In the case of primer sets consisting of SEQ ID NO: 7 and SEQ ID NO: 8, the melting temperature is determined as a white top when the melting temperature is 81-83 ° C., and a brown top when 80-82 ° C .; And in the case of the primer set consisting of SEQ ID NO: 9 and SEQ ID NO: 10, the melting temperature is 84.5 to 86 ° C., the white top, and 84 to 85.5 ° C., the brown top.

More preferably, when the SNP primer set of step b) is a primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2, the melting top temperature is 78.5 to 79 ° C, white top, and 78 to 78.5 ° C, brown top. Determine as; In the case of primer sets consisting of SEQ ID NO: 3 and SEQ ID NO: 4, the melting temperature (melting temperature) is determined as white top if the melting temperature (81.5 ~ 82.5 ℃), brown top if 82.5 ~ 83 ℃; In the case of primer sets consisting of SEQ ID NO: 5 and SEQ ID NO: 6, the melting temperature is determined as a white top when the melting temperature is 80 to 81 ° C, and a brown top when the temperature is 79 to 80 ° C; In the case of primer sets consisting of SEQ ID NO: 7 and SEQ ID NO: 8, the melting temperature is determined as a white top when the melting temperature is 81.5-82.5 ° C., and brown top when 81-82 ° C .; And in the case of the primer set consisting of SEQ ID NO: 9 and SEQ ID NO: 10, determining that the melting temperature is 85 to 85.5 ° C. as the white top, and 84.5 to 85.5 ° C. as the brown top.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not limited and interpreted by these examples.

Use of Disclosure Strains

The strains used for SNP marker analysis of the present invention, as described in Table 1 below, belong to the genus Flammulina among the genetic resources that are collected and preserved by the Rural Development Administration mushroom family as a public strain, different species, Species such as the F. velutipes species, but different varieties, and representative strains with different characteristics in the same species collection area were included. B stands for brown, LB stands for light brown, and W stands for white.

Genomic DNA Extraction

In order to isolate the genomic DNA of 25 strains used in the test, inoculated with mycelium in potato dextrose agar (PDA) and incubated in an incubator at 25 ° C. for 7 days, the mycelia were harvested and lyophilized and used in the experiment. DNA is placed in a 1.5 ml tube with the amount of sample in the 0.05 ~ 0.1 ml position of the tube, close the lid and put in liquid nitrogen. To crush the samples, sterilized rods or beads were used to quickly remove liquids from the nitrogen before the quenched samples melted. After adding 900 μl of extraction buffer, cetyl trimethyl ammonium bromide (CTAB) buffer, the samples were vortexed again. After treatment at 65 ° C. for 1 hour in a water bath, 450 μl of chloroform was added, followed by tapping for about 5 minutes to react at room temperature, followed by centrifugation at 12,000 rpm and 20 ° C. for 10 to 15 minutes. 600 μl of the supernatant was collected and transferred to a new tube, and then 5 μl RNase-A (10 mg / ml) was added thereto and treated at 37 ° C. for 30 minutes. After the treatment, 600 μl isopropanol was added and tapped for about 1 minute, followed by centrifugation at 12,000 rpm, 20 ° C., and 10 to 15 minutes, and only the supernatant was discarded while leaving pellets under the tube. Centrifuge 12,000rpm, 20 ℃, and 10 minutes by adding 500 µl of 70% ethanol, discard the supernatant, wash twice with ethanol, and dry at room temperature for about 30 minutes. After adjusting according to the 50 ~ 100 ㎕ put pellets to melt and stored at 4 ℃.

Enoki Mushroom resequencing  Genome-wide SNP Analysis Using Data

A short read (Solexa QA package) was used to obtain analytical quality data [8], and the consensus sequence of each sample was extracted through read mapping BWA (Burrows Wheeler Aligner). We used SNP detection (SAM tools), a program that can read, write, edit, and view files in SAM (Sequence Alignmint / Map) format. Using the SNP filtered through the process and variation, a sequence of 25 strains of the fungus was performed in multiple sequence alignment (clustalW: EBI's tool for comparing two sequences).

Sequence preprocessing

The sequencing data of the top mushrooms produced by the Next Generation Sequence (NGS) was collected from a public database (http://112.220.192.2/mushroom/) operated by the Mushroom Division. The top 25 mushrooms were composed of next-generation sequencing (Hi-seq 2000; Theragen Etex, Suwon, Korea) data. Genome-wide SNPs were extracted by comparative analysis with KACC42780 (4019-20).

The pretreatment process was performed using the DynamicTrim and LengthSort programs of the Illumina Hiseq platform / Solexa QA (v.1.13) package, which measures the sequence quality and filters the sequences to higher quality standards. Dynamic Trim cuts bad quality bases at both ends of the short reads according to the phred score and refines them with high quality cleaned reads. LengthSort performed the process of removing too many base truncated reads from DynamicTrim. The phred score ≥ 20 of the Dynamic Trim and the LengthSort process performed a short read length ≥ 25bp.

Alignment of standard dielectrics

In BWA, mapping to the reference genome with short reads is the most basic analysis of bioinformatics for the genome. The cleaned reads that passed the pretreatment were aligned with the standard dielectric using BWA (0.6.0-r104), and the mapping was performed to select the raw SNP (In / Del) between the standard dielectric and the sequenced samples. As a process, it creates a file in Binary Alignment / Map (BAM) format, and the following options are applied. Maximum number of gap extensions (-e) = 50, seed length (-l) = 30, maximum differences in the seed (-k) = 1, number of threads (-t) = 16, mismatch penalty (-M) = 6, gap open penalty (-O) = 15 and gap extension penalty (-E) = 8. The genome reanalysis data were combined into one file after alignment with the standard dielectric material, and then subjected to SNP analysis.

Raw SNP detection and consensus sequence extraction

Both BAM and SAM have sequence information. BAM file is same as SAM file, but reference sequence names and lengths are included in the header. Also, we used indexing technique to find the desired sequence quickly. BAM format files generated by mapping clean reads to standard dielectrics were selected from raw SNPs (IN / Del) using SAMtools (v0.0.16), and consensus sequences were extracted. Default values were used other than the SAM tools use option. Minimum mapping quality for SNPs (-Q) = 30, minimum mapping quality for SNPs (-q) = 15, minimum read depth (-d) = 3, minimum read depth (-D) = 100, min indel score for nearby SNP filtering (-G) = 30, SNP within INT bp around a gap to be filtered (-W) = 15, window size for filtering dense SNPs (-W) = 15. In order to select high-precision SNP from the extracted SNP results, the mapping quality value was applied to 30 higher than the default value of 25 and filtered by SNP with raw reads.

Creation of SNP Matrix

An integrated SNP matrix was prepared to perform SNP comparison between the top mushroom analyzes. The raw SNP position obtained by comparing each sample with the standard dielectric was used as a candidate, and a list of unions was constructed. At this time, a blank region (non-SNP loci) was prepared by filling the matrix from the consensus sequence of the sample. Subsequently, the SNP comparison is performed to filter mis-calling SNPs, and the SNP type classification criteria are homozygous when the SNP read depth accuracy is higher than 90%, heterozygous when the SNP read depth is 50%, and homozygous and heterozygous types. If not distinguished, it was classified as other.

As a result, the common SNPs of the white (7 species) and brown (10 species) top mushroom varieties having good quality (quantity or quality) of DNA extracted from the 25 species of mushrooms of Table 1 were selected ( Table 2). SNPs of the white top mushroom were 131,874 homozygous type, and 470,947 SNPs of the brown top mushroom were homozygous or heterozygous type.

Selection of white trait-related candidate region

Through seven common SNPs, 131,874 genes with the same aa type (homozygous SNP) were selected as white trait candidate regions based on the gene unit. As shown in FIG. 1, the white top common SNP (aa type) was concentrated in the regions of chromosomes 1, 4, 7, and 11. In FIG. 1, the portion indicated in red represents a white trait candidate region.

Selection of polymorphic SNPs between white and brown tops

It was confirmed that 14,749 polymorphic SNPs between white and brown tops were selected, and regions having other traits (AA or Aa type) other than aaa type were selected in the candidate region of white morphology.

As a result, 240 polymorphic SNPs were selected.

Primer preparation and screening for HRM analysis

From the SNPs selected in [Example 9] through general PCR, molecular markers substantially functioning as SNPs were separated and used as primers for HRM analysis.

Specifically, the primers are 31 HRMs out of 240 polymorphic SNPs selected between the white and brown tops selected in [Example 9] using Primer3 (ver.0.4.0) with a size of about 100pb including each SNP position. A primer set was prepared, and a general PCR was used to select only a primer set in which a single band was identified. This means that if multiple bands appear, it means that the primer binds to various parts of the sequence and amplifies all of them, and when used for HRM analysis, the exact melting value is not obtained.

As a result, as shown in FIG. 2, single bands of the remaining 25 primer sets except for primer sets 1, 3, 4, 5, 19, and 29 were confirmed.

HRM analysis through real time PCR

The white population consists of four white strains and four new white strains used in next generation sequencing (NGS), and the brown population consists of nine brown strains and new brown strains used in next generation sequencing (NGS). Composed of three species, specifically used strains are shown in Table 3 below.

Specifically, in order to amplify the SNP marker, real-time PCR using a mixture of 1 μl of 50 ng of genomic DNA, 12.5 μl of 2X Type it HRM PCR kit (Qiagen, USA), and 1.75 μl and DW 8 μl of each primer set of 10 pmol Was performed. An amplification product was prepared by repeating 40 seconds of 10 seconds at 95 ° C and 30 seconds at 55 ° C, starting with preliminary denaturation at 95 ° C for 5 minutes in a real time PCR reaction. After confirming that this primer set amplifies only one PCR band in each enoki mushroom variety, the amplification product was analyzed at 0.1 ° C every 2 seconds through the Roter-gene Q High-Resolution Melt system (Qiagen, USA) during HRM analysis. Melting at 65 ℃ to 95 ℃ as the temperature rise was confirmed the genotype of the mushrooms with the SNP marker genotype using Precision Melt Analysis Software (Bio-Rad, Hercules, CA, USA), and confirmed the color of these mushrooms It was.

As a result, as shown in FIG. 3, 5 sets (HRM-primer 6, HRM-primer 10, HRM-primer 11, HRM-primer 15 and HRM) among the 25 SNP primer sets of [Example 10] -primer 16 means primer sets 6, 10, 11, 15, and 16, respectively), which clearly distinguished white and brown tops. Specifically, when HRM analysis was performed with primer set 6, the melting temperature was 78.5 ° C. for the white top and 78˜78.3 ° C. for the brown top; When HRM analysis was performed with primer set 10, the melting temperature was 81.5-82 ° C. for white tops and 82.5-83 ° C. for brown tops; When HRM analysis was performed with primer set 11, the melting temperature was 80 ° C. for the white top and 79.5 ° C. for the brown top; When HRM analysis was performed with primer set 15, melting temperature was 82 ° C. for white tops and 81.5-82 ° C. for brown tops; When HRM analysis was performed with primer set 16, it was confirmed that the melting temperature was 85 to 85.5 ° C. for the white top and 84.5 to 85 ° C. for the brown top.

The common characteristic of the five SNP markers was that there was little variation in the melting curve of white, but the variation of melting curve in the same brown was greater than white. It was interpreted that the phenotypic characteristics of brown tops with large polymorphism were reflected in the melting curve. The sequence numbers for the five SNP primer sets are as described in the following [Table 4] and [Table 5].

primer  Set number primer  order SEQ ID NO: 6 F  TCCAAATAATCAGCGTGGTG One R  GGGTCATTGGAAGAGGCTTT 2 10 F  CGTTCGCATATCCATTGTTG 3 R  AGGACCTTCGAGGGATGAAT 4 11 F  GCTGTTTGAAGGCACGATTT 5 R  TAGCTTCGACGTTCAATACCC 6 15 F  CGGTCTGTCTTGCTCTTGCT 7 R  AGCATCCACAACCGCTTTAG 8 16 F  CACCACCATGTCTGCCTCT 9 R  TTAATGCGTACGGTGATTGG 10

Primer set number SNP site SEQ ID NO: 6 intergenic 11 10 chr04_NT_00651 12 11 intergenic 13 15 chr07_NT_00409 14 16 intergenic 15

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> SNP markers for discriminating color of Flammulina velutipes and          use <130> 1064552 <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer6_F <400> 1 tccaaataat cagcgtggtg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer6_R <400> 2 gggtcattgg aagaggcttt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer10_F <400> 3 cgttcgcata tccattgttg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer10_R <400> 4 aggaccttcg agggatgaat 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer11_F <400> 5 gctgtttgaa ggcacgattt 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer11_R <400> 6 tagcttcgac gttcaatacc c 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer15_F <400> 7 cggtctgtct tgctcttgct 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer15_R <400> 8 agcatccaca accgctttag 20 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer16_F <400> 9 caccaccatg tctgcctct 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer16_R <400> 10 ttaatgcgta cggtgattgg 20 <210> 11 <211> 599 <212> DNA <213> Artificial Sequence <220> <223> primer6_intergenic <400> 11 aggccccggc gctcccggct gacctcgctt cggagctcgc tgcgtacgac gcctctgagc 60 ccaccatcgc agacgccccg gcagccaccg catccgtcgt cgaaggcgag accgcaggcg 120 gtgccgccgc ttacttggat ttccttgagg cggacctccc caagccagag gcgcaccatc 180 attagagatt gtcatggaca tggaaatata actgctgttt gactgtcctc catcttgtct 240 ggacactatc acatatgtcc aaataatcag cgtggtgaag cagccaagta attttaaaca 300 acctcaggac tcgccttaca aaagcctctt ccaatgaccc aactgtcgcg ctttgccgta 360 ctgtatacga acgactaggc ctatgcactt gatggtaacg atttacgaca tcgtaacatt 420 catcgttggc ttcatctatg ctgtagatca agttttccag acaattgttg aaaactcttc 480 cacgcggtat gtagacacca aaaggttcgt ctgtgagatg agcggacatt ttgtatctgt 540 ataatcacgg ttgtcaattg ggcagtatgt atgggccccc ttacaactta tatagagtt 599 <210> 12 <211> 599 <212> DNA <213> Artificial Sequence <220> <223> primer10_chr04_NT_00651 <400> 12 aacttggcgg ccaattggta tgaagaggac gactgtggcg tggatggtga gatgggcgac 60 gcgctggttg acgctgagct gctggaggac gatgaaggga ttgtgagatg gatcgactgt 120 ttgcgccctt gcggagggaa gtctgcgcga ggcctaagga ataaggcggt tagtaagaaa 180 gaacacgcta gtaaagtagc aacgcacggg taaggaggtg tcgaaataga tctccttctc 240 tctcgcgttc gcatatccat tgttggatac tccggctcgg gatatacggc gcgttcttgc 300 catcggagcg taaccgttgg agtacggcgg cagtgttatc tacattcatc cctcgaaggt 360 cctccaatgc cgaaatcggt ggtaacgcgt atgaagacgg tgcagaccgt gataatcgtg 420 agtccgagcg accagggtgg ataggcggga gaataatggt atccgaaggg taagaggtaa 480 cgtcaggcga gttatcagga tacgatactc ggggagcgtt ggtcgccttt ggagggtagg 540 gagtataccg agaaggcgat ggtgctatag gctggcgcgc gactccggat gatgcatgc 599 <210> 13 <211> 599 <212> DNA <213> Artificial Sequence <220> <223> primer11_intergenic <400> 13 gatactgatg agaaaatgtt gcctacagtg gggtgggaga gcctcaagcc atttattgag 60 gttagaatca aagtgcatta taatatccga gtctgtgggt cgttgttgtc cgtcgcatag 120 gcgtaaaggc tgccgtacgg agtactgtcg atattgtcag aaacacaatc tgggttttca 180 acgcgacata caacgagatt cttgatgtag aataagagcg tcgtcaattt tagaaggtgg 240 acgaagtacg tgatagaaga atgcgtcccg ggtggctgtt tgaaggcacg attttcgtca 300 cgttctccca gtattcgtcg tcgcattcca gtgggtattg aacgtcgaag ctagtcttcc 360 attagaaaag ttctagaaca aaacagctac tcactcctca tattgaaggg caaaagggcg 420 accaagtatc gtgttgtggg tgacatcaag aaagaagagc accctacata aaggtcagtg 480 tggaaaacga agatagctgg aatcagcttg ccaaaaagct cgtttccaga gctcatttgt 540 tacgtttggg ggaccgctac ggcgcatgtg ggccccagca tcgaataagc gacggaagc 599 <210> 14 <211> 599 <212> DNA <213> Artificial Sequence <220> <223> primer15_chr07_NT_00409 <400> 14 atagcactga aaccacctgg aacgtacaag ccctggaact gcagtccgtg taatcaaggc 60 gcccctctag taccattcca ggagttcaac aatgacacga tctcgactcc tactacggct 120 cccgcctttg aggcggcagc tgcaccatcg gcatgcacga aaaccactac acgaccaaca 180 agcactccca ctccgaccag cgatgctgca acgaatgctg ctgaagcagc tgccgccgcc 240 gccgctgcac aagccggtct gtcttgctct tgctttgtag atgaagcctg atcaatattg 300 gttcacagct cttgcaagcg ctaacgaatc tgctgctact atggctgcag ctaaagcggt 360 tgtggatgct gccaaggctg cagctgccgc cgctgccgta gcagcagcag cggtaagtag 420 tagacatcat ctagcttact ttccagtatc gctgaatata tttatcaggc cgtcgcaaat 480 actccggcag ccatggcgtc cgcaattgcg tctgcaacat atgcacaaca ggcacttgaa 540 tctgcacttg cctctctcac taacattttc ggtactggga cgattccagc ttcgattgc 599 <210> 15 <211> 599 <212> DNA <213> Artificial Sequence <220> <223> primer16_intergenic <400> 15 tttccctttt ggaaagttat gatgaattgt ttgttcgcgg ctgctcggca tgcggccggg 60 ttctttcggt ggaaggccat gtcccgccgg tcgatcggat ctggggtggc gaactttggg 120 acgcgagaca tgtgacctgt cggtgatcga cgataacacg aggcgattta aacttttgga 180 aataatccca gaataattcg gccaccgcta ataaatgact taaatattgg gatatcttct 240 tggaccagta ccaccaccat gtctgcctct cgcatgcacg tctcgctggc tggccacatc 300 aagtcatcga ctacactccc acagagggcg acgttggcgt cccaatcacc gtacgcatta 360 acttctacca tccaagtcct cagcaggtct atctgcgtct cgtcgtcggc cacaaagcta 420 tcgccacctc tgttcagcag atagcagaca ccagcctcgc aaagtggcaa ctcgacggcg 480 tcgtcccttt catcgaaaac ctcgcttcgg accatgtcca aatctctgtt caggccctcg 540 acaatgaggg catcatcgac accgttacct gcggtcagtt cgccttttgg cggcctgcc 599

Claims (10)

A primer set consisting of SEQ ID NO: 1 and SEQ ID NO: 2; A primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4; A primer set consisting of SEQ ID NO: 5 and SEQ ID NO: 6; A primer set consisting of SEQ ID NO: 7 and SEQ ID NO: 8; And a single nucleotide polymorphism (SNP) primer set for determining a mushroom color, comprising any one or more primer sets selected from the group consisting of a primer set consisting of SEQ ID NO: 9 and SEQ ID NO: 10.
The method of claim 1, wherein the color of the enoki mushroom SNP primer set for determining the color of the mushrooms, characterized in that white or brown.
Enoki mushroom color discrimination kit comprising a primer set of claim 1.
The method of claim 3, wherein the kit is a kit for color determination of the enoki mushroom, characterized in that for High Resolution Melting (HRM) analysis.
The kit according to claim 3, wherein the kit further comprises a DNA polymerase, dNTPs, and a PCR reaction buffer solution.
Composition for HRM (High Resolution Melting) analysis for the determination of the color of the enoki mushroom comprising the primer set of claim 1.
The composition of claim 6, wherein the composition further comprises a DNA polymerase, dNTPs, and a buffer for PCR reaction.
a) extracting genomic DNA from an enoki mushroom to determine color;
b) amplifying the DNA by performing PCR using the SNP primer set according to claim 1 using the extracted genomic DNA as a template; And
c) A method for determining the color of the mushrooms, comprising the step of high-resolution melting (HRM) analysis of the amplified DNA product.
The method according to claim 8, wherein the genomic DNA of step a) comprises a sequence of any one or more sequence numbers selected from the group consisting of SEQ ID NOs: 11 to 15.
The method according to claim 8, wherein d) HRM analysis shows that the SNP primer set of step b),
In the case of primer sets consisting of SEQ ID NO: 1 and SEQ ID NO: 2, the melting temperature (melting temperature) is determined as a white top if the melting temperature (78 ~ 79 ℃), brown top if 77.5 ~ 78.5 ℃;
In the case of the primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4, the melting temperature (melting temperature) is 81 ~ 83 ℃ to determine the white top, 82 ~ 84 ℃ to determine the brown top;
In the case of primer sets consisting of SEQ ID NO: 5 and SEQ ID NO: 6, the melting temperature (melting temperature) is determined as white top if the melting temperature (79.5 ~ 81 ℃), brown top if 78 ~ 80 ℃;
In the case of primer sets consisting of SEQ ID NO: 7 and SEQ ID NO: 8, the melting temperature is determined as a white top when the melting temperature is 81-83 ° C., and a brown top when 80-82 ° C .; And
In the case of primer sets consisting of SEQ ID NO: 9 and SEQ ID NO: 10, the melting temperature is determined as a white top when the melting temperature is 84.5 to 86 ° C., and a brown top when 84 to 85.5 ° C .;
Enoki mushroom color discrimination method, characterized in that it further comprises.

Images