KR102369297B1 - Marker for discriminating foxglove aphid-resistant or sensitive soybean and uses thereof - Google Patents

Abstract

The present invention relates to a marker for determining Aulacorthum solani resistance or susceptibility of soybeans and uses thereof. A SNP marker of the present invention has a very high correlation with the Aulacorthum solani resistance-related gene, so that it is possible to efficiently and early identification of Aulacorthum solani-resistant or susceptible soybean resources.

Description

Marker for discriminating foxglove aphid-resistant or sensitive soybean and uses thereof}

The present invention relates to a marker for identification of soybean aphid resistance or sensitivity soybean resources and uses thereof.

Soybean ( Glycine max ) is one of the major grains widely used worldwide for applications such as protein and dairy resources, livestock feed and biofuels. Although soybean production has significantly increased over the past 20 years, there is a loss of about 19% of the actual yield by harmful animals, pathogens and viruses, and the development of pest-resistant soybeans is necessary to prevent this loss.

The soybean aphid (Aphis glycines Matsumura), a pest of the hemiptera, is an economically significant pest, causing about 58% annual yield loss and about $2.4 billion in losses of soybeans grown in North America. The soybean aphid inhabits the underside of the leaf, and by ingesting the sap from the leaf of the soybean, it causes a loss of photosynthesis and transmits the soybean mosaic virus. One of the major hemiptera pests, Aulacorthum solani Kaltenbach, hosts a wide range of plants from 25 families to 95 species, and recently causes serious damage to various crops worldwide. . Whipworm aphid causes significant worldwide harvest losses in soybeans, but little research has been done in terms of effective control methods for soybean aphids.

On the other hand, Korea Patent No. 1878539 discloses 'a polymorphic marker for aphid resistance of soybean and its use' present in the 5,497,330th base of the soybean chromosome 7, but 7,096,343 to 7,096,564 of the soybean chromosome 7 of the present invention. There is no description about the 'marker for identifying aphid aphid resistance or sensitivity soybean resource and its use' present in the second base.

The present invention has been derived by the above requirements, and the present inventors inoculate the F ₃ RIL (recombinant inbred line) population obtained by crossing PI366121 (P. After that, the degree of damage to the inoculated leaf (primary leaf damage, PLD) and total plant damage (TPD) were measured through a choice test and a non-choice test. It was confirmed that the aphid resistance gene is a single dominant gene. In addition, after creating a high-density genetic map using the SNP Chip for PI366121 (P. aphid-resistance), Williams 82 (S. Aphid susceptibility) and their F _4:8 RIL population, the entire sequence information of Williams 82 (Williams 82. a2.v1), the Glyma.07g077700 gene most closely associated with Aphid resistance was selected in the 76 kbp region between AX-90462843 and AX-90334585 on chromosome 7, and exon 5 of the Glyma.07g077700 gene By identifying a SNP (single nucleotide polymorphism) that shows a distinct difference between Aphid aphid resistance or sensitive soybean resources within the burn region (7,096,343 to 7,096,564 bp), the present invention was completed.

In order to solve the above problems, the present invention is a single nucleotide polymorphism (SNP) located at the 50th of the nucleotide sequence of SEQ ID NO: 1; SNP located at the 50th position among the nucleotide sequence of SEQ ID NO: 2; SNP located at the 51st of the nucleotide sequence of SEQ ID NO: 3; SNP located at the 51st position among the nucleotide sequence of SEQ ID NO: 4; SNP located at 51st among the nucleotide sequence of SEQ ID NO: 5; And SNP located at the 52nd position among the nucleotide sequence of SEQ ID NO: 6; Soybean ( Glycine max ) ) provides a marker for judging the resistance or susceptibility of Aphid lice.

In addition, the present invention provides a composition for discriminating aphid resistance or sensitivity soybeans, comprising an agent capable of detecting or amplifying a marker for determining resistance or sensitivity to aphid of the bean.

In addition, the present invention provides a kit for discriminating aphid resistance or sensitivity soybeans comprising the composition.

In addition, the present invention comprises the steps of isolating genomic DNA from a soybean sample; and determining the genotype of the polymorphic site, which is the base of each SNP position of the polynucleotide consisting of the nucleotide sequences of SEQ ID NOs: 1 to 6 described above. provides a way for

The SNP marker of the present invention has a very high correlation with the gene for resistance to aphids, so it is possible to efficiently identify soybean resources that are resistant or susceptible to aphids, so it is required for breeding beans with resistance to aphids. It is expected that it will be very useful to reduce the time, cost, and effort required, and the dissemination of soybean resources cultivating using the SNP marker of the present invention will be able to contribute to the income creation of soybean growers.

1 is a genetic map of the RIL population of F _4:8 105 lines obtained by crossing Williams 82 (susceptibility to aphids) and PI366121 (resistance to aphids). shows The beard aphid trait is the degree of damage to the inoculation leaf in the avoidance resistance test (Choice test) (primary leaf damage, PLD) and total plant damage (TPD), sedation resistance test (non-choice test) It means the degree of damage to the inoculated leaf (PLD) and the degree of damage to the whole plant (TPD).
2 is a genetic map of the RIL population of F _4:8 105 lines obtained by crossing Williams 82 (susceptibility to aphids) and PI366121 (resistance to aphids), a candidate gene related to resistance to aphids present in chromosome 7; ( Glyma.07g077000, Glyma.07g077100, Glyma.07g077200, Glyma.07g077300, Glyma.07g077400, Glyma.07g077500, Glyma.07g077600 and Glyma.07g077600 and Glyma.07g077700 exon 5 SNP markers are shown.
3 is a RT-PCR result comparing the relative expression level of the Glyma.07g077700 gene after inoculation with Williams 82 (susceptibility to aphids) and PI366121 (resistance to aphids).

In order to achieve the object of the present invention, the present invention is a SNP (single nucleotide polymorphism) located at the 50th of the nucleotide sequence of SEQ ID NO: 1; SNP located at the 50th position among the nucleotide sequence of SEQ ID NO: 2; SNP located at the 51st of the nucleotide sequence of SEQ ID NO: 3; SNP located at the 51st position among the nucleotide sequence of SEQ ID NO: 4; SNP located at 51st among the nucleotide sequence of SEQ ID NO: 5; And SNP located at the 52nd position among the nucleotide sequence of SEQ ID NO: 6; Soybean ( Glycine max ) ) provides a marker for judging the resistance or susceptibility of Aphid lice.

In the marker of the present invention, the consecutive nucleotides may be 8 to 100 consecutive nucleotides, but is not limited thereto.

In the present invention, the term "nucleotide" refers to deoxyribonucleotides or ribonucleotides that exist in single-stranded or double-stranded form, and unless specifically stated otherwise, includes analogs of natural nucleotides.

In the present invention, the term "polymorphism" refers to a case in which appearance or unique characteristics appear in various ways even in organisms of the same species, or when two or more alleles exist in one locus, , a polymorphism site that differs only by a single base depending on the individual is called "single nucleotide polymorphism (SNP)".

The fact that the marker of the present invention can discriminate resistance or sensitivity to aphid aphid resistance in soybeans is that the 50th nucleotide in the nucleotide sequence of SEQ ID NO: 1 is different as G or T, and the 50th nucleotide in the nucleotide sequence of SEQ ID NO: 2 is C or It appears differently as A, the 51st nucleotide in the nucleotide sequence of SEQ ID NO: 3 is different as T or C, the 51st nucleotide in the nucleotide sequence of SEQ ID NO: 4 is different as G or C, and the 51st in the nucleotide sequence of SEQ ID NO: 5 It is based on the fact that the base is represented differently by T or C, and the 52nd base in the nucleotide sequence of SEQ ID NO: 6 is represented differently by A or C.

More preferably, the 50th nucleotide of SEQ ID NO: 1 is G, the 50th nucleotide of SEQ ID NO: 2 is C, the 51st nucleotide of SEQ ID NO: 3 is T, the 51st nucleotide of SEQ ID NO: 4 is G, and the 51st nucleotide of SEQ ID NO: 5 If the base is T and the 52nd base of SEQ ID NO: 6 is A, it can be determined as aphid resistance; The 50th nucleotide of SEQ ID NO: 1 is T, the 50th nucleotide of SEQ ID NO: 2 is A, the 51st nucleotide of SEQ ID NO: 3 is C, the 51st nucleotide of SEQ ID NO: 4 is C, the 51st nucleotide of SEQ ID NO: 5 is C, If the 52nd base of SEQ ID NO: 6 is C, it can be determined as susceptibility to aphids.

The present invention also provides a composition for discriminating aphid resistance or sensitivity soybeans comprising an agent capable of detecting or amplifying a marker for discriminating the aphid resistance or sensitivity of the bean.

The agent capable of detecting or amplifying the marker for identifying the soybean aphid resistance trait may be a primer or probe specific for the marker for screening the soybean aphid resistance trait of soybean, but is not limited thereto.

In the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and can serve as a starting point for synthesis of a primer extension product. The length and sequence of the primers should allow synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required.

As used herein, the oligonucleotide used as a primer may also contain a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate or a peptide nucleic acid or An intercalating agent may be included.

As used herein, the term “probe” refers to a single-stranded nucleic acid sequence that hybridizes with a complementary single-stranded target sequence to form a double-stranded molecule (hybrid body).

In the present invention, the probe binding to and recognizing the SNP marker includes a sequence complementary to the polynucleotide sequence including the SNP, but is not limited thereto, but may be in the form of DNA, RNA, or a DNA-RNA hybrid. In addition, a fluorescent labeling factor, a radiolabeling factor, etc. may be additionally attached to the 5' or 3' end of the probe to make it recognizable with the naked eye.

The present invention also includes a composition for discriminating the soybean aphid resistance or sensitivity soybean containing a formulation capable of detecting or amplifying a marker for discriminating or amplifying the soybean aphid resistance or sensitivity of the bean A kit for identification is provided.

In one embodiment of the present invention, DNA polymerase, dNTPs and a buffer may be further included in order to perform the amplification reaction, but the present invention is not limited thereto.

In one embodiment of the present invention, the kit may further include a user guide describing optimal conditions for performing the reaction. The handbook is a printout explaining how to use the kit, eg, how to prepare reverse transcription buffer and PCR buffer, and suggested reaction conditions. Instructions include a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information published or provided through electronic media such as the Internet.

The kit of the present invention can distinguish between aphid-resistant or sensitive soybeans by detecting and confirming the base of the SNP marker provided in the present invention using the composition for discriminating against aphid-resistant soybeans. Specifically, the kit may be an RT-PCR kit, a DNA chip kit, a SNP chip kit, or a microarray chip kit, but is not limited thereto.

In one example, the RT-PCR kit includes, in addition to each primer specific for the SNP, a test tube or other suitable container, reaction buffer (pH and magnesium concentration vary), deoxynucleotides (dNTPs), dideoxynucleotides (ddNTPs) , enzymes such as Taq polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. In addition, a primer pair specific for a gene used as a quantitative control may be included.

As another example, the microarray may be configured to further include one or more polynucleotides selected from the group consisting of polynucleotides including SNP bases consisting of the nucleotide sequences of SEQ ID NOs: 1 to 6. Since the polynucleotide contains SNP bases that show polymorphism among Aphid aphid resistance or susceptible soybean resources, the microarray according to the present invention can be usefully used to discriminate Soybean aphid resistance or susceptible soybean resources or varieties.

The present invention also

isolating genomic DNA from the soybean sample; and

For discriminating soybean varieties with resistance or sensitivity to Aphids, comprising the step of determining the genotype of the polymorphic site that is each SNP position base of the polynucleotide consisting of the nucleotide sequences of SEQ ID NOs: 1 to 6 described above. provide a way

In the method according to an embodiment of the present invention, the step of determining the genotype of the polymorphic site comprises an agent capable of detecting or amplifying a marker for determining the aphid resistance of the soybean of the bean. It may be carried out using a composition for use, but is not particularly limited thereto.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples only illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Plant material

PI366121, Williams 82, PI96983 and 26 soybean resources used in the present invention (applause, protein, Daewon, Daepung, Daeheuk, Bangsa, Saeprotein, Somyung, Soho, Shinhwa, Yeonpung, Uram, Ilpom black, Chosaengsori, Thousand grains, Celadon, Celadon No. 3, Taekwang, Blue, Pungwon, Hannam, Haman, Geum and Heukjeong) were provided by the Rural Development Administration and used. The PI366121 is a soybean aphid resistant soybean resource, and the remaining soybean resources are a soybean aphid susceptible soybean resource.

In the present invention, two recombinant inbred lines (RIL) populations were used. The first RIL group is a group of F _4:8 105 strains obtained by crossing Williams 82 (susceptibility to Aphid lice) and PI366121 (resistance to Aphid lice) for QTL analysis related to Aphid resistance, and Williams 82 is a group of F. Because of its sensitivity, it was selected as a model for the first group and used as a soybean resource for whole genome sequencing.

The second RIL group is a group of F ₃ 41 lines obtained by crossing PI366121 (Aphid resistance) and PI483463 (susceptibility to Aphid lice) to confirm the genetic separation ratio of Aphid resistance. It was expected to be regulated by a single dominant gene and to exhibit Mendelian inheritance laws in the F ₃ generation.

2. Cultivation of Aphids

Rural Development Administration, National Academy of Food Sciences, Central Crop Department, soybean aphid collected from soybean fields and bred was sold and used. Aphids received for sale were bred in a growth chamber with a relative humidity of 60-80%, light conditions for 15 hours, and a temperature of 22-25°C.

3. Evaluation of Aphid Resistance

The avoidance resistance test (Choice test) and sedation resistance test (non-choice test) evaluation of the beard aphid is F _4:8 105 RIL group obtained by crossing Williams 82 and PI366121 under the same conditions as the growth conditions of the beard aphid. was carried out for The parental version and F _4:8 105 lines were sown in a 10×5 tray (550L×270W×120H mm) with the soybean as the central row, and the plants were planted in 3 repetitions in a completely randomized design (CRD) method. placed. In the V1 growth stage of soybeans, 4 adults were inoculated on the upper surface of the leaf of the plant using a paint brush, and 14 days after inoculation, the grade was graded from 1 to 9 and the degree of damage to the inoculated leaf (primary leaf damage, PLD) and total plant damage (TPD) were evaluated, where 1 means no damage and 9 means serious damage.

In addition, for the sedation resistance test, after sowing the parental version and F _4:8 105 line in the same tray with the center row empty, inoculate the aphids in the same way as above and restrict the movement of aphids between plant bodies after inoculation. 120-mesh cages were covered for safety, and primary infection leaf damage (PLD) and total plant damage (TPD) were assessed 7 days after inoculation.

In addition, the sedative resistance test for the RIL group of the F ₃ 41 line obtained by crossing PI366121 and PI483463 was also performed in the same manner as above. After inoculation of 5 adults of 5 specimens in each line, the reaction of 5 individuals was investigated. If all 5 showed resistance, homozygous resistance, if all 5 showed susceptibility, homozygous sensitivity, resistance and susceptibility When separated into two and three, it was classified as a heterozygous (isolated) lineage.

4. Genomic DNA Extraction

Genomic DNA of soybean resources was extracted using the CTAB (hexadecyltrimethylammonium bromide) method, and the extracted DNA was quantified using an ND-1000 absorbance meter.

5. Axiom ^® 180k (180,961) SNP Confirmation with Soya SNP Analysis

Using the Axiom ^® 180k (180,961) Soya SNP array, the genomic DNA of the RIL population of F _4:8 105 strains obtained by crossing Williams 82 and PI366121 and the parental copy was scanned with a GeneTitan ^® Scanner (Affymetrix, Santa Clare), Of the total of 180,961 SNPs, 8,451 SNPs were used for genetic mapping.

6. Genetic association mapping and QLT confirmation

For the genetic mapping of the first RIL population, QTL IciMapping software was used. Among the 180,961 SNPs obtained through the Axiom ^® 180k (180,961) Soya SNP analysis, only SNP markers showing polymorphism between parents were selected. LOD 3.0 or higher for ordering, nnTwoOpt (nearest neighbor was used for tour construction, and two-opt), and Rippling using the conditions of Sum of adjacent recombination fractions (SARF).

QTL search was conducted by the method of ICIM (Inclusive Composite Interval Mapping) through QTL IciMapping. The search for candidate genes related to Aphid resistance was searched using the entire sequence information of soybeans prepared based on Williams82.a2.v1. Based on the QTL searched using Soybase (http://www.soybase.org/), candidate genes were searched using physical distance.

7. Evaluation of expression levels of candidate genes related to Aphid resistance

In order to measure the expression level of candidate genes, 10 Aphids were inoculated next to Williams82 and PI366121, the parents of the first RIL group. After inoculation, 0, 24, and 48 hours after inoculation, leaf samples were collected in triplicate, RNA was extracted and cDNA was synthesized through a reverse transcription reaction. Transcription level was confirmed by qRT-PCR reaction with ABI StepOnePlus device, and all experiments were performed in triplicate. The results were analyzed with ABI StepOnePlus Software, and primers for PCR were designed using Primer 3.0 program. To normalize the expression level of the target gene ( Glyma07G077700 ) identified through PCR, the housekeeping gene cons6 was used as a standard gene.

gene Primer name Sequence information (5'→3') (SEQ ID NO:) target gene Glyma07G077700-F2 GTTTGACTCTTAGCTCGTTACCAA (7) Glyma07G077700-R2 CAAGGTTTGCTGAACGACAT (8) standard gene cons6_F AGATAGGGAAATGGTGCAGGT (9) cons6_R CTAATGGCAATTGCAGCTCTC (10)

Example 1. Analysis result of gene segregation model

As a result of performing a sedation resistance test against Aphid lice aphid in the RIL population of F ₃ 41 strains obtained by crossing PI366121 (resistance to aphids) and PI483463 (susceptibility to aphids), homozygous resistance to aphids 12 strains, 21 strains of heterozygous strains, and 8 strains of homozygous susceptibility strains were identified, and this ratio is consistent with Mendel's dominant genetic phenomenon separation ratio. there was.

Example 2. QTL analysis related to Aphid resistance

Axiom ^® 180k (180,961) As a result of searching for QTL related to Axiom aphid using the genetic map created through the Soya SNP array, a choice test and a non-choice test for Axiom aphid were conducted. It was confirmed that all of the resistance-related traits identified through this were present on chromosome 7 (Table 2). The QTL was present between AX-90462843 and AX-90334585, and the physical positions of the two markers were 7,020 kbp and 7,097 kbp, respectively, and their physical distance was 76 kbp. The logarithm of the odds (LOD) values were 9.5 for PLD-C, 7.2 for TPD-C, 5.9 for PLD-N, and 4.4 for TPD-N, showing a high correlation, and PVE (Phenotypic variation explained by the marker) was PLD. -C was 35.3, TPD-C was 28.5, PLD-N was 21.5, and TPD-N was 20.2, respectively, which showed well each phenotype (Fig. 1).

Example 3. Search for candidate genes related to Aphid resistance

Based on the QTL position related to the beard aphid found in the genetic map, as a result of searching for candidate genes related to the aphid resistance in Soybse.org on the physical map based on Williams 82, Glyma.07g077000, Glyma.07g077000, It was confirmed that there are a total of 8 genes : Glyma.07g077100, Glyma.07g077200, Glyma.07g077300, Glyma.07g077400, Glyma.07g077500, Glyma.07g077600 and Glyma.07g077700 ( FIG. 2 ).

In addition, as a result of performing genome reanalysis of the exon regions of the candidate genes, 2, 2, and 12 SNP markers were searched for at the Glyma.07g077000, Glyma.07g077400, and Glyma.07g077700 gene positions, respectively, but in the remaining genes, SNP markers was not searched for (Table 3 and Figure 2).

And, among the candidate genes of Glyma.07g077000, Glyma.07g077400 and Glyma.07g077700 , the NB-ARC gene (R gene), which is already known as a resistance gene for pathogens, is Glyma.07g077700 . .07g077700 was finally selected.

In addition, as a result of comparing the relative expression levels of the finally selected Glyma.07g077700 gene after inoculation of Williams 82 (susceptibility to aphids) and PI366121 (resistance to aphids) to PI366121, Glyma immediately after inoculation (0h) There was no difference in the expression level of the .07g077700 gene, and 24 hours after inoculation, the expression level of the Glyma.07g077700 gene was slightly higher in Williams 82 than in PI366121, but there was no statistically significant difference. It was confirmed that the expression level of the Glyma.07g077700 gene was significantly increased. Through this, it was found that the Glyma.07g077700 gene is closely related to the Aphid resistance of the Glyma.

Example 4. SNP marker development and applicability test of the marker for the determination of Aphid resistance

Using a total of 12 SNP markers (SNPs 3-1 to 3-12) present in exons 1, 4, 5, 6 and 7 of the finally selected Aphid resistance-related gene Glyma.07g077700 The applicability of the SNP marker was tested on 27 susceptible soybean resources.

As a result, at the positions of SNP 3-1, SNP 3-9, SNP 3-10, SNP 3-11 and SNP 3-12, by confirming that PI366121 (resistant soybean resource) and some susceptible soybean resources have the same allele, , It could be seen that the SNP marker could not properly discriminate between Aphid Aphid resistance or susceptible soybean resources. On the other hand, in the remaining SNP positions, it was confirmed that PI366121 (resistant soybean resource) and most sensitive resources had different alleles. That is, through this, SNP 3-3, SNP 3-4, SNP 3-5, SNP 3-6, SNP 3-7, and SNP 3-8 markers present in exon 5 in chromosome 7 of soybean were identified by It was found to be a molecular marker that can effectively discriminate resistant or susceptible soybean resources (Tables 4 and 5).

Sequence information comprising the SNP marker of the present invention SNP ID resistance allele sequence SEQ ID NO: SNP 3-3 G CCCGCTGCCGTGGCCAAAAATCTTAAGAAGCTTCACTCACTTTTCATTA [T/G] ATCTTGTCAGAGGTTGGAAGAAATTGTTAAAAAGGAAGAAGACGCAGAA One SNP 3-4 C CATTTGCTTTTACCCTGAACCATTCACTCTGGGATGCCCTGTTGTAGAT [A/C] AATTACATGTGTAGATTGCCCAAAGTTGGAGCTATTTGAAAGTGCTAAC 2 SNP 3-5 T GCTTTTACCCTGAACCATTCACTCTGGGATGCCCTGTGTGATAAATTA [C/T] ATTGTGTAGATTGCCCAAAGTTGGAGCTATTTGAAAGTGCTAACAGACAAC 3 SNPs 3-6 G ACCCTGAACCATTCACTCTGGGATGCCCTGTTGTTAGATAAATTACATGTG [C/G] TAGATTGCCCAAAGTTGGAGCTATTTGAAAGTGCTAACAGACAACCTGTT 4 SNPs 3-7 T CATTCACTCTGGGATGCCCTGTTGTTAGATAAATTACATGTGCTAGATTGC [C/T] CAAAGTTGGAGCTATTTGAAAGTGCTAACAGACAACCTGTTTTTCTCGGAT 5 SNPs 3-8 A TTACATGTGCTAGATTGCCCAAAGTTGGAGCTATTTGAAAGTGCTAACAGA [C/A] AACCTGTTTTCTCGGATCTAAAGGTATGTTACATGCAATTTGCACTCTCAATTT 6

[SNP related to Aphid susceptibility/ SNP related to Aphid resistance]

<110> Dankook University Cheonan Campus Industry Academic Cooperation Foundation <120> Marker for discriminating foxglove aphid-resistant or sensitive soybean and uses it <130> PN20266 <160> 10 <170> KoPatentIn 3.0 <210> 1 <211> 99 <212> DNA <213> Glycine max <400> 1 cccgctgccg tggccaaaaa tcttaagaag cttcactcac ttttcattag atcttgtcag 60 aggttggaag aaattgttaa aaaggaagaa gacgcagaa 99 <210> 2 <211> 99 <212> DNA <213> Glycine max <400> 2 catttgcttt taccctgaac cattcactct gggatgccct gtgttagatc aattacatgt 60 gtagattgcc caaagttgga gctatttgaa agtgctaac 99 <210> 3 <211> 101 <212> DNA <213> Glycine max <400> 3 gcttttaccc tgaaccattc actctgggat gccctgtgtt agataaatta tatgtgtaga 60 ttgcccaaag ttggagctat ttgaaagtgc taacagacaa c 101 <210> 4 <211> 101 <212> DNA <213> Glycine max <400> 4 accctgaacc attcactctg ggatgccctg tgttagataa attacatgtg gtagattgcc 60 caaagttgga gctatttgaa agtgctaaca gacaacctgt t 101 <210> 5 <211> 101 <212> DNA <213> Glycine max <400> 5 cattcactct gggatgccct gtgttagata aattacatgt gctagattgc tcaaagttgg 60 agctatttga aagtgctaac agacaacctg ttttctcgga t 101 <210> 6 <211> 106 <212> DNA <213> Glycine max <400> 6 ttacatgtgc tagattgccc aaagttggag ctatttgaaa gtgctaacag aaaacctgtt 60 ttctcggatc taaaggtatg ttacatgcaa tttgcactct caattt 106 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 gtttgactct tagctcgtta ccaa 24 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 caaggtttgc tgaacgacat 20 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 agatagggaa atggtgcagg t 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ctaatggcaa ttgcagctct c 21

Claims (7)

SNP (single nucleotide polymorphism) located at the 50th position among the nucleotide sequence of SEQ ID NO: 1; SNP located at the 50th position among the nucleotide sequence of SEQ ID NO: 2; SNP located at 51st among the nucleotide sequence of SEQ ID NO: 3; SNP located at the 51st of the nucleotide sequence of SEQ ID NO: 4; SNP located at the 51st of the nucleotide sequence of SEQ ID NO: 5; And SNP located at the 52nd position of the nucleotide sequence of SEQ ID NO: 6; Soybean (Glycine max) comprising a polynucleotide consisting of 8 or more consecutive nucleotides or a complementary polynucleotide comprising; For marker composition. According to claim 1, wherein the 50th nucleotide of SEQ ID NO: 1 is G, the 50th nucleotide of SEQ ID NO: 2 is C, the 51st nucleotide of SEQ ID NO: 3 is T, the 51st nucleotide of SEQ ID NO: 4 is G, SEQ ID NO: 5 In the case where the 51st base of T, and the 52nd base of SEQ ID NO: 6 is A, it is characterized in that it is judged as Aphid beard aphid resistance. According to claim 1, wherein the 50th nucleotide of SEQ ID NO: 1 is T, the 50th nucleotide of SEQ ID NO: 2 is A, the 51st nucleotide of SEQ ID NO: 3 is C, the 51st nucleotide of SEQ ID NO: 4 is C, SEQ ID NO: 5 If the 51st base of C, the 52nd base of SEQ ID NO: 6 is C, it is characterized in that for judging by the aphid susceptibility, a marker composition for determining the susceptibility or resistance of the soybean. According to any one of claims 1 to 3, a composition for discriminating aphid resistance or sensitivity soybeans comprising an agent capable of detecting or amplifying the marker composition for determining the resistance or sensitivity of soybeans according to any one of claims 1 to 3. A kit for discriminating aphid resistance or sensitivity soybeans comprising the composition of claim 4 . The kit according to claim 5, wherein the kit is an RT-PCR kit, a DNA chip kit, a SNP chip kit, or a microarray chip kit. isolating genomic DNA from the soybean sample; and
A soybean variety having resistance or sensitivity to Aphids, comprising the step of determining the genotype of the polymorphic site, which is the base of each SNP position of the polynucleotide consisting of the nucleotide sequence of SEQ ID NOs: 1 to 6 according to claim 1 method to determine.

Images