KR101878539B1 - Nucleotide polymorphism markers for Foxglove aphid resistance in soybean and the use thereof - Google Patents

Abstract

The present invention relates to a composition and a kit for screening for aphid resistant aphid resistant soybean comprising a base polymorphic marker, a soybean aphid aphid resistance gene marker, an agent capable of detecting or amplifying the marker, and a soybean aphid resistant soybean selective soybean Method, it is possible to provide a marker that specifies the location of a nucleic acid molecule on the genome that is involved in resistance to infection with aphis aphid. The present invention also provides a composition for screening for aphid resistant aphid-resistant soybean comprising a probe capable of detecting a fungal pathogen-resistant trait marker of soybean or an amplifiable agent, a fungal aphid resistance screening kit comprising the fungal aphid aphid resistance screening kit and a fungal aphid aphid Resistant bean selection method can be provided.

Description

BACKGROUND OF THE INVENTION Field of the Invention The present invention relates to a polynucleotide polymorphism marker and a polynucleotide polymorphism marker,

The present invention relates to a composition and a kit for screening for aphid resistant aphid resistant soybean comprising a base polymorphic marker, a soybean aphid aphid resistance gene marker, an agent capable of detecting or amplifying the marker, and a soybean aphid resistant soybean selective soybean ≪ / RTI >

Soybean (Glycine max (L.) Merr.) Is one of the world's most widely used crops for applications such as protein and oil resources, livestock feed and biofuels. Despite a significant increase in soybean production over the last 20 years, there is a loss of about 19% of actual yields due to harmful animals, pathogens and viruses, and the development of pest-resistant soybeans is necessary to prevent this loss.

The pest resistance is divided into antixenosis and antibiosis. Non-favorability means the effect of the host plant on insect behavior, in which insect pests do not prefer host plants. To evaluate this, a choice test (hostess control) do. Antagonism is defined as the property of a host plant that negatively affects the life activity, life cycle and population of an insect when the plant is fed to the insect. A no-choice test is performed in which individual plants are infected with insects in order to confirm their antifeed.

On the other hand, half an hour Thursday pests of soybean aphid (soybean aphid, Aphis glycines Matsumura) is a very important economic pests of annual yield losses of about 58%, and lead to a loss of about $ 2.4 billion for the beans grown in North America. Soybean aphids live in the lower part of the leaf, ingesting sap from the leaves of the soybean, causing loss of photosynthesis and infecting the soybean mosaic virus.

To date, five species of soybean aphid resistance genes have been identified. Specifically, Rag1 , a single dominant gene found on chromosome 7 in the soybean aphid resistant strain, was found. Another single dominant gene, Rag2, was precisely mapped to a 54 kb region on chromosome 13 of the plant introduction (PI) plant, 200538. Similarly, the major non-preferred resistance gene, Rag3, was mapped on chromosome 16 of PI 567543C and Rag4 was mapped on chromosome 13 of PI 567541B. The major QTL, Rag5, was mapped on chromosome 13 of PI 567301B.

One of the major pest insects, Aulacorthum solani Kaltenbach) hosts a broad range of plants, from 25 families to 95 species, and causes serious damage to a variety of crops in Europe, North America, and, more recently, globally (Environ Entomol, 2010, 39 : 1631-1642). Cryptomeria japonica aphids cause a significant amount of harvest losses worldwide in soy, for example in Japan, yields are reduced by up to 90% (Annu Rep Soc Plant Prot N Jpn, 2001, 52: 175-177). However, in spite of its economic importance, cryptomeria aphid has been rarely studied in terms of biology, environmental studies, and effective control methods compared to soybean aphids.

Thus, the present inventors looking at the location of the QTL for adjusting the bush clover beard aphid resistance from PI 366121, example efforts result, wild soybean (Glycine to develop tightly linked SNP (single nucleotide polymorphism, SNP) marker and the gene soja ) PI 366121 was found to be resistant to aphid aphid aphid, and the present invention was accomplished by confirming the aphid resistance marker of the soybean aphid.

One object of the present invention is to provide a soybean phytate aphid resistant trait marker comprising a base polymorphism marker present in the 5,497,330 base to 5,733,055 base range of the chromosome 7 of soybean.

It is another object of the present invention to provide a composition for screening a susceptible aphid resistant aphid comprising a probe capable of detecting the marker or an amplifiable agent.

It is still another object of the present invention to provide a kit for screening a susceptible aphid resistant bean comprising the composition.

Yet another object of the present invention is to provide a method for producing a protein comprising the steps of: (a) obtaining DNA from soybeans; (b) hybridizing a polymorphic site of the base polymorphic marker of claim 1 with a probe from the DNA obtained from step (a); And (c) identifying the base of the hybridized polymorphic site of step (b).

In one aspect of the present invention, the present invention provides a soybean aphid aphid resistance trait marker comprising a base polymorphism marker present in the 5,497,330 base to 5,733,055 base range of the chromosome 7 of soybean.

In the present invention, the term "polymorphism" refers to the case where two or more alleles exist in one locus, and the polymorphism markers are present in a selected group in an amount of 1% or more, Or more than 2% of alleles. In the present invention, the polymorphic markers may be microsatellite, single nucleotide polymorphisms or other polymorphic markers, and in the present invention, the nucleotide polymorphism marker may be a single nucleotide polymorphism marker. have. The single nucleotide polymorphism (SNP) is called a single nucleotide polymorphism.

The allele refers to various types of genes that exist on the same locus of the homologous chromosome. Alleles are also used to represent polymorphisms, for example, SNPs have two kinds of bialles.

As used herein, the term " foxglove aphid " refers to a pest with aphids of the order Aulacorthum solani , and it seriously damages crops by using more than 95 kinds of plants including soybeans as a host.

The term " resistance to aphid aphid in the present invention " refers to a phenotypic expression in which soybean is not damaged or inhibited by aphid aphid when the bean is infected with aphid aphid, and " Escherichia coli When a bee aphid is infected, it refers to a phenotype in which the bean is damaged or inhibited by aphis aphid.

In the present invention, the term " pollinator aphid-resistant trait marker " may be a single nucleotide polymorphic marker existing in the 5,497,330 base to 5,733,055 base of the chromosome 7 of soybean, particularly 5,497,330 base, 5,501,827 base, The polynucleotide may be a single nucleotide polymorphic marker selected from the group consisting of base, 5,511,626 base, 5,526,770 base, 5,526,975 base, 5,546,038 base, 5,554,122 base, 5,651,095 base, 5,733,055 base and combinations thereof.

In addition, the single nucleotide polymorphism marker may be one or more selected from the SNP markers shown in the following table.

Specifically, the single nucleotide polymorphism marker comprises a polynucleotide comprising as a SNP 50 nucleotides and consisting of 5 to 50 consecutive DNA sequences, of the at least one nucleotide sequence selected from the group consisting of SEQ ID NOS: 1 to 10, (Ii) the 50th base of SEQ ID NO: 2 is A or C; (iii) the polynucleotide of SEQ ID NO: 3 is a polynucleotide of (Iv) the 50 th base of SEQ ID NO: 4 is G or T, (v) the 50 th base of SEQ ID NO: 5 is G or A, (vi) (Viii) the 50th base of SEQ ID NO: 8 is T or C, (ix) the 50th base of SEQ ID NO: 7 is T or C, 9 is C or T, and (x) the nucleotide sequence of SEQ ID NO: 1 The 50th base of 0 may be G or A. (I) the 50th base of SEQ ID NO: 1 is G, (ii) the 50th base of SEQ ID NO: 2 is A, (iii) the 50th base of SEQ ID NO: 3 is G, (iv) (Vi) the 50th base of SEQ ID NO: 6 is G, (vii) the 50th base of SEQ ID NO: 7 is G, T, (viii) the 50th base of SEQ ID NO: 8 is T, (ix) the 50th base of SEQ ID NO: 9 is C, or (x) the 50th base of SEQ ID NO: 10 is G, (I) the 50th base of SEQ ID NO: 1 is A, (ii) the 50th base of SEQ ID NO: 2 is C, (iii) the 50th base of SEQ ID NO: 3 is (Iv) the 50th base of SEQ ID NO: 4 is T, (v) the 50th base of SEQ ID NO: 5 is A, (vi) the 50th base of SEQ ID NO: 6 is C, (vii) 7 (Ix) the 50 th base of SEQ ID NO: 9 is T, or (x) the 50 th base of SEQ ID NO: 10 is A, (viii) Can be judged as a marker indicating susceptibility to aphid aphid, which can be used to screen for aphids resistant to aphid aphid.

According to one embodiment of the present invention, using the result of phenotype and genotype analysis in the RIL (recombinant inbred line) group, the region between the 5,497,330 bp and 5,733,055 bp proximity markers of the chromosome 7 through the inclusive composite interval mapping, It was confirmed that LOD (logarithm of odds) value is high in the degree of resistance of soybeans by beard aphid.

The term " Inclusive composite interval mapping (ICIM) " in the present invention means an approach for quantitative trait mapping of populations obtained through parental crossing.

In the present invention, the term " quantitative trait locus " refers to a position on a genetic map showing quantitatively diverse phenotypes in a genetically distinct RIL population, and uses a molecular marker to identify a specific part of a chromosome involved in a measurable trait The number of genes and chromosomes involved in major traits such as yield, fruit weight and heading in a specific environment, interaction effects of individual genes, interaction between quantitative trait loci and environment, and quantitative trait locus and genetic background And genetic background of major agronomic traits, such as the interaction with the genetic background.

As used herein, the term " RIL (Recombinant Inbred Line) " refers to a group of plants used to produce maps for quantitative trait loci, and homologous recombination is performed to produce homologous recombinants. And are used as data for analysis.

The term " genetic map " in the present invention is referred to as a genetic map, and is a genetic map showing the relative positions of genes. Relative chromosomal location. The distance between markers on the map indicates how frequently they are inherited together. Genetic association maps are constructed by observing how often two markers are inherited together in the household tree. The associative map is a mapping operation for converting the recombination values between the parents to the distances between the parents in an arbitrarily cultivated experimental group and arranging the order of them to create a linkage group between the markers .

The term " LOD (Logarithm of odds) " in the present invention is an index indicating the degree of association between a specific expression trait and alleles, and can be expressed by a logarithmic value.

In another aspect, the present invention provides a composition for screening a susceptible to aphid resistant aphid comprising a probe capable of detecting the aphid-resistant trait marker of the soybean, or an amplifiable agent.

The selection of the Aphis-resistant pathogen marker and the Aphis-resistant aphid-resistant soybean has been described above.

In the present invention, the term " probe capable of detecting a pathogenic aphid-resistant trait marker of soybean " is specifically identified by hybridization with a fungal pathogen-resistant trait marker region of soybean, And the specific method of such gene analysis is not particularly limited and may be by any gene detection method known in the art to which this invention belongs.

In the present invention, the term "agent capable of amplifying the soybean aphid-resistant trait marker of soybean" means that the soybean aphid resistance gene marker region of the soybean is amplified to identify the soybean aphid-resistant soybean Means a primer capable of specifically amplifying the polynucleotide of the soybean aphid-resistant trait marker of the soybean.

The primers used for the polymorphic marker amplification can be amplified using appropriate conditions in suitable buffers (e.g., four different nucleoside triphosphates and polymerase such as DNA, RNA polymerase or reverse transcriptase) and template-directed DNA Stranded oligonucleotides that can serve as the starting point of synthesis. The appropriate length of the primer may vary depending on the purpose of use, and is usually, but not limited to, 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template.

The term "primer" in the present invention means a base sequence having a short free 3 'hydroxyl group and can form base pairs with a complementary template, It means a short sequence functioning as a point. Primers can initiate DNA synthesis in the presence of reagents for polymerization (i. E., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at appropriate buffer solutions and temperatures. PCR amplification can be performed to predict skin type through the production of desired products. The PCR conditions, the lengths of the sense and antisense primers can be modified based on what is known in the art.

The probes or primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution with an equivalent of one or more natural nucleotides, and modification between nucleotides, such as uncharged linkers (e.g., methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

In another aspect, the present invention provides a kit for screening a susceptible aphid-resistant bean comprising the composition for screening the susceptible aphid resistant beans.

The composition for screening for aphid aphid resistance-resistant beans is as described above.

The kit may be an RT-PCR kit DNA chip kit, SNP chip kit or microarray chip kit.

The kit of the present invention can select the aphid-resistant traits of soybean aphid aphid by confirming the SNP polymorphism marker, which is a marker for selecting a pathogen-resistant aphid-resistant soybean, or confirming the expression level of the SNP polymorphism marker with the mRNA expression level . As a specific example, in the present invention, a kit for measuring the mRNA expression level of a marker for screening of aphid resistant aphid-resistant soybean can be a kit containing essential elements necessary for conducting RT-PCR. The RT-PCR kit contains test tubes or other appropriate containers, reaction buffers (varying in pH and magnesium concentration), deoxynucleotides (dNTPs), and the like, in addition to the respective primer pairs specific for the genes of the aphid- Enzymes such as Taq polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. It may also contain a primer pair specific for the gene used as a quantitative control. Also preferably, the kit of the present invention can be a sickle-leaf aphid-resistant bean screening kit containing essential elements necessary for carrying out a DNA chip or a SNP chip.

DNA chips or SNP chip kits are typically formed by attaching nucleic acid species to a glass surface that is not larger than a flat solid support plate, typically a slide for a microscope, in a gridded array. The nucleic acid is uniformly arranged on the chip surface , A hybridization reaction occurs between a nucleic acid on a DNA chip or a SNP chip and a complementary nucleic acid contained in a solution treated on the chip surface, thereby enabling massive parallel analysis.

The microarray may comprise DNA or RNA polynucleotides. The microarray comprises a conventional microarray except that the polynucleotide of the present invention is contained in the probe polynucleotide.

Methods for producing microarrays by immobilizing probe polynucleotides on a substrate are well known in the art. The probe polynucleotide means a polynucleotide capable of hybridizing, and means an oligonucleotide capable of binding to the complementary strand of the nucleic acid in a sequence-specific manner. The probe of the present invention is an allele-specific probe in which a polymorphic site is present in a nucleic acid fragment derived from two individuals of the same species and hybridizes to a DNA fragment derived from one individual but not to a fragment derived from another individual . In this case, the hybridization conditions show a significant difference in the intensity of hybridization between alleles, and should be sufficiently stringent to hybridize to only one of the alleles. This can lead to good hybridization differences between different allelic forms.

The probe of the present invention can be used for selecting a soybean aphid-resistant bean by detecting alleles. The diagnostic methods include detection methods based on hybridization of nucleic acids such as Southern blots, etc., and may be provided in a form pre-bonded to a substrate of a DNA chip in a method using a DNA chip. The hybridization may be carried out under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25 ° C or higher.

For example, conditions of 5 x SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and 25-30 0 C may be suitable for allele-specific probe hybridization.

Immobilization on the substrate of the probe polynucleotide associated with the sialic acid-resistant bean screening of the present invention can also be easily prepared using this conventional technique. In addition, hybridization of nucleic acids on a microarray and detection of hybridization results are well known in the art. The detection can be accomplished, for example, by labeling the nucleic acid sample with a labeling substance capable of generating a detectable signal comprising a fluorescent substance, such as Cy3 and Cy5, and then hybridizing on the microarray and detecting The hybridization result can be detected by detecting the generated signal.

In another aspect, the present invention provides a method for producing a protein comprising the steps of: (a) obtaining DNA from a soybean; (b) hybridizing the polymorphic site of the base polymorphic marker with the probe from the DNA obtained from step (a); And (c) identifying the base of the hybridized polymorphic site of step (b).

The soybean aphid aphid resistance marker and the soybean aphid resistance-resistant soybean selection are as described above.

Any method known to a person skilled in the art can be used to obtain the DNA of step (a). In particular, a method of extracting genomic DNA by combining with nucleic acid with CTAB (cetyltrimethylammonium bromide) to form a complex can be used.

The step of hybridizing the polymorphic site of the single nucleotide polymorphic marker with the probe from the DNA obtained in step (a) of the step (b) can be carried out by any method known to a person skilled in the art.

Sequencing analysis, hybridization with a microarray, allele specific PCR, dynamic allele-specific hybridization (DASH), and so on can be performed to determine the bases of the polymorphic site of step (c) , PCR extension analysis, SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (for example, Sequenom's MassARRY system), mini-sequencing method, Bio-Plex system But are not limited to, BioRad), CEQ and SNPstream systems (Beckman), Molecular Inversion Probe array technology (e.g., Affymetrix GeneChip), and BeadArray Technologies (e.g. Illumina GoldenGate and Infinium analysis). One or more alleles in a polymorphic marker, including microsatellite, SNP or other types of polymorphic markers, can be identified by such methods or by other methods available to those skilled in the art to which this invention pertains. The base of such a polymorphic site can be determined preferably through a SNP chip.

The SNP chip means one of DNA microarrays capable of confirming each base of several hundred thousand SNPs at a time.

The TaqMan method comprises the steps of: (1) designing and constructing a primer and a TaqMan probe to amplify a desired DNA fragment; (2) labeling probes of different alleles with FAM dyes and VIC dyes (Applied Biosystems); (3) performing PCR using the DNA as a template and using the primer and the probe; (4) after completion of the PCR reaction, analyzing and confirming the TaqMan assay plate with a nucleic acid analyzer; And (5) determining the genotype of the polynucleotides of step (1) from the analysis results.

In the above, the sequencing analysis can be performed using a conventional method for determining the nucleotide sequence, and can be performed using an automated gene analyzer. The allele-specific PCR means a PCR method in which a DNA fragment in which the SNP is located is amplified with a primer set including a primer designed with the base at the 3 'end at which the SNP is located. The principle of the above method is that, for example, when a specific base is substituted by A to G, an opposite primer capable of amplifying a primer containing the A as a 3 'terminal base and a DNA fragment of an appropriate size is designed, In the case where the base at the SNP position is A, the amplification reaction is normally performed and a band at a desired position is observed. When the base is substituted with G, the primer can be complementarily bound to the template DNA, And the amplification reaction is not performed properly due to the inability of complementary binding at the terminal. DASH can be performed by a conventional method, preferably by a method such as Prince et al.

On the other hand, in the PCR extension analysis, first, a DNA fragment containing a base in which a single base polymorphism is located is amplified by a pair of primers, and all nucleotides added to the reaction are deactivated by dephosphorylation, and SNP- specific extension primers, a dNTP mixture, a digoxin nucleotide, a reaction buffer, and a DNA polymerase to perform a primer extension reaction. At this time, the extension primer has a base immediately adjacent to the 5 'direction of the base in which the SNP is located at the 3' terminus, and the nucleic acid having the same base as the dodecoxynucleotide is excluded in the dNTP mixture, and the dodecoxynucleotide indicates the SNP Base type. For example, when dGTP, dCTP and dTTP mixture and ddATP are added to the reaction in the presence of substitution from A to G, the primer in the substituted base is extended by DNA polymerase, The primer extension reaction is terminated by ddATP at the position where the base first appears. If the substitution has not occurred, the extension reaction is terminated at the position, so that it is possible to discriminate the type of the base representing the SNP by comparing the lengths of the extended primers.

As the detection method, when the extension primer or the dioxynucleotide is fluorescently labeled, the SNP is detected by detecting fluorescence using a gene analyzer (for example, Model 3700 of ABI Co., Ltd.) used for general nucleotide sequence determination And when the unlabeled extension primer and the didyxin nucleotide are used, the SNP can be detected by measuring the molecular weight using MALDI-TOF (matrix assisted laser desorption ionization-time of flight) technique.

The present invention relates to soybean-derived aphid aphid resistance trait markers that are resistant to infection with aphis aphid aphid, and can provide a marker that specifies the location of a nucleic acid molecule on the genome that is involved in resistance to infection with aphid aphid . The present invention also provides a composition for screening for aphid resistant aphid-resistant soybean comprising a probe capable of detecting a fungal pathogen-resistant trait marker of soybean or an amplifiable agent, a fungal aphid resistance screening kit comprising the fungal aphid aphid resistance screening kit and a fungal aphid aphid Resistant bean selection method can be provided.

Figure 1 shows damaged leaves and damage rating. The leaf color changed on the 14th day after infection with the aphids. The degree of damage was evaluated from 1 to 9 according to the area where the color changed in the leaves.
Figure 2 shows the phenotypic frequency distribution in the community. Distribution of primary infestation leaf damage (PLD) and total plant damage (TPD) was shown in the selection test (top) and the non-selection test (bottom). Here GR1 means no damage, GR9 means serious damage. The positions of the parents Williams 82 (white arrow) and PI 366121 (black arrow) were indicated.
Figure 3 shows the inclusive composite interval mapping (ICIM) for QTL according to PLD and TPD in selective and non-selective tests. Raso2 was mapped in the area between BARC-042815-08424 and BARC-015945-02020, which showed high LOD values from PLD and TPD values in both selective and non-selective tests.

Hereinafter, the present invention will be described in more detail with reference to examples. These examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

Example  1: Plant material

141 F4: 8 recombinant inbred lines (RILs) were mated to F4 using a single seed descent method using the Williams 82 and the aphid resistant P. aureus strain PI 366121, And established a cluster. The RIL and two parental lines were used in the present invention. PI 366121 is highly susceptible to bean pod mottle virus infection in Fukushima, Japan. Williams 82 is known to be susceptible to aphid aphids, and recently the entire genome sequence has been published.

Example  2: Aphis

Crawfish beard aphids were collected in Suwon, Korea in 2008. Breeding was continued by using a bean (var. Sowon) in a food environment, the check block of the National Academy of Sciences of food, grown in the insect in a cage separate growth chamber in which the conditions that 15 hours light per day maintained at 23 to 25 ℃.

Example  3: Aphis  Resistance evaluation

Both selective and non-selective tests were performed in triplicate in a growth chamber maintained at 23 to 25 ° C under 60-80% relative humidity and with light for 15 hours per day. For the selection test, Sowon was planted at the center of the column in the 10 x 5 tray (550 L x 270 W x 120 H mm), and the rest was planted with RIL. For the non-selection test, the column center was empty in the same tray and the RIL was planted and covered with a 120-mesh cage to prevent migration of aphids between RILs. To assess the degree of resistance and infection damage as a control, all trays contained Williams82 and PI 366121. When the soybeans reached the V1 stage, 4 cymbidium aphid aphids were placed on the leaves of each individual leaf using a paintbrush. Total plant damage (TPD) and primary infestation leaf damage (PLD) were assessed at 14 days (DAI-14) after scarf beetle aphid infection by grading with a score of 1 to 9. Where 1 means no damage and 9 means severe damage (Figure 1). In the study of soybean aphid, the number of aphids per plant has been used as an index of plant damage rating. However, it has been reported that there is no significant correlation between the number of aphids and the total plant damage rating in the aphid aphid. Therefore, TPD and PLD were used for further analysis.

On the other hand, to perform the non-selection test, a small mesh cage was used. These conditions limited plant growth, so plants could not be scored on non-selective tests 14 days after infection. However, DAI-7 was able to distinguish sensitivity and resistance to aphids from non-selection tests.

Example  4: DNA extraction and GoldenGate  analysis

The unexpanded trifoliate leaves of each plant were recovered and genomic DNA was isolated. Dielectric DNA was extracted using the modified CTAB (hexadecyltrimethylammonium bromide) method. To generate a genetic map, 141 RILs and two parental lines were examined using GoldenGate analysis, which included 1,536 SNP sites well distributed on 20 bean chromosomes, and 504 SNP markers were found. The selected 504 SNP markers were evenly distributed throughout the entire soybean genome with about 25 markers per chromosome.

Example  5: Gene association mapping and QTL  Confirm

The association map was created using QTL IciMapping (version 4.0) with parameters adjusted according to the manufacturer's instructions; The parameters were grouped by setting the logarithm of odds threshold to 3.0 and using the nnTwoOpt algorithm using the nearest neighbors for tour construction. Two-opt was used for the tour improvement, and the adjacent recombinant fractions And the resultant was rippled. The QTL was verified using ICIM (inclusive composite interval mapping) method. The parameters were as follows: 1.0 cM step and 3.0 LOD threshold.

Example 6: 180K  AXIOM SoyaSNP  Analyzing SNPs

Recently, the 180K AXIOM SoyaSNP analysis was developed on the Affymetrix platform, enabling high-resolution genetic characterization. The assay can score SNPs over 180 K and provides approximately one SNP per 6.5 kb in the soybean genome. The SNP genotyping analysis can facilitate the development of high-density genetic mapping that provides a more sophisticated QTL location and enables the development of SNPs that are highly relevant to a particular trait in order to enable selection through markers in plant breeding do.

Specifically, genomic DNA was extracted by modified CTAB (hexadecyltrimethylammonium bromide) method from specimen soybeans. Genetic DNA samples of the parental line and 141 F4-derived F8 RILs were cloned using the GeneTitan® Scanner (Affymetrix, Santa Clara, Calif.) Using a 180K Axiom® SoyaSNP array (Affymetrix, Santa Clara, CA) CA), and 42,170 polymorphic markers were selected from a total of 180,961 markers.

Experimental Example  One: Expressive trait  evaluation

The F4-derived F8 RIL of 141 individuals, and the parental lines Williams 82 and PI 366121, are summarized in Table 1.

characteristics Parent F _{4: 8} RILs PI 366121 Williams 82 Average range Elective examination PLD 1 ± 0.0 8.1 ± 1.5 5.2 1-9 TPD 1 ± 0.0 6.0 ± 0.9 3.8 1-9 Non-selection  exam PLD 1 ± 0.0 5.8 ± 1.2 3.9 1-9 TPD 1 ± 0.0 5.6 ± 1.3 3.5 1-9

In order to evaluate the non-favorability and antifouling properties, selective and non-selective tests were performed in the growth chamber using the RIL population and parental line. The sensitive individual, Williams 82, was severely damaged by aphids, but the resistant individual PI366121 was not damaged (Table 1).

In the selection test, Williams 82 PLD was 8.1 points and TPD was 6.0 points. However, the TPD and PLD of PI 3661321 all recorded one point. The average PLD of RIL was 5.2 and the average TPD was 3.8. The damage score ranges from 1 to 9 points.

In the non-selection test, PLD and TPD were only assessed in DAI-7, because the isolated mesh cage inhibited optimal plant growth, and the 7 days post-infection evaluation was able to distinguish resistance and susceptibility to Cryptomeria aphid . The Williams 82 PLD and TPD scores were 5.8 and 5.6, respectively. PI 366121, on the other hand, was not damaged by aphids. The RIL showed similar PLD and TPD for the ciliate aphid in non-selective tests. On the other hand, a transgressive segregant with a higher damage score than Williams 82 was observed.

The trait distributions observed in the selective and non-selective tests are shown in FIG. In the selection test, PLD showed a bimodal shape in the range of 1 to 9 instead of representing normal distribution (Fig. 2a). The bimodal distribution means that PI 366121 is responsible for resistance to aphid aphid by a limited number of major genes. In the non-selection test for antimutagenic resistance in PI 366121, PLD and TPD scores and frequency were evenly distributed at 1 to 9 points in DAI-7 (FIGS. 2c and 2d). A total of 18 RILs showed 1 PLD score, 28, 33, and 11 RILs showed 3, 5, and 9 points, respectively. The frequency distribution of TPD was similar to that of PLD.

The phenotypic evaluation results indicate that PI 366121, which is a parental line for S. aphis infection, is resistant and Williams 82 is susceptible. PI 366121 and Williams 82 showed a frequency distribution suitable for QTL analysis.

Experimental Example  2: QTL  analysis

Prior to identifying the Cryptomeria aphid-resistant SNP markers, the major QTL domains associated primarily with Cryptococcus aphidis resistance were analyzed. QTL mapping using the ICIM method was performed using the PLD and TPD phenotype data from the selection and non-selection tests and the genotypic analysis data from the GoldenGate analysis. 504 SNP markers that are polymorphic in the entire genome are located at an average of 20 cM intervals in each genome. Table 2 summarizes the QTL analysis of the resistance to sycamore aphids using PLD and TPD as phenotypic traits.

^a primary infestation leaf damage grade

^b Total plant damage grade

^c Log of odds

^d Phenotypic variance explained

^e Additive effect

Overall, the analysis identified major QTL regions on chromosome 7, with phenotypic diversity of 60-72% in all but the non-selective TPD test. In selected PLD tests, QTLs were identified on chromosome 3, 6, 7 and 18. Chromosomes 3 and 6 each have one QTL, while chromosome 7 has two QTLs and chromosome 18 has three QTLs. The two QTLs on chromosome 7 showed high LOD scores of 22.3 and 33.2, respectively. The two QTL peaks are located close to each other on chromosome 7 (distance between adjacent markers is 3.97 cM) and the phenotypic diversity is almost 72%. For TPD, three QTLs were identified: two QTL peaks present on chromosome 7, corresponding to the QTL position for PLD on chromosome 7, and one QTL peak on chromosome 18. In the non-selection test, three QTLs for PLD were also detected, and two QTLs for chromosome 7 were identified as in the selection test for TPD. For TPD, two QTLs of chromosome 7 corresponding to the QTLs identified in other tests were again detected. The identified QTLs on chromosome 7 showed the highest percentage of phenotypic variance explained value (PVE), the genotype diversity caused by QTL (commonly used to determine that 25% is a major QTL). The additive effect (Add) of chromosome 7 QTLs was negative, suggesting that the effect was derived from the resistant individual PI 366121. Other QTLs on chromosome 3, 6 and 18 showed low LOD and PVE%. Depending on the LOD and PVE% values, the most important resistant QTL for non-preference and antagonism appears to be located on chromosome 7. The major QTL of chromosome 7 has a large number of SNP markers within a distance of 13 cM corresponding to the region between 71 cM (BARC-042815-08424) and 84 cM (BARC-015945-02020) of chromosome 7, 3.

Experimental Example  3: Aphis  Identify resistant SNPs

Based on the results of Experimental Example 2, the 180K Axiom® SoyaSNP analysis was performed to search for the SNP markers related to the resistance of the aphid aphid present around the main QTL of chromosome 7, and as a result, a high LOD value on chromosome 7 The top ten SNPs identified were identified and are shown in Tables 3 and 4 below.

SNP ID Chromosome Physical location PI366121 (resistance allele) Williams82 (sensitive allele) AX-90463543 Chr07 5497330 G A AX-90457213 Chr07 5501827 A C AX-90428033 Chr07 5511541 G A AX-90357286 Chr07 5511626 G T AX-90372171 Chr07 5526770 G A AX-90464073 Chr07 5526975 A C AX-90444435 Chr07 5546038 T C AX-90445841 Chr07 5554122 T C AX-90335372 Chr07 5651095 C T AX-90331100 Chr07 5733055 G A

SNP ID resistance allele sequence SEQ ID NO: AX-90463543 G CTCTCCCTGGTCTTCGACCTTTACCGGACTGCAAACATCCAGTACATTC [G / A] TTGCGTCAGATTGAAATCAGAAGCCATTCATTATCAGTTCTGAATATAA SEQ ID NO: 1 AX-90457213 A TGTACCCAAAATGCGGCACTTTGTGGTTGAACAAATCCACATCTCTACC [A / C] TCACCAGCTCTGCTGAATTTCTCCGAAATCTTAGGCAAAAAAACAGCAT SEQ ID NO: 2 AX-90428033 G ACACCTTTTTTCCTTTTCACTCAAGTGCTAGACAAAACAACTTCACCTA [G / A] AGATTAACAAATAGGTTTAGAACACTTGCAACTATTTGGCAAAGAATAG SEQ ID NO: 3 AX-90357286 G TTGGCAAAGAATAGCTAAATAAATCACAAATTGACAATCAAGCATGGTG [G / T] CACCAGGCACTTGCCCTTTTGCTGAATATGAAATTACCTTGCGTGTACC SEQ ID NO: 4 AX-90372171 G AAAAGTAGATCCAAGCCAAATGCAGGAACACTTTCGGAATTGGAGATCA [G / A] ATCTCAATTCAATCTCCGAAGGCAAACTTGAAGAAATACGCACTGACTT SEQ ID NO: 5 AX-90464073 A CAGTGAATACGAACCATAGGAGAGAAAGGAATCATGTTGCGGAGTGATC [A / C] GCAATCGATGGTTGGGTTAACCATCATTCCTTTGTTTCTCTTCATTGCA SEQ ID NO: 6 AX-90444435 T TTACTCAAGACCTTTTCGTCAAACACAGCATACTGCTTCTTGAACTCAA [T / C] GAGTGCCTTCTCTGCTAGAGGGTCTATCTTATCCTCATACTTGTCATAC SEQ ID NO: 7 AX-90445841 T TAGGATTATGCCACTGACCAGAGACGTTTTTGAAAATCTTGTAGTATTA [T / C] GGTGTTCTGGTAGCGAAGCAAATATATGAATTGCTTTCACTGCAACTGC SEQ ID NO: 8 AX-90335372 C TTTGGCATTCTGTACAGAATTTGACAGAGACGTTCACCATCATTAACTT [C / T] GCATAACGAAAGCACTTTTAAACGGTGCATTGGATGCTTCACAGTGTTG SEQ ID NO: 9 AX-90331100 G TTTTAAAGAAATTGCAAATGGTTCTAGAACCACTAAACCTATGTTACAG [G / A] CAATAGtaacacagtaacacatgactcaaacactaatcaaacatttcac SEQ ID NO: 10

* In [X / Y], X is a resistant trait and Y is a susceptible trait.

The SNPs listed in Tables 3 and 4 play a major role in increasing the resistance of PI 366121 to non-adherence and anti-allergic resistance to aphids. Accordingly, the SNPs can be used to determine the resistance of the soybean aphid aphid, and can be usefully used in the development of aphid resistant aphid resistant varieties.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all aspects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> Dankook University Cheonan Campus Industry Academic Cooperation Foundation <120> Nucleotide polymorphism markers for Foxglove aphid resistance in          soybean and the use thereof <130> KPA150677-KR <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> AX-90463543 <400> 1 ctctccctgg tcttcgacct ttaccggact gcaaacatcc agtacattcr ttgcgtcaga 60 ttgaaatcag aagccattca ttatcagttc tgaatataa 99 <210> 2 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> AX-90457213 <400> 2 tgtacccaaa atgcggcact ttgtggttga acaaatccac atctctaccm tcaccagctc 60 tgctgaattt ctccgaaatc ttaggcaaaa aaacagcat 99 <210> 3 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> AX-90428033 <400> 3 acaccttttt tccttttcac tcaagtgcta gacaaaacaa cttcacctar agattaacaa 60 ataggtttag aacacttgca actatttggc aaagaatag 99 <210> 4 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> AX-90357286 <400> 4 ttggcaaaga atagctaaat aaatcacaaa ttgacaatca agcatggtgk caccaggcac 60 ttgccctttt gctgaatatg aaattacctt gcgtgtacc 99 <210> 5 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> AX-90372171 <400> 5 aaaagtagat ccaagccaaa tgcaggaaca ctttcggaat tggagatcar atctcaattc 60 aatctccgaa ggcaaacttg aagaaatacg cactgactt 99 <210> 6 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> AX-90464073 <400> 6 cagtgaatac gaaccatagg agagaaagga atcatgttgc ggagtgatcm gcaatcgatg 60 gttgggttaa ccatcattcc tttgtttctc ttcattgca 99 <210> 7 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> AX-90444435 <400> 7 ttactcaaga ccttttcgtc aaacacagca tactgcttct tgaactcaay gagtgccttc 60 tctgctagag ggtctatctt atcctcatac ttgtcatac 99 <210> 8 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> AX-90445841 <400> 8 taggattatg ccactgacca gagacgtttt tgaaaatctt gtagtattay ggtgttctgg 60 tagcgaagca aatatatgaa ttgctttcac tgcaactgc 99 <210> 9 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> AX-90335372 <400> 9 tttggcattc tgtacagaat ttgacagaga cgttcaccat cattaactty gcataacgaa 60 agcactttta aacggtgcat tggatgcttc acagtgttg 99 <210> 10 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> AX-90331100 <400> 10 ttttaaagaa attgcaaatg gttctagaac cactaaacct atgttacagr caatagtaac 60 acagtaacac atgactcaaa cactaatcaa acatttcac 99

Claims (12)

A polynucleotide comprising a single nucleotide polymorphism (SNP) at the 5497330 base position of the chromosome 7 of soybean, or a polynucleotide complementary thereto, as a marker for screening a soybean aphid resistance gene , Wherein the polynucleotide is a polynucleotide comprising the 50th base as a SNP and 5 to 50 consecutive DNA sequences out of the nucleotide sequences of SEQ ID NO: 1, wherein the 50th base of SEQ ID NO: 1 is G or A. A marker for the resistance to trait traits of beans.
[Claim 2] The method according to claim 1, wherein the soybean aphid resistance marker for transgenic aphid is selected from the group consisting of SEQ ID NOS: 2 to 10, a 50th base as a SNP and 5 to 50 consecutive DNA sequences , Or a polynucleotide complementary thereto,
(i) the 50th base of SEQ ID NO: 2 is A or C,
(ii) the 50th base of SEQ ID NO: 3 is G or A,
(iii) the 50th base of SEQ ID NO: 4 is G or T,
(iv) the 50th base of SEQ ID NO: 5 is G or A,
(v) the 50th base of SEQ ID NO: 6 is A or C,
(vi) the 50th base of SEQ ID NO: 7 is T or C,
(vii) the 50th base of SEQ ID NO: 8 is T or C,
(viii) the 50th base of SEQ ID NO: 9 is C or T, and
(ix) the 50th base of SEQ ID NO: 10 is G or A,
Marker for the resistance to the trait of a bean.
A composition for screening a susceptible aphid-resistant bean comprising a probe capable of detecting a marker for screening a susceptible aphid-resistant trait of soybeans of claim 1 or 2 or an amplifiable agent.
A kit for screening a susceptible aphid-resistant bean comprising the composition of claim 3.
5. The kit for screening a chicken aphid-resistant soybean according to claim 4, wherein the kit is an RT-PCR kit DNA chip kit, SNP chip kit or microarray chip kit.
(a) obtaining DNA from soybeans;
(b) hybridizing the polymorphic site of the single base polymorphism of claim 1 with a probe from the DNA obtained from step (a); And
(c) identifying the base of the hybridized polymorphic site of step (b).
7. The method according to claim 6, wherein when the 50 th base of SEQ ID NO: 1 is G, the soybean aphid-resistant soybeans are judged to be aphid resistant aphid.
7. The method according to claim 6, wherein when the 50th base of SEQ ID NO: 1 is A, the soybean aphid-sensitive soybean is judged to be susceptible.
(a) obtaining DNA from soybeans;
(b) hybridizing the polymorphic site of the single base polymorphism of claim 2 with a probe from the DNA obtained from step (a); And
(c) identifying the base of the hybridized polymorphic site of step (b).
10. The method of claim 9,
(i) the 50th base of SEQ ID NO: 1 is G,
(ii) the 50th base of SEQ ID NO: 2 is A,
(iii) the 50th base of SEQ ID NO: 3 is G,
(iv) the 50th base of SEQ ID NO: 4 is G,
(v) the 50 &lt; th &gt; base of SEQ ID NO: 5 is G,
(vi) the 50th base of SEQ ID NO: 6 is A,
(vii) the 50th base of SEQ ID NO: 7 is T,
(viii) the 50 &lt; th &gt; base of SEQ ID NO:
(ix) the 50th base of SEQ ID NO: 9 is C, or
(x) The 50th base of SEQ ID NO: 10 is G, and the soybean aphid-resistant soybeans are judged to be resistant to aphid aphid resistance.
10. The method of claim 9,
(i) the 50th base of SEQ ID NO: 1 is A,
(ii) the 50th base of SEQ ID NO: 2 is C,
(iii) the 50th base of SEQ ID NO: 3 is A,
(iv) the 50th base of SEQ ID NO: 4 is T,
(v) the 50 &lt; th &gt; base of SEQ ID NO: 5 is A,
(vi) the 50th base of SEQ ID NO: 6 is C,
(vii) the 50th base of SEQ ID NO: 7 is C,
(viii) the 50 &lt; th &gt; base of SEQ ID NO:
(ix) the 50th base of SEQ ID NO: 9 is T, or
(x) wherein the 50 th base of SEQ ID NO: 10 is A, the strain is judged to be a susceptible to aphid aphid.
delete

Images