KR20220036303A - A biomarker for predicting a head stage of wheat - Google Patents

Abstract

The single nucleotide polymorphisms (SNPs) markers that significantly affect the sprouting period of wheat identified according to the present invention can help select cultivars for the cultivation characteristics of wheat and suggest appropriate cultivation methods depending on the wheat cultivar. It is possible.

Description

Biomarker for predicting the head stage of wheat {A BIOMARKER FOR PREDICTING A HEAD STAGE OF WHEAT}

The present invention provides a single nucleotide polymorphism marker that can predict the heading period of wheat as a biomarker; A method of providing information for predicting the planting period of wheat using the marker; A composition for predicting the heading period of wheat comprising a probe or primer for the marker; and a kit for predicting the heading period of wheat, including a probe or primer for the marker.

Wheat is used as a supplementary food in the East, but is a staple food in the West, and is one of the world's two largest food crops along with rice. More than 90% is milled and used for making noodles, baking, confectionery, and industrial purposes. Although global wheat production has been steadily increasing in line with increasing consumption over the past decade (FAO, 2018), increasing yield remains the most important goal in wheat breeding programs (Wurschum et al. 2018).

Countries around the world are continuously conducting related research because it is necessary to simultaneously increase productivity and ensure stability due to rapid changes in the cultivation environment due to abnormal climate (Asseng et al. 2017, Yang et al. 2017, Zampieri et al. 2017) . In Europe, research has recently been active on improving drought tolerance and increasing wheat yield to respond to climate change (Senapati et al, 2018). However, research on wheat in Korea is very poor compared to other countries.

It is known that the yield of wheat is most affected by the number of tillers per unit area, the number of kernels per unit, and the seed weight. In this respect, to increase wheat yield, agricultural traits and genetic characteristics of wheat are studied, and domestic wheat breeding or wheat cultivation is conducted. It is necessary to develop SNP analysis and molecular markers of the Korean wheat core group that can be applied to.

The present invention is intended to solve the above needs, and the purpose of the present invention is to provide a single nucleotide polymorphism marker that can predict the sprouting period of wheat.

In addition, another object of the present invention is a method of providing information for predicting the heading period of wheat using the marker; A composition for predicting the heading period of wheat comprising an agent capable of detecting the marker; The aim is to provide a kit for predicting the heading period of wheat, including an agent capable of detecting the marker.

However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by a person skilled in the art to which the present invention pertains.

As a result of efforts to develop biomarkers that can distinguish major agricultural traits from various wheat varieties, the inventor of the present invention discovered a specific single nucleotide polymorphism marker that has a significant correlation with the emergence period of wheat and developed the present invention. Completed.

Therefore, the present invention provides a single nucleotide polymorphism marker that can predict the heading period of wheat in wheat cultivation and its use.

Specifically, the present invention provides a marker for predicting the heading period of wheat that includes one or more single nucleotide polymorphism markers selected from among single nucleotide polymorphism markers that can predict the heading period of wheat.

The single nucleotide polymorphism marker capable of predicting the heading period of wheat of the present invention may be selected from the group consisting of BA00307905 of wheat chromosome 4B (genome) and BA00204258 of wheat chromosome 3B.

In one embodiment, a combination of two single nucleotide polymorphism markers for predicting the heading period of wheat may be used.

Wheat is a hexaploid crop, has 42 chromosomes, is allopolyploid, and the six chromosomes are divided into two homologous chromosomes each into the A, B, and D genomes. In other words, in the case of chromosome 1, there are two homologous chromosomes 1A, two homologous chromosomes 1B, and two homologous chromosomes 1D, and chromosome numbers exist up to number 7.

In this specification, the term "heading period" refers to the period in which spikes emerge from the leaf sheaths of branch leaves when the spike neck nodes elongate prior to flowering in flowering plants. The heading period of wheat can be defined by different criteria as needed. For example, the day when a predetermined ratio of the number of ears per unit area is harvested may be defined as the harvesting period. The predetermined ratio may be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more of the total number of ears per unit area, but this may be used as a definition of the head harvesting period as needed. It may vary. Alternatively, the heading period may be defined based on the time when ears of standard varieties emerge, but is not limited to this.

This means that if the genotype of BA00307905 of the single nucleotide polymorphism marker wheat chromosome (genome) 4B of the present invention is AA, vegetative growth can be prolonged and the heading period can be delayed compared to when the genotype of the SNP is GG or AG. can do.

In addition, when the genotype of BA00204258 of the single nucleotide polymorphism marker wheat chromosome 3B of the present invention is AA, it can be predicted that vegetative growth is prolonged and the heading period is delayed compared to when the genotype of the SNP is AG.

In the present invention, the term 'polymorphism' refers to the coexistence of one or more forms in a nucleic acid including exons and introns or a portion thereof. ‘Single Nucleotide Polymorphism’ or ‘SNP’ refers to the presence of two or more single nucleotides at a specific position in a gene. Most SNPs have two alleles. For one allele of the above polymorphism, if you have two identical alleles, you are said to be homozygous for the allele (having the same base at the SNP position), and if you have two different alleles, you are called heterozygous for the allele (SNP). (having different bases at different positions). In the present invention, SNP naming is indicated by BA code. BA code refers to the code assigned to each SNP present in the genome of wheat (Triticum aestivum) by CerealsDB (https://plants.ensembl.org/Triticum_aestivum/Info/Index). The positions of bases according to the BA code of CerealsDB are consistent with the standard wheat genome (IWGSC RefSeq v1.0) and are interconnectable.

As used herein, the term 'allele' refers to an alternative form of a gene, including an intron, exon, intron/exon junction, and 3' and/or 5' untranslated region associated with the gene or part thereof. . In general, alleles refer to multiple types of a gene that exist at the same genetic locus on homologous chromosomes. Alleles of a particular gene may differ from each other by a single nucleotide or several nucleotides and may include substitutions, deletions, and insertions of nucleotides.

In the present invention, the term 'marker', 'polymorphic marker', or 'single nucleotide polymorphic marker' refers to a genomic polymorphic site of a gene. Each polymorphic marker has two or more sequence variations at the polymorphic site that are characteristic of a particular allele.

In addition, the present invention provides a method for predicting the heading period of wheat, which includes confirming the base of the polymorphic site of one or more single nucleotide polymorphism markers selected from the single nucleotide polymorphism markers of the present invention from a nucleic acid sample isolated from wheat.

In addition, the present invention provides information for predicting the heading period of wheat, including confirming the base of the polymorphic site of one or more single nucleotide polymorphism markers selected from the single nucleotide polymorphism markers of the present invention from a nucleic acid sample isolated from wheat. Provides a method.

The method for predicting the heading period of wheat or providing information for predicting the heading period of wheat includes the steps of (a) preparing genomic DNA isolated from wheat; (b) amplifying at least one single nucleotide polymorphism site selected from the group consisting of BA00307905 of wheat chromosome 4B (genome) and BA00204258 of wheat chromosome 3B from the nucleic acid sample; and (c) identifying the base of the single nucleotide polymorphism site in the amplified nucleic acid sample and analyzing the wheat germination period according to the genotype.

In addition, the method for predicting the heading period of wheat or the method for providing information for predicting the heading period of wheat includes (a) genomic DNA isolated from wheat as a template and containing a base at a position corresponding to the SNP of the present invention. A probe that specifically hybridizes with a polynucleotide consisting of 5 to 100 consecutive nucleic acid sequences or a polynucleotide complementary thereto; or reacting it with a primer capable of amplifying it; and (b) confirming the reactant.

In the present invention, the term 'nucleic acid sample' refers to a sample containing nucleic acid (DNA or RNA) obtained from wheat. Nucleic acid samples can be obtained from any source containing nucleic acids, such as samples of leaves, roots, stems, flowers, kernels, etc. collected from wheat. Methods for obtaining nucleic acid samples from wheat are well known in the art, and known methods can be used without limitation.

From a nucleic acid sample isolated from an individual, the base of the polymorphic site can be confirmed by amplifying the polymorphic site of the single nucleotide polymorphism marker or hybridizing it with a probe that can detect the single nucleotide polymorphism marker.

For example, polymorphic sites can be amplified using PCR, ligase chain reaction (LCR), transcription amplification, self-sustaining sequence cloning, and nucleic acid-based sequence amplification (NASBA).

Identification of bases at polymorphic sites includes sequencing analysis, hybridization by microarray, allele-specific PCR (allele-specific PCR), dynamic allele-hybridspecificization (DASH), PCR extension analysis, and SSCP. , PCR-RFLP analysis, TaqMan techniques, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), mini-sequencing methods, Bio-Plex system (BioRad), CEQ, and SNPstream. Systems (Beckman), Molecular Inversion Probe array technology (e.g., Affymetrix GeneChip), and BeadChip (HumanOmni2.5-8 from Illumina), etc. For example, the base of a polymorphic site can be confirmed using a SNP chip. SNP chip refers to a type of DNA microarray that can identify each base of hundreds of thousands of SNPs at once.

Sequencing analysis can use conventional methods for determining base sequences and can be performed using an automated genetic analyzer. In addition, allele-specific PCR refers to a PCR method that amplifies the DNA fragment where the SNP is located using a primer set including a primer designed with the base where the SNP is located as the 3' end. The principle of the method is that, for example, when a specific base is substituted from G to A, PCR is performed by designing a primer containing the G as the 3' terminal base and a reverse primer capable of amplifying a DNA fragment of an appropriate size. When performing the reaction, if the base at the SNP position is G, the amplification reaction is performed normally and a band at the desired position is observed, and if the base is replaced with A, the primer can complement the template DNA. It takes advantage of the fact that the amplification reaction is not performed properly due to the failure of complementary bonds at the 3' end. DASH can be performed by conventional methods, preferably by the method by Prince et al.

PCR extension analysis first amplifies a DNA fragment containing the base where the single nucleotide polymorphism is located using a pair of primers, then dephosphorylates all nucleotides added to the reaction to inactivate them, followed by SNP-specific extension primers and a dNTP mixture. This is accomplished by performing a primer extension reaction by adding dideoxynucleotides, reaction buffer, and DNA polymerase. At this time, the extension primer uses the base immediately adjacent to the 5' direction of the base where the SNP is located as the 3' end, and the dNTP mixture excludes nucleic acids having the same base as the dideoxynucleotide, and the dideoxynucleotide represents the SNP. It is selected from one of the base types. For example, when there is a substitution from A to G and a mixture of dGTP, dCTP and TTP and ddATP are added to the reaction, the primer is extended by DNA polymerase at the base where the substitution occurred, and after a few bases, A The primer extension reaction is terminated by ddATP at the position where the base first appears. If the substitution has not occurred, the extension reaction is terminated at that position, so that the type of base representing the SNP can be determined by comparing the lengths of the extended primers.

At this time, the detection method is to detect the SNP by detecting fluorescence using a genetic analyzer (for example, ABI's Model 3700, etc.) used for general base sequence determination in the case of fluorescently labeled extension primers or dideoxynucleotides. When using unlabeled extension primers and dideoxynucleotides, the SNP can be detected by measuring the molecular weight using matrix assisted laser desorption ionization-time of flight (MALDI-TOF) technique.

In the present invention, genomic DNA can be obtained using the SDS extraction method, CTAB separation method (Cetyl trimethyl Ammonium Bromide) commonly used in the art, or a commercially available DNA extraction kit.

PCR in the present invention may be performed by any method selected from the group consisting of real-time PCR, qRT-PCR, or multiplex PCR. However, as long as it is a method that can amplify the above-mentioned single nucleotide polymorphism site in a candidate variety or sample, May be included without limitation. In addition, the PCR product may be additionally treated with restriction enzymes.

The step of confirming the product amplified by PCR in the present invention may be performed using a DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting amplification products, gel electrophoresis can be performed, and gel electrophoresis can use agarose gel electrophoresis or acrylimide gel electrophoresis depending on the size of the amplification product.

Specifically, a single nucleotide polymorphism marker that can predict the heading period of wheat may be selected from the group consisting of BA00307905 of wheat chromosome 4B (genome) and BA00204258 of wheat chromosome 3B.

In the above,

The genotype of BA00307905 on wheat chromosome 4B is AA; or

If the genotype of BA00204258 on the wheat chromosome 3B is AA, it indicates a late heading period. In this case, the vegetative growth period of wheat is long, and the plant can have relatively large characteristics.

Also, in the above,

When BA00307905 on wheat chromosome 4B is GG; or

If BA00204258 of the wheat chromosome 3B is AG, it indicates that the wheat has an early sprouting period. In this case, the vegetative growth period of wheat is short, so the plant body is relatively small and flowering can be fast.

BA00307905 of wheat chromosome 4B refers to a single nucleotide polymorphism (SNP) marker present at a position corresponding to 416,305,576 bp of chromosome 4B, and the single nucleotide polymorphism (SNP) marker may have a genotype of AA or GG. The location of the single nucleotide polymorphism marker may be interconnected with the location in the wheat reference genome sequence (IWSGSC wheat reference genome sequence; IWGSC RefSeq v1.0). If the genotype in the above marker is AA, the corresponding wheat can be classified as a variety with a long vegetative growth period and a late heading period. If the base in the marker is GG, the wheat in question can be classified as a variety with a short vegetative growth period and rapid flowering.

BA00204258 of the wheat chromosome 3B refers to a single nucleotide polymorphism (SNP) marker present at a position corresponding to 284,404,491 bp of chromosome 3B. This single nucleotide polymorphism (SNP) marker can have a genotype of AA or AG. The location of the single nucleotide polymorphism marker may be interconnected with the location in the wheat reference genome sequence (IWSGSC wheat reference genome sequence; IWGSC RefSeq v1.0). If the genotype in the above marker is AA, the corresponding wheat can be classified as a variety with a long vegetative growth period and a late heading period. If the base in the marker is AG, the wheat can be classified as a variety with a short vegetative growth period and rapid flowering.

In addition, the present invention provides a polynucleotide consisting of 5 to 100 consecutive nucleic acid sequences containing BA00307905 of wheat chromosome 4B, or a polynucleotide complementary thereto; and

Prediction of the heading period of wheat comprising an agent capable of detecting one or more single nucleotide polymorphism markers selected from the group consisting of a polynucleotide consisting of 5 to 100 consecutive nucleic acid sequences containing BA00204258 of the wheat chromosome 3B or a polynucleotide complementary thereto Provides a composition for

The polynucleotide consisting of 5 to 100 consecutive nucleic acid sequences containing BA00307905 of the wheat chromosome (genome) 4B, or a polynucleotide complementary thereto, may include, for example, the sequence of SEQ ID NO: 2.

The polynucleotide consisting of 5 to 100 consecutive nucleic acid sequences including BA00204258 of the wheat chromosome 3B or a polynucleotide complementary thereto may include, for example, the sequence of SEQ ID NO: 1.

In addition, the present invention provides a kit for predicting the head of wheat containing the above agent.

The composition or kit for predicting the heading period of wheat according to the present invention can be used to predict the heading period of all wheat varieties. In addition, the composition can be applied not only to later generations resulting from crossbreeding between two or more wheat varieties, but also to processed products made from the above-mentioned wheat varieties as main raw materials.

An agent capable of detecting the single nucleotide polymorphism marker may be a probe or primer capable of specifically hybridizing or amplifying the polynucleotide or a polynucleotide complementary thereto.

In the present invention, the term "probe" refers to a substance that can predict the wheat germination period by specifically hybridizing with a polymorphic site of a gene. There is no particular limitation on the specific method of such genetic analysis, and the technical field to which this invention belongs It may be by any known gene detection method.

In the present invention, the term "primer" is a base sequence with a short free 3' hydroxyl group that can form a base pair with a complementary template and serves as a starting point for copying the template strand. It refers to a short sequence that functions as a point. The appropriate length of the primer may vary depending on the purpose of use, but generally may be 15 to 30 bases. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize to the template. The primer can hybridize to a DNA sequence containing a polymorphic site to amplify a DNA fragment containing the polymorphic site.

For the purpose of the present invention, the primer amplifies a single nucleotide polymorphism site that shows significant relevance for predicting the heading age of wheat.

The primers are, for example, a primer set of SEQ ID NO: 3 (5'-GCTGGCGTGTCAATGTGCTCTT-3') and SEQ ID NO: 4 (5'-GAATTCATACCCGCAGCCCT-3') or SEQ ID NO: 5 (5'-CTAGCTGCAGTTGCTGATGA-3') and SEQ ID NO: 6 It may be a primer set of (5'-CTTACTCACATATGAGCCCCT-3').

In one embodiment of the present invention, the germination period was predicted by confirming the genotype on the BA00307905 SNP in a nucleic acid sample extracted from wheat using the primer sets of SEQ ID NOs: 3 and 4, and the germination period was predicted using the primer sets of SEQ ID NOs: 5 and 6. It was confirmed that the germination period can be predicted by confirming the genotype on the BA0024258 SNP in the nucleic acid sample.

Primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. These nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution of a native nucleotide with one or more homologs, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonate, phosphotriester, phosphoro). amidates, carbamates, etc.) or charged linkages (e.g. phosphorothioate, phosphorodithioate, etc.).

In the present invention, in addition to the above composition, the kit may further include DNA polymerase, dNTP, and PCR buffer solution to facilitate the PCR reaction, and in addition, electrophoresis to check whether the PCR product is amplified. Components required for performance or identification standards for known varieties may be additionally included in the kit of the present invention. In addition, the kit may further include known components for effectively performing a reaction using a probe.

The kit can be used without limitation as long as it can detect or confirm a single nucleotide polymorphism marker. For example, the kit may be a DNA chip kit or a real time-polymerase chain reaction (RT-PCR) kit. The RT-PCR kit contains, in addition to each primer pair specific for the gene of the polymorphic marker, a test tube or other suitable container, reaction buffer (of varying pH and magnesium concentration), deoxynucleotides (dNTPs), Taq-polymerase, and It may include enzymes such as reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterilized water, etc. It may also include a pair of primers specific to the gene used as a quantitative control. A polymorphic marker can be confirmed by measuring the mRNA expression level of the single nucleotide polymorphism marker using an RT-PCR kit. DNA chip kits are generally made by attaching nucleic acid species in a gridded array to a flat solid support plate, typically a glass surface no larger than a microscope slide. Nucleic acids are arranged uniformly on the chip surface, forming a DNA chip. It is a tool that enables massively parallel analysis by causing multiple hybridization reactions between the nucleic acids on the chip and the complementary nucleic acids contained in the solution treated on the chip surface.

Kits of the present invention also include microarrays. Microarrays may contain DNA or RNA polynucleotides. The microarray may be a conventional microarray except that the probe polynucleotide includes a polynucleotide of the polymorphic marker of the present invention. Methods for manufacturing microarrays by immobilizing probe polynucleotides on a substrate are well known in the art. The probe polynucleotide refers to a polynucleotide capable of hybridization, and refers to an oligonucleotide capable of sequence-specific binding to the complementary strand of a nucleic acid.

The probe of the present invention is an allele-specific probe, in which a polymorphic site is present among nucleic acid fragments derived from two members of the same species, and hybridizes to the DNA fragment derived from one member, but does not hybridize to the fragment derived from the other member. . In this case, hybridization conditions must be sufficiently stringent to ensure that only one of the alleles hybridizes, as there is a significant difference in hybridization strength between alleles. This can lead to good hybridization differences between different allelic forms.

Microarrays can be any known microarray without limitation, and methods for producing microarrays are well known in the art. Additionally, hybridization of nucleic acids and detection of hybridization results on microarrays are also well known in the art. For example, the hybridization result can be detected by labeling a nucleic acid sample with a labeling material that can generate a detectable signal, such as a fluorescent substance, and then hybridizing it on a microarray and detecting the signal generated from the labeling material.

In the present invention, the provision of information for predicting the extraction period of the wheat can be provided through a computer program. For example, the result of confirming the base of the polymorphic site of the single nucleotide polymorphism marker of wheat is output through a computer-readable program, and as a result, it is possible to check whether the heading period of the wheat to be predicted is fast or slow. Alternatively, a cultivation method can be provided according to the predicted heading time of the wheat being tested.

The single nucleotide polymorphisms (SNPs) markers that significantly affect the sprouting period of wheat identified according to the present invention can help select cultivars for the cultivation characteristics of wheat and suggest appropriate cultivation methods depending on the wheat cultivar. It is possible.

Figure 1 shows the results of a GWAS analysis of a water extractor performed according to an embodiment of the present invention.
Figure 2 shows the results of alignment of BA00307905, performed according to an embodiment of the present invention.
Figure 3 shows the results of alignment for BA00204258, performed according to an embodiment of the present invention.

Hereinafter, the present invention will be described in detail.

Below, preferred embodiments are presented to aid understanding of the present invention. However, the following examples are provided only to make the present invention easier to understand, and the content of the present invention is not limited by the following examples.

[Example]

Preparation example 1. Collection of wheat varieties and performance of genome-wide association analysis (GWAS)

Approximately 73,000 PCRs were performed using 37 pairs of allele-specific SSR markers on 1,969 domestic and foreign cultivated and collected wheat varieties distributed by the National Genetic Resources Center (1,269 from the Genetic Resources Center and 700 items from the Promotion Agency's high-generation lineage CB). (Table 1), and digital electrophoresis was performed using Qiagen's QIAxcel program to confirm the band pattern.

primer forward (5'-3') Reverse (5'-3') Xgwm2-3A CTGCAAGCCTTGTGATCAACT CATTCTCAAATGATGGAACA Xgwm5-3A GCCAGCTACCTCGATACAACTC AGAAAGGGCCAGGCTAGTAGT Xgwm11-1B GGATAGTCAGACAATTCTTGTG GTGAATTGTGTTCTTGTATGCTTCC Xgwm44-7D GTTGAGCTTTTCAGTTCGGC AGTGGCATCCACTGAGCTG Xgwm46-7B GCACGTGAATGGATTGGAC TGACCCAATAGTGGTGGTCA Xgwm99-1A AAGATGGACGTATGCATCACA GCCATATTTGATGACGCATA Xgwm120-2B GATCCACCTTCCTCTCTCTCTC GATTATACTGGTGCCGAAAC Xgwm135-1A TGTCAACATCGTTTTGAAAAGG ACACTGTCAACCTGGCAATG Xgwm149-4B CATGTTTTCTGCCTCTAGCC CTAGCATCGAACCTGAACAAG Xgwm196-6A ACCACTGCAGAGAACACATACG GTGCTCTGCTCTTAAGTGTGGG Xgwm186-5A GCAGAGCCTGGTTCAAAAAG CGCCTCTAGCGAGAGCTATG Xgwm190-5D GTGCTTGCTGAGCTATGAGTC GTGCCACGTGGTACCTTTTG Xgwm219-6B GATGAGCGACACCCTAGCCTC GGGGTCCGAGTCCACAAC Xgwm233-7A TCAAAACATAAATGTTCATTGGA TCAACCGTGTGTAATTTTGTCC Xgwm234-5B GAGTCCTGATGTGAAGCTGTTG CTCATTGGGGTGTGTACGTG Xgwm251-4B CAACTGGTTGCTACACAAGCA GGGAGTCTGTTCCATCTTAG Xgwm257-2B AGAGTGCATGGTGGGACG CCAAGACGATGCTGAAGTCA Xgwm260-7A GCCCCCTTGCACAATC CGCAGCTACAGGGAGGCC Xgwm261-2D CTCCCTTGTACGCCTAACGC CTCGCGCTACTAGCATTG Xgwm272-5D TGCTCTTTGGCGAATATATGG GTTCAAACAAATTAAAAGGCCC Xgwm285-3B ATGACCCTTCTGCCAAACAC ATCGACCGCGATCTAGCC Xgwm312-2A ATCGCATGATGCACGTAGAG ACATGCATGCCTACCTAATGG Xgwm337-1D CCTCTTCCTCCCTCACTTAGC TGCTAACTGGCCTTTGCC Xgwm372-2A AATAGAGCCCTGGGACTGGG GAAGGACGACATTCCACCTG Xgwm400-7A GTGCTGCCACCACTTGC TGTAGGCACTGCTTGGGAG Xgwm413-1B TGCTTGTCTAGATTGCTTGGG GATCGTCTCGTCCTTGGCA Xgwm415-5A GATCTCCCATGTCCGCC CGACAGTCGTCACTTGCCTA Xgwm427-6A AAACTTAGAACTGTAATTTCAGA AGTGTGTTCATTTGACAGTT Xgwm437-7D GATCAAGACTTTTGTATCTCTC GATGTCCAACAGTTAGCTTA Xgwm469-6D CAACTCAGTGCACACACAACG CGATAACCACTCATCCACACC Xgwm480-3A TGCTGCTACTTGTACAGAGGAC CCGAATTGTCCGCCATAG Xgwm539-2D CTGCTCTAAGATTCATGCAACC GAGGCTTGTGCCCTCTGTAG Xgwm566-3B TCTGTCTACCCATGGGATTTG CTGGCTTCGAGGTAAGCAAC Xgwm610-4A CTGCCTTCTCCATGGTTTTGT AATGGCCAAAGGTTATGAAGG Xgwm626-6B GATCTAAAATGTTATTTTCTCTC TGACTATCAGCTAAACGTGT Xgwm642-1D ACGGCGAGAAGGTGCTC CATGAAAGGCAAGTTCGTCA Xgwm664-3D CAGTCAGTGCGTTTAGCAA AGCTTTGCTCTATTGGCGAG

GBS-SNP-CROP (Melo et al. 2016) was used as a GBS analysis tool, Core Hunter (Crossa et al. 2009), GenoCore (Jeong et al. 2017), MSTRAT (Gouesnard et al. 2001), Through PowerCore (Kim et al. 2007), 616 points were selected as the wheat core group, and SNP chip analysis was performed on 575 of them. SNP chip analysis experiments were performed using Axiom™ BreedWheat 35K Genotyping Array (384HT format) and Axiom GeneTitan Multi-Channel Instrument.

Preparation example 2. Association analysis of single nucleotide polymorphism markers by agricultural trait for 616 wheat core populations

A survey of major agricultural traits was conducted for 616 lines, and genome-wide association analysis (GWAS) was performed by substituting genotyping data and phenotyping data through GAPIT.

The model analysis for agricultural traits is as follows:

[Equation 1]

In Equation 1, the yi+ value means each agricultural characteristic, β0 is the intercept of the equation, β1 is the additive effect, x1i is the explanatory variable, β2 is the superiority effect, and ei is the random error.

Growth surveys and seed characteristic analysis were conducted on wheat genetic resources, and through single nucleotide polymorphism marker analysis, a total of 1,248 associated marker candidates were identified using an LOD value of 5 as a cut-off for 19 agricultural traits, including head-off period. selected.

Experimental Example 1. Search for single nucleotide polymorphism markers related to water harvesting period

Through the GWAS analysis results and GAPIT, a LOD value of 5 or higher was selected for the heading period, and through this, genes associated with SNPs were searched through SNP search and NCBI.

SNP base sequences were sequenced using the core population lineage and SNP chip data, and SNPs related to head-to-head time were searched.

Among them, two SNPs were secured, and the location of each SNP on the wheat chromosome is shown in Table 2. The position of each SNP listed in Table 2 was created based on cerealDB, and matches the position on the wheat standard genome (IWGSC RefSeq v1.0).

SNP Chromosom Position P.value maf effect LOD BA00204258
(AX-95112052) 3B 284,404,491 1.95E-08 N.A. -3.405535559 7.709965389 BA00307905
(AX-9484881) 4B 416,305,576 8.63E-07 N.A. 1.49569339 6.063989204

The sequence of the polynucleotide containing the BA00204258 SNP can be represented by SEQ ID NO: 1 (GAGCAAGCTGAACTGTGATGCGCGTGAGTTTGCTA[A/G]ACATACCAGGGGCTCATATGTGAGTAAGGAGATCA). In addition, the sequence of the polynucleotide containing the BA00307905 SNP can be represented by SEQ ID NO: 2 (AACCAGGAGTCACCGGTCTCAGCGAGCACTGCACT[A/G]TCACCCGTCAGCATGTCCTGGATGTGCTGAAGAG). In the above, [A/G] means that A or G may be present as a base in the corresponding SNP site.

Experimental Example 2. Characterization of single nucleotide polymorphism marker related to water head

In order to confirm whether the single nucleotide polymorphism marker discovered in Experimental Example 1 can predict the heading period of wheat, cultivars within the core group of wheat were randomly selected and the genotype and heading period of BA00307905 (AX-94848813) were confirmed, and domestic varieties (Geumgang, It was applied to Cheonggye, Dahong, and Groo) to confirm whether it was possible to predict the watering season through bases on the BA00307905 SNP (Table 5). The wheat used for characterization of single nucleotide polymorphism markers is shown in Table 3. In addition, cultivars within the core group of wheat were randomly selected and their genotypes and heading periods were confirmed in BA00204258 (AX-95112052), which is shown in Table 4. Applying it to domestic cultivars (Geumgang, Eunpa, Cheonggye, Dahong, and Groo), BA0024258 SNP phase It was confirmed whether the water extraction period could be predicted through the base, and the results are shown in Table 6. The HRM primers for confirming BA00307905SNP were 5'-GCTGCGTGTCAATGTGCTCTT-3' (SEQ ID NO: 3) and 5'-GAATTCATACCCGCAGCCCT-3' (SEQ ID NO: 4), and the HRM primer for confirming BA0024258 SNP was 5'-CTAGCTGCAGTTGCTGATGA. -3' (SEQ ID NO: 5) and 5'-CTTACTCACATATGAGCCCCT-3' (SEQ ID NO: 6) were used. HRM PCR for analysis is maintained at 95℃ for 5 minutes, then 1 step and 2 steps are repeated 45 times under the conditions of 95℃ for 10 seconds (1 step) and 65℃ for 25 seconds (2 steps), and the temperature is changed every 0.1 second during the PCR amplification process. This was performed by searching for changes in fluorescence.

Core group number Sample number Wheat variety name origin 36 57 Eunpa Mil Korea, South 51 88 Dahong Mil Korea, South 57 98 Milyang 13 Korea, South 111 157 Cheonggye Mil Korea, South 115 162 Sae Mil Korea, South 301 676 Keumgang Mil Korea, South 338 829 CHN-AWS-2010-1 China 341 842 Iksan 346 Korea, South 402 1035 Iksan 343 Korea, South 480 1360 Bouquet France 564 1770 Cr 15146 Germany 573 1797 COR 61-545 United States

Sample number wheat varieties BA00307905
genotype BA00204258
genotype water starter
(heading date; HD) 98 Milyang 13 GG AG 4/19 162 Sae Mil GG AG 4/17 829 CHN-AWS-2010-1 GG AG 4/18 842 Iksan 346 GG AG 4/16 1035 Iksan 343 GG AG 4/19 1360 Bouquet AA AA 5/21 1770 Cr 15146 AA AA 5/21 1797 COR 61-545 AA AA 5/16

As shown in Table 4, when the genotype of the BA00307905 SNP or the genotype of the BA00204258 SNP is AA, it was confirmed that the heading period is delayed by about a month compared to wheat with the genotype of the BA00307905 SNP as GG or wheat with the genotype of the BA00204258 SNP as AG. . In addition, the Bouquet, Cr 15146, and COR 61-545 varieties were confirmed to have the characteristic of increasing vegetative growth.

In comparison, when the genotype of the BA00307905 SNP was GG or the genotype of the BA00204258 SNP was AG, it was confirmed that the heading period was early, the vegetative growth period was short, and the plant size was small.

In order to check whether the planting period can be predicted through the above SNP, it was applied to domestic varieties (Geumgang, Cheonggye, Dahong, and Groo) to confirm whether the planting period can be predicted through the genotype on the BA00307905 SNP. The results are shown in Table 5. In addition, the results of confirming whether it is possible to predict the planting season through the genotype on the BA00204258 SNP are shown in Table 6.

Sample number wheat varieties genotype water starter 88 Dahong Mil GG 4/27 157 Cheonggye Mil GG 4/24 676 Keumgang Mil GG 4/17

Sample number wheat varieties genotype water starter 57 Eunpa Mil AG 4/22 88 Dahong Mil AG 4/27 157 Cheonggye Mil AG 4/24 676 Keumgang Mil AG 4/17

As shown in Table 5 and Table 6, the genotype on the BA00307905 SNP of Dahong, Cheonggye, and Geumgang were AG or GG, and it was confirmed that the planting season was early in April. In addition, the genotype for BA00204258 SNP in Dahong, Cheonggye, Eunpa, and Geumgang was confirmed to be AG. It can be seen that this shows the same tendency as the previously confirmed results and the results confirmed by aligning the base sequences between each variety for which the SNP was confirmed. In other words, it can be seen that the single nucleotide polymorphism marker of the present invention can effectively predict the heading period in wheat.

SEQUENCE LISTING <110> KONGJU NATIONAL UNIVERSITY INDUSTRY-UNIVERSITY COOPERATION FOUNDATION <120> A BIOMARKER FOR PREDICTING A HEAD STAGE OF WHEAT <130>P20U25C1737 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 71 <212> DNA <213> Triticum aestivum <220> <221> misc_feature <223> n is a or g. <400> 1 gagcaagctg aactgtgatg cgcgtgagtt tgctanacat accaggggct catatgtgag 60 taaggagatc a 71 <210> 2 <211> 71 <212> DNA <213> Triticum aestivum <220> <221> misc_feature <223> n is a or g. <400> 2 aaccaggagt caccggtctc agcgagcact gcactntcac ccgtcagcat gtcctggatg 60 tgcttgaaga g 71 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HRM Primer <400> 3 gctgcgtgtc aatgtgctct t 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HRM Primer <400> 4 gaattcatac ccgcagccct 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HRM Primer <400> 5 ctagctgcag ttgctgatga 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> HRM Primer <400> 6 cttactcaca tatgagcccc t 21

Claims (9)

A method of providing information for predicting the heading period of wheat, comprising confirming the genotype of one or more single nucleotide polymorphism markers selected from the group consisting of BA00307905 of wheat chromosome 4B and BA00204258 of wheat chromosome 3B from a wheat sample. According to paragraph 1,
BA00307905 on wheat chromosome 4B is AA; Alternatively, when BA00204258 of the wheat chromosome 3B is AA, a method of providing information for predicting the heading period of wheat indicates a late heading period of wheat. According to paragraph 1,
When BA00307905 on wheat chromosome 4B is GG; Alternatively, when BA00204258 of the wheat chromosome 3B is AG, a method of providing information for predicting the heading period of wheat indicates an early heading period of wheat. According to paragraph 1,
The method includes (a) preparing genomic DNA isolated from wheat;
(b) amplifying at least one single nucleotide polymorphism site selected from the group consisting of BA00307905 of wheat chromosome 4B (genome) and BA00204258 of wheat chromosome 3B from the nucleic acid sample; and
(c) A method of providing information for predicting the germination period of wheat, comprising the step of analyzing the germination period of wheat according to the bases of single nucleotide polymorphism sites in the amplified nucleic acid sample. A method for predicting the heading stage of wheat, comprising confirming the genotype of one or more single nucleotide polymorphism markers selected from the group consisting of BA00307905 of wheat chromosome 4B and BA00204258 of wheat chromosome 3B from a wheat sample. A polynucleotide consisting of 5 to 100 consecutive nucleic acid sequences containing BA00307905 of wheat chromosome 4B, or a polynucleotide complementary thereto; and
Prediction of the heading period of wheat comprising an agent capable of detecting one or more single nucleotide polymorphism markers selected from the group consisting of a polynucleotide consisting of 5 to 100 consecutive nucleic acid sequences containing BA00204258 of the wheat chromosome 3B or a polynucleotide complementary thereto Composition for. According to clause 6,
The composition wherein the agent capable of detecting the single nucleotide polymorphism marker is a probe or primer capable of specifically hybridizing or amplifying the polynucleotide or a polynucleotide complementary thereto. A polynucleotide consisting of 5 to 100 consecutive nucleic acid sequences containing BA00307905 of wheat chromosome 4B, or a polynucleotide complementary thereto; and
Prediction of the heading period of wheat comprising an agent capable of detecting one or more single nucleotide polymorphism markers selected from the group consisting of a polynucleotide consisting of 5 to 100 consecutive nucleic acid sequences containing BA00204258 of the wheat chromosome 3B or a polynucleotide complementary thereto Composition for. According to clause 8,
The agent capable of detecting the single nucleotide polymorphism marker is a kit that is a probe or primer capable of specifically hybridizing or amplifying the polynucleotide or a polynucleotide complementary thereto.