KR102323668B1 - INDEL marker for color discrimination of Flammulina velutipes and use thereof - Google Patents

Abstract

The present invention relates to an INDEL marker for color discrimination of enoki mushroom, and a use thereof. An INDEL marker for color discrimination of enoki mushrooms and a primer set capable of specifically detecting the marker of the present invention can discriminate traits (colors) not only in the fruit body period of enoki mushrooms but also in the mycelium period. A large amount of resources can be analyzed accurately and quickly. In addition, an INDEL primer set of the present invention can be effectively used for analysis of information corresponding to the mother or parent and progeny of the enoki mushroom variety that determines the color of the fruit body. In addition to existing cultivated varieties, it is possible to find out the color of the fruit body of newly grown enoki mushroom varieties. By rapidly and accurately discriminating white and brown-related trait markers from various enoki mushroom sources, excellent varieties can be developed quickly.

Description

INDEL marker for color discrimination of enoki mushroom and use thereof

The present invention relates to an INDEL marker for color discrimination of Flammulina velutipes and uses thereof, and more particularly, to an INDEL marker for color discrimination of enoki mushrooms and a primer set capable of specifically detecting the marker.

Enoki mushroom ( Flammulina velutipes ) is a mushroom belonging to the subphylum Basidiomycota, Agaricales, and Physalacriaceae. It occurs in the winter between Enoki mushroom is a low-temperature mushroom and is widely cultivated in Asia, especially in the distribution area. According to the data of the Ministry of Agriculture, Food and Rural Affairs in 2018, the production of agricultural mushrooms in Korea is 135,776 tons, of which the top is 28,532 tons, which is the main edible mushroom with the highest production after oyster mushroom and oyster mushroom. In 2019 mushroom export statistics, the export volume of enoki mushrooms was 11,676 tons, accounting for 59.7% of the total export of 19,548 tons of agricultural mushrooms, and the export amount was $ 20,119,000, accounting for 41.8% of the total export value of 48,139,000 dollars. occupies a large part. Enoki mushrooms cultivated and distributed in Korea and enoki mushrooms for export are mainly white-type imported species to Japan. Of the approximately KRW 8 billion in annual royalty payments for mushrooms, the top is the highest at KRW 1 billion, making it an urgent item to foster and distribute domestic varieties. Therefore, until now, Korean enoki mushroom varieties have been mainly selected and used by introducing varieties developed in Japan and suitable for our cultivation conditions.

Recently, through molecular breeding systems, molecular markers are being actively developed for the purpose of searching for useful traits, recognizing species of organisms, and identifying varieties. For this purpose, a RAPD (randomly amplified polymorphic DNA) method using PCR (Polymerase Chain Reaction) was developed. The RAPD method has the advantage of being able to confirm the results simply and quickly, but has a disadvantage in that reproducibility is poor because non-specific PCR products are amplified. In addition, the AFLP (Amplified Fragment Length polymorphism) method is capable of detecting high DNA polymorphism, but has poor reproducibility and is complicated. SSR (single sequence repeat) is a method for preparing and analyzing PCR primers for repetitive microsatellite sequences. have. However, there are disadvantages in that it is difficult to discover repetitive nucleotide sequences related to specific traits and a high-density genetic map is required. In addition, research on the analysis of the genome of living organisms and the development of specific genetic markers using the same is being actively conducted. There are representative single nucleotide polymorphism (SNP) markers and insertion/deletion (INDEL, insertin/deletion) markers in the development of discriminant markers through genome analysis. Compared to other markers, reaction conditions are not affected by the environment. Therefore, it can be used as a more accurate and detailed molecular marker.

INDEL (insertion/deletion) marker is a generic term for mutations in which some bases are inserted or deleted in the middle of the DNA base sequence of an organism. A specific variety can be identified by finding an insertion or deletion region, making a primer based on the information, amplifying the DNA using PCR technology, and analyzing the pattern.

Accordingly, the present inventors performed genomic analysis of enoki mushroom resources, identified INDEL markers specifically identified in white and brown enoki mushrooms by bioinformatic analysis, developed a specific primer set for this, and PCR analysis using the same. The present invention was completed by developing a method for color discrimination of enoki mushrooms.

It is an object of the present invention to provide an insertion-deletion marker composition for color discrimination of enoki mushrooms including a gene encoding phenylalanine ammonia lyase.

Then, another object of the present invention is to provide a composition for color discrimination of enoki mushrooms comprising an agent capable of detecting or amplifying the marker composition.

In addition, another object of the present invention is to provide a kit for color discrimination of enoki mushrooms comprising the composition for color discrimination of enoki mushrooms.

Finally, another object of the present invention is to provide a method for color discrimination of enoki mushrooms using the composition for color discrimination of enoki mushrooms.

In order to achieve the above object, the present invention provides an insertion-deletion marker composition for color discrimination of enoki mushrooms comprising a gene encoding phenylalanine ammonia lyase.

Next, the present invention provides a composition for color discrimination of enoki mushrooms comprising an agent capable of detecting or amplifying the marker composition.

In addition, the preparation may include an insertion-deletion primer set capable of amplifying the polynucleotide of SEQ ID NO: 1.

In addition, the present invention provides a kit for color discrimination of enoki mushrooms comprising the composition for color discrimination of enoki mushrooms.

Finally, the present invention provides a first step of extracting genomic DNA from enoki mushrooms; A second step of amplifying the genomic DNA using the composition for color discrimination of enoki mushrooms of claims 3 to 6; It provides a method for discriminating the color of enoki mushrooms, including a third step of analyzing the amplification product obtained in the second step.

In addition, in the method, when the composition for determining the color of enoki mushroom in step 2 is a primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4, the size of the amplification product is 200 bp, determining as a brown enoki mushroom;

When the composition for color discrimination of enoki mushroom in step 2 is a primer set consisting of SEQ ID NO: 2 and SEQ ID NO: 5, the size of the amplification product is 293 bp, it is determined as white enoki mushroom; and

When the composition for color discrimination of enoki mushroom in step 2 is a primer set consisting of SEQ ID NOs: 2, 3, 4 and 5, the size of the amplification product is 464 bp, 293 bp, and 200 bp, it is a brown enoki mushroom, 464 bp and 200 bp bp, step 4 of discriminating as white enoki mushrooms; may additionally include.

The INDEL marker for color discrimination of the enoki mushroom of the present invention and the primer set capable of specifically detecting the marker can discriminate the trait (color) in the mycelium as well as in the mature fruit body of the enoki mushroom. A large amount of resources can be analyzed accurately and quickly. In addition, the INDEL primer set of the present invention can be effectively used for analysis of information corresponding to the parent or parental and progeny of the enoki mushroom variety that determines the color of the fruiting body, and thus can be used not only for existing cultivated varieties, but also for newly grown enoki mushroom varieties. It has the advantage of rapidly developing excellent varieties by quickly and accurately discriminating white and brown-related trait markers from various enoki mushroom resources because it can determine the color of the fruiting body.

1 schematically shows a bioinformation analysis process for developing an INDEL marker for color discrimination of enoki mushrooms of the present invention.
2 shows the nucleotide sequences for the specific INDEL marker sites for brown and white enoki mushrooms of the present invention.
3 schematically shows the reaction process of the INDEL marker-specific primer set of the present invention to brown and white enoki mushrooms.
4 is a photograph showing the results of amplifying the DNA of brown and white enoki mushrooms using the INDEL marker-specific primer set of the present invention.

The present inventors performed genomic analysis of enoki mushroom resources, identified INDEL markers specifically identified in white and brown enoki mushrooms by bioinformatic analysis, developed a specific primer set for them, and PCR analysis using them. The present invention was completed by developing a method for color discrimination of enoki mushrooms.

Hereinafter, the present invention will be described in more detail.

The present invention provides an insertion-deletion marker composition for color discrimination of enoki mushrooms comprising a gene encoding phenylalanine ammonia lyase.

In addition, the gene encoding the phenylalanine ammonia lyase may be composed of the nucleotide sequence represented by SEQ ID NO: 1. As a nucleotide sequence showing at least 70%, specifically 80% or more, more specifically 90% or more, even more specifically 95% or more, and most specifically 99% or more homology to the sequence of SEQ ID NO: 1, substantially If it is possible to express a protein having phenylalanine ammonia lyase activity, it may be included without limitation.

As used herein, the term "insertion-deletion marker" or "INDEL (Insertion-deletion) marker" refers to a mutation in which some bases are inserted or deleted in the middle of a DNA base sequence. The INDEL marker searches for regions that are inserted or deleted from the standard genome through a method of comparative analysis of the reference genome and the genomic information of the variety used in the experiment, and prepares a primer based on the information. Therefore, the amplification result can represent two types of band size compared to the standard genome, large (insertion) and small (deletion). Among the various types of markers based on genomic information, the INDEL (Insertion/Deletion) marker is a method that detects polymorphisms using PCR (polymerase chain reaction) technology, and is a relatively simple method to obtain rapid analysis results. In addition, nucleotide sequences inserted or deleted in the genome exist in various lengths not only in intra-species but also in inter-species, making them suitable for cultivar classification. The standard genome of the insertion-deletion (INDEL) marker of the present invention is a gene encoding phenylalanine ammonia lyase.

Next, the present invention provides a composition for color discrimination of enoki mushrooms comprising an agent capable of detecting or amplifying the marker composition.

In addition, the agent may be an insertion-deletion primer set capable of amplifying the polynucleotide of SEQ ID NO: 1, but is not limited thereto, and is specific to the desired polynucleotide included in genomic DNA. A probe capable of specifically binding to a target polynucleotide contained in genomic DNA, the polynucleotide or its complementary polynucleotide as a means for enabling binding and recognition or amplifying the polynucleotide is specific It may be a primer that can be actively amplified.

The primer set of the present invention may be used for amplification of a target sequence, and preferably may be used for amplification of an indel (INDEL) marker for color discrimination of enoki mushrooms. In addition, the primer set includes a primer set consisting of SEQ ID NOs: 3 and 4; a primer set consisting of SEQ ID NOs: 2 and 5; and a primer set consisting of SEQ ID NOs: 2, 3, 4 and 5; may include any one primer set selected from the group consisting of.

As used herein, the term “probe” is a DNA or RNA nucleotide sequence of various lengths, and a radioactive label or fluorescent label may be additionally attached to the 5' or 3' end, and a complementary sequence composed of a single-stranded nucleotide sequence. It is characterized in that it specifically binds to and hybridizes to single-stranded DNA or RNA with In the present invention, it may include a sequence complementary to the polynucleotide sequence of the indel marker, and may be in the form of DNA, RNA, or a DNA-RNA hybrid, but is not limited thereto.

The term "primer" as used in the present invention is a nucleic acid sequence having a short free 3' hydroxyl group, which can form a complementary template and a base pair, and can form a base pair of the template. A short nucleic acid sequence that serves as a starting point for copying. The length and sequence of the primer should allow synthesis of the extension product to begin, and the specific length and sequence of the primer will depend on the complexity of the DNA or RNA target required, as well as the conditions of use such as temperature and ionic strength. something to do. As a specific example, the specific length and sequence of the primer should be determined in consideration of various conditions such as guanine and cytosine contents (GC contents), GC arrangement, annealing temperature, and ionic strength. Primers are capable of initiating DNA synthesis in the presence of four different nucleoside triphosphates (dNTPs) and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) in an appropriate buffer and temperature.

In addition, the appropriate length of the primer may vary depending on the purpose of use, but may be generally used in a size of 15 to 30 nucleotides. The primer sequence does not need to be completely complementary to the polynucleotide containing the insertion-deletion (INDEL) marker or its complementary polynucleotide, and can be used as long as it is sufficiently complementary to hybridize. In addition, as long as it is a synthesis technique known in the art, it can be obtained without limitation.

In addition, the primers may be modified, for example methylation, capping, substitution of nucleotides or modifications between nucleotides, for example, uncharged linkages (eg methyl phosphonate, phosphotriester, phosphoroamie). date, carbamate, etc.) or charged linkages (eg phosphorothioate, phosphorodithioate, etc.).

In addition, the color of the enoki mushroom is preferably white or brown, but is not limited thereto.

In addition, the present invention provides a kit for color discrimination of enoki mushrooms comprising the composition for color discrimination of enoki mushrooms.

In addition, the kit can be used to discriminate the color of enoki mushrooms by detecting through amplification of the indel marker of the present invention using the composition for color discrimination of enoki mushrooms.

In addition, the kit may be a kit for PCR (polymerase chain reaction) analysis, but is not limited thereto.

In addition, when the kit is used as a kit for PCR (polymerase chiain reaction) analysis, it may further include a DNA polymerase, dNTPs, and a buffer solution for PCR reaction.

Finally, the present invention provides a first step of extracting genomic DNA from enoki mushrooms; A second step of amplifying the genomic DNA using the composition for color discrimination of enoki mushrooms of claims 3 to 6; It provides a method for determining the color of enoki mushrooms, including a third step of detecting the amplification product obtained in the second step.

In addition, the genomic DNA of step 1 preferably includes a gene encoding phenylalanine ammonia lyase.

In addition, the amplification of the two steps is a polymerase chain reaction (PCR), a ligase chain reaction, a nucleic acid sequence-based amplification, a transcription-based amplification system. , strand displacement amplification, and amplification through Qβ replica, nucleic acid-based sequence amplification (NASBA), and other suitable methods for amplifying nucleic acid molecules known in the art can be used without limitation.

In addition, in the discrimination method, the primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4 in the second step to determine the color of the enoki mushroom; Alternatively, an amplification reaction may be performed using a primer set consisting of SEQ ID NO: 2 and SEQ ID NO: 5 to amplify the target sequence.

In addition, the detection of the amplification product may be performed through a DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, phosphorescence measurement, etc., but is not limited thereto.

In addition, in the above method, when the composition for color discrimination of enoki mushroom in step 2 is an insertion-deletion primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4, if the size of the amplification product is 200 bp, a brown enoki mushroom to determine;

When the composition for color discrimination of enoki mushroom in step 2 is an insertion-deletion primer set consisting of SEQ ID NO: 2 and SEQ ID NO: 5, if the size of the amplification product is 293 bp, white enoki mushroom;

When the composition for color discrimination of enoki mushroom in step 2 is a primer set consisting of SEQ ID NOs: 2, 3, 4 and 5, the size of the amplification product is 464 bp, 293 bp, and 200 bp, it is a brown enoki mushroom, 464 bp and 200 bp bp, step 4 of discriminating as white enoki mushrooms; may additionally include.

That is, when PCR is performed using the nucleotide sequence of SEQ ID NO: 1 as a template, when the primer set consisting of SEQ ID NOs: 3 and 4 is used, a 200 bp brown enoki mushroom-specific amplification product may be obtained, and SEQ ID NO: 2 and When a primer set consisting of 5 is used, a 293 bp white enoki mushroom-specific amplification product may be obtained. A brown enoki mushroom-specific amplification product of bp and 200 bp may be obtained, or a white enoki mushroom-specific amplification product of 464 bp and 200 bp may be obtained.

Hereinafter, embodiments of the present invention will be described in more detail with reference to the accompanying drawings. However, the following examples are only intended to materialize the contents of the present invention, and the present invention is not limited thereto.

<Example 1> Enoki mushroom genome sequence variation analysis and color-related gene selection

To develop color-related insertion-deletion (INDEL) markers for enoki mushrooms, enoki mushrooms ( Flammulina velutipes ) whose genome sequence was analyzed among genetic resources collected and preserved by the Mushroom Department of Rural Development Administration Relevant genes and mutations were analyzed. Enoki mushroom-related strains are shown in Table 1 below. 1 schematically shows a bioinformation analysis process for developing an INDEL marker for color discrimination of enoki mushrooms of the present invention. Referring to FIG. 1 , the mutation region of enoki mushroom ( Flammulina velutipes ) was searched for by performing bioinformatics analysis using a computer program or the like. The results are shown in FIG. 2 . 2 shows the nucleotide sequences for the specific INDEL marker sites for brown and white enoki mushrooms of the present invention.

In order for enoki mushroom to form a fruit body, it must be a dikaryon with two nuclei in the cell, and a monokaryon cannot form a fruit body. In the case of brown enoki mushrooms, it is assumed that all color-related genes are dominant (AA) or co-dominant (Aa), and that all white enoki mushrooms are recessive (aa). Among mutations with different sequences, homozygous-recessive variations were selected, excluding heterozygous variations. Among the selected mutations, the InDel mutation present in the gene was finally selected, and as a result of performing an NCBI search with the gene nucleotide sequence (SEQ ID NO: 1) containing the mutation, it was confirmed as a phenylalanine ammonia lyase. As shown in FIG. 2, as a result of comparing the nucleotide sequence (SEQ ID NO: 1) of the gene encoding phenylalanine ammonia lyase of brown and white enoki mushrooms, the sequences of all brown enoki mushrooms used in the present invention Base sequences 432 to 437 of No. 1 were identified as GCGCAC (exon 3), but all white enoki mushrooms were confirmed to have the corresponding sequence deleted.

series
number strain
number Color collection station karyotype scientific name One 4019 Brown Korea heteronuclear Flammulina velutipes 2 4019-20 Brown Korea mononuclear Flammulina velutipes 3 4028 Brown Taiwan heteronuclear Flammulina velutipes 4 4019-1820 Brown Korea heteronuclear Flammulina velutipes 5 4049 Brown Korea heteronuclear Flammulina velutipes 6 4057 Brown China heteronuclear Flammulina velutipes 7 4064 Brown Korea heteronuclear Flammulina velutipes 8 4067 Brown Korea heteronuclear Flammulina velutipes 9 4069 Brown Japan heteronuclear Flammulina velutipes 10 4072 Brown China heteronuclear Flammulina velutipes 11 4083 Brown Korea heteronuclear Flammulina velutipes 12 4090 Brown Korea heteronuclear Flammulina velutipes 13 4103 Brown Korea heteronuclear Flammulina velutipes 14 4175 Brown Korea heteronuclear Flammulina velutipes 15 4019-20 X mono3 Brown Korea heteronuclear Flammulina velutipes 16 4210 White Korea heteronuclear Flammulina velutipes 17 mono-3 White Korea mononuclear Flammulina velutipes 18 mono-19 White Korea mononuclear Flammulina velutipes 19 4166 White Korea heteronuclear Flammulina velutipes 20 4178 White Korea heteronuclear Flammulina velutipes 21 4209 White Japan heteronuclear Flammulina velutipes 22 4167 White Japan heteronuclear Flammulina velutipes 23 4169 White Korea heteronuclear Flammulina velutipes

<Example 2> Preparation of primers using INDEL markers in enoki mushroom color-related genes

Based on the nucleotide sequence (SEQ ID NO: 1) of the gene encoding phenylalanine ammonia lyase, a color-related gene for enoki mushrooms selected in Example 1, primers for brown and white enoki mushroom-specific INDEL markers were prepared did. First, primers capable of amplifying both brown and white enoki mushrooms (SEQ ID NO: 2 and SEQ ID NO: 3) and nucleotide sequences 432 to 437 (GCGCAC) of SEQ ID NO: 1 are included to specifically amplify only brown enoki mushrooms ( SEQ ID NO: 4) was prepared. In addition, a primer (SEQ ID NO: 5) capable of specifically amplifying only white enoki mushrooms was prepared based on the white enoki mushroom nucleotide sequence in which nucleotide sequences 432 to 437 (GCGCAC) of SEQ ID NO: 1 were deleted (see FIG. 3). . The primers prepared in the present invention are shown in Table 2 below.

order
number base sequence order
number base sequence Amplification size (bp) 2 TCTCCACTTACCTTCTCCTA 3 TATGGTAAGTACACGGTCAG 464 3 TATGGTAAGTACACGGTCAG 4 TTCCTAGCGGACACGCGCAC 200 2 TCTCCACTTACCTTCTCCTA 5 TTGAGAGGTTGGTCAGTGTC 293

<Example 3> PCR analysis using INDEL marker-specific primers of brown or white enoki mushrooms

In order to improve the discrimination effectiveness of 17 brown enoki mushrooms, 10 white enoki mushrooms, and the primer set developed in the present invention, 2 commercially available white enoki mushrooms (Cheongdo, Jeonnam enoki) and 1 brown enoki mushroom (golden enoki) ) was subjected to PCR. The enoki mushroom varieties used are shown in Table 3 below. PCR was performed using the nucleotide sequence (SEQ ID NO: 1) of the gene encoding phenylalanine ammonia lyase as a template, and using the primer set prepared in Example 2.

Specifically, 30 kinds of enoki mushrooms used in PCR were inoculated on potato glucose agar (potato dextrose agar, PDA) and cultured for 7 days in an incubator at 25° C., and then the mycelia were freeze-dried. Grind the lyophilized mycelium with liquid nitrogen, transfer it to a 1.5 ml tube, and phenol:chloroform:isoamylalchol in the same amount as 300 μl of the extraction solution [100 mM NaCl, 50 mM EDTA, 0.25 M Tris-HCl (pH 8.0), 5 % SDS]. (25:24:1) was added, mixed, and centrifuged at 12,000 rpm and 4°C for 15 minutes, and the supernatant was transferred to a new 1.5 ml tube. 0.6 times of isopropanol (Isopropanol) was mixed with the supernatant, centrifuged at 12,000 rpm, 4°C for 20 minutes, the supernatant was removed, and 70% ethanol was added and washed. The DNA precipitate in the tube was air-dried, dissolved in tertiary sterile distilled water, and used for PCR amplification. In order to PCR amplify the INDEL marker, 1 μl of extracted DNA, 12.5 μl of AccuPower Taq PCR Master Mix (Bioneer, Korea), 0.25 pmol of each primer (SEQ ID NOs: 2, 3, 4 and 5) were mixed and final 20 with sterile distilled water. μl was used for the reaction. The PCR amplification reaction was performed at 94 °C for the first 10 minutes, followed by a total of 30 repetitions of 30 seconds at 94 °C, 30 seconds at 56 °C, and 1 minute at 72 °C, and finally reacted at 72 °C for 10 minutes to complete the reaction. The sample in which the PCR amplification reaction was completed was electrophoresed on 3% agarose gel to confirm the amplification product. The results are shown in FIG. 4 .

4 is a photograph showing the results of amplifying the DNA of brown and white enoki mushrooms using the INDEL marker-specific primer set of the present invention.

As shown in FIG. 4, 464 bp amplification products were confirmed for all enoki mushrooms. This means that all enoki mushrooms contain a gene (SEQ ID NO: 1) encoding phenylalanine ammonia lyase in their genomic DNA. In all brown enoki mushrooms, amplification products of 200 bp were confirmed, and in all white enoki mushrooms, amplification products of 293 bp were confirmed. Also, as expected, an amplification product of 293 bp was identified in two commercially available white enoki mushrooms (Cheongdo, Jeonnam), and an amplification product of 200 bp in one brown enoki mushroom (Golden enoki). These results indicate that the primer set prepared in Example 2 was amplified by accurately reacting according to the color of the enoki mushroom. In addition, when all of the 464 bp, 293 bp, and 200 bp amplification products are confirmed, it is heterozygous dominant (Aa) and can be distinguished as a brown enoki mushroom. These results indicate that the INDEL marker and primer set of the present invention can be effectively used for breeding enoki mushrooms with excellent traits by specifically discriminating the gene that determines the color of the fruit body of enoki mushrooms.

series
number strain
number Color collection station karyotype scientific name One 4019 Brown Korea heteronuclear Flammulina velutipes 2 4049 Brown Korea heteronuclear Flammulina velutipes 3 4057 Brown China heteronuclear Flammulina velutipes 4 4090 Brown Korea heteronuclear Flammulina velutipes 5 4103 Brown Korea heteronuclear Flammulina velutipes 6 4111 Brown Philippine heteronuclear Flammulina velutipes 7 4146 Brown Korea heteronuclear Flammulina velutipes 8 4149 Brown Korea heteronuclear Flammulina velutipes 9 4163 Brown Japan heteronuclear Flammulina velutipes 10 4175 Brown Korea heteronuclear Flammulina velutipes 11 4218 Brown Korea heteronuclear Flammulina velutipes 12 4219 Brown Korea heteronuclear Flammulina velutipes 13 4232 Brown Korea heteronuclear Flammulina velutipes 14 4074 White Korea heteronuclear Flammulina velutipes 15 4166 White Korea heteronuclear Flammulina velutipes 16 4168 White Japan heteronuclear Flammulina velutipes 17 4209 White Japan heteronuclear Flammulina velutipes 18 4210 White Korea heteronuclear Flammulina velutipes 19 4216 White Korea heteronuclear Flammulina velutipes 20 4217 White Korea heteronuclear Flammulina velutipes 21 4226 White Japan heteronuclear Flammulina velutipes 22 4228 White Japan heteronuclear Flammulina velutipes 23 4230 White Korea heteronuclear Flammulina velutipes 24 4231 White Korea heteronuclear Flammulina velutipes 25 4148 Brown Korea heteronuclear Flammulina velutipes var. lactea 26 4019-20 Brown Korea mononuclear Flammulina velutipes 27 4019-1820 Brown Korea heteronuclear Flammulina velutipes 28 cheongdo top White Korea heteronuclear Flammulina velutipes 29 Jeonnam Top White Korea heteronuclear Flammulina velutipes 30 golden top Brown Korea heteronuclear Flammulina velutipes

As described above, although specific embodiments of the present invention have been described in detail, those skilled in the art who understand the spirit of the present invention may add, change, delete, etc. other components within the scope of the same spirit, and other degenerate inventions However, other embodiments included within the scope of the present invention may be easily proposed. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention is indicated by the following claims rather than the above detailed description, and all changes or modifications derived from the meaning and scope of the claims and their equivalents are included in the scope of the present invention. should be interpreted as

<110> Konkuk University Glocal Industry-Academic Collaboration Foundation <120> INDEL marker for color discrimination of Flammulina velutipes and use it <130> 2020-I245 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 2746 <212> DNA <213> Flammulina velutipes <220> <221> gene <222> (1)..(2746) <223> phenylalanine ammonia lyase <400> 1 atgccttcag aactcttcga cctcgacaat gccagggctg cccgcgacac tttcctagac 60 gcgcgccgta ctgctaccct attgcacaaa tttcttgata gccaccggga actcaagagc 120 tacaagtatg ttacgcgtct tctctcgtat ttctctccac ttaccttctc ctaggaatgg 180 acgcaccatt aatgtagatg gccatacact gtctctcgcc gctgtgaccg ccgctgcgcg 240 ctacaacgcc aacgttgagt tgagtcagag tgcacaggtc aaggaaggcg tcgagaagag 300 tcgcgccgtc atcgctgaaa aggtggagca aggcactagt gtctacggcg tctccactgg 360 ctttggtggc agcggtcagt cgatgcaaac tatgattccg ccccgcatct aattcaattc 420 ctagcggaca cgcgcactga ccaacctctc aagctgcagc aggctcttct tcaacatcag 480 catgctggcg ttctccccag ctcaagcaag actctaggtg tacttcctct aatggatccg 540 atggccgcga caagcatgcc tgaggcttgg gttcggtaaa ttctccatgt tctagatctg 600 accgtgtact taccataacc acagaggtgc catgctaatc cgaatgaact cgttgatacg 660 ggggcattca ggagttcggt tcgtgatgtg tccccagcat cgctgaacgg tatcgctaac 720 acgtactaga tgggagctta ttgaaaagat caatgacctg ctccgagcca acatcacacc 780 agtagtcccg cttcgctcaa gcatctcagc ctccggaggt atgtttacgt gctcgataat 840 taaactggtc cctgaacagt gattaagatt tatctcctct ctcatatgtg gctggaacct 900 tgagtacgtc tttacattca tttagacgtt ctccggctca ccacgctcgg ttttcagccg 960 ccaacccatc gattcgcgtc ttcgatggac cttctgcctt cggtgcgcga aaaatggtct 1020 catctagaga cgctttggcc gcgcacaaga tcaaaccagt cactcttgcg tccaaagagg 1080 gtttaggcat tttgaacggg acggcatttt ccgcggcagt cgcgtcactt gctctgactg 1140 aggcaactca tcttgctctt ctggctcaag tctgtactgc tcttggcacg gaggctcttt 1200 gtggaacaac aggatcatat gcgcctttca tccatgtcac tgctcggcct catcctggcc 1260 aggtaaacaa tcttgaattt atctttgttt catctactta caaattgccg catcttacca 1320 gatcgaagcc gccaacaaca tgtggaatct tctgcaaggc agtaaacttg cctccggaca 1380 cgaagaggaa gtgtccatca accaagacaa atatgagtta cgccaggacc gctacccatt 1440 gaggacctcg ccccaattcc tcggccctca aatagaagat attctcgctg cactagcatc 1500 agtcactcaa gaatgtaact caagtaagca tcgcctttta ttccaatttc ccgcatctaa 1560 cacaaagttt aatagccact gataacccgc ttgttgatgg gaacactggt gaagttcacc 1620 acggcggcaa cttccaagct atggctatct ctaacgccat ggaaaagaca cgtcttgcag 1680 tgcatcacat cggcaagctt atgttttctc aaagcaccga actggtcaac cccgctatga 1740 accatggcct tccgccttcg ctcgctgctt ctgatccgtc tttgaactac cacggcaagg 1800 gtgtcgatat cgccactgca gcgtacgtct cagagttagg ctacctcgca aaccccgtca 1860 ccacacacat tcaatccgcc gagatgcaca accaggctgt gaagtgggtt ttctcttcaa 1920 cgctctatga attccaggct gactttgaac tttacctagc tcgttggctc tgatctctgc 1980 ccgagcgact gtgacttctc tggatgtcct gaccattctt atgtcctcgt acctctacct 2040 cctctgccaa ggtaattctc cttctctcct tttttgtgac actgcgggct cacacgtata 2100 cagctgttga ccttcgtgcc ctccgacgcg acctagatgt cggtgtccgc gccattatcg 2160 ctgaagaagt gtctaagctt ttctcaaaca acctctcttc tgaggaaatg gacctgctac 2220 actcatccct atattcaaaa taccaacata ctatggataa gacgaccaca atggacgccg 2280 tggaccagat gaaggaggtg accgcatctt tcgcgccgat gctcgtggag gtgttcacct 2340 caactcgagt catgcctgac gccctcagcg ccatccctcg ctttagatct aatatctctt 2400 cgcgcgctac gcagctgttt gatagactac gcgcaagcta cctttcgggc gagcgtggtg 2460 ccactcctgc cagctccctt ttaggccgga cacgttcggt gtacgaattc atccgtgtct 2520 ctttgggaat tcgcatgcat ggctcggaga actatagcgc ctttgccaat gggctgggcg 2580 tcgatgaccc tactattggt cagaacatct cgtcgatcta tgaggtgagg ttttatgata 2640 tggatgaatg cgatagctaa cgggatttct ataggccatc cgggacggca aattccacga 2700 cgtcgtagca gacctctttg aggctctgcc tcgcagcaag ctctag 2746 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 tctccactta ccttctccta 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 tatggtaagt acacggtcag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ttcctagcgg acacgcgcac 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ttgagaggtt ggtcagtgtc 20

Claims (10)

In the insertion-deletion marker composition for determining the color of enoki, comprising a gene encoding phenylalanine ammonia lyase,
The gene encoding the phenylalanine ammonia lyase comprises the nucleotide sequence represented by SEQ ID NO: 1, Insertion-Deletion marker composition for color discrimination of enoki mushrooms.
delete A composition for color discrimination of enoki mushrooms, comprising an agent capable of detecting or amplifying the marker composition of claim 1 .
4. The method of claim 3,
The agent is an insertion-deletion (Insertion-Deletion) primer set capable of amplifying the polynucleotide of SEQ ID NO: 1, the composition.
5. The method of claim 4,
The primer set includes a primer set consisting of SEQ ID NOs: 3 and 4; a primer set consisting of SEQ ID NOs: 2 and 5; And SEQ ID NO: 2, 3, 4, and a primer set consisting of 5; characterized in that any one selected from the group consisting of, the composition.
4. The method of claim 3,
The composition, characterized in that the color discrimination of the enoki mushroom is white or brown.
A kit for color discrimination of enoki mushrooms, comprising the composition of any one of claims 3 to 6.
8. The method of claim 7,
The kit is a kit for determining the color of enoki mushrooms, characterized in that it is for PCR (polymerase chain reaction) analysis.
Step 1 of extracting genomic DNA from Enoki mushroom;
A second step of amplifying the genomic DNA extracted in the first step using the composition for color discrimination of any one of claims 3 to 6;
A method of determining the color of enoki mushrooms, including; step 3 of analyzing the amplification product obtained in step 2 above.
10. The method of claim 9,
In the above method, when the composition for color discrimination of enoki mushroom in step 2 is a primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4, the size of the amplification product is 200 bp, determining as a brown enoki mushroom;
When the composition for color discrimination of enoki mushroom in step 2 is a primer set consisting of SEQ ID NO: 2 and SEQ ID NO: 5, if the size of the amplification product is 293 bp, it is determined as a white enoki mushroom; and
When the composition for color discrimination of enoki mushroom in step 2 is a primer set consisting of SEQ ID NOs: 2, 3, 4 and 5, if the size of the amplification product is 464 bp, 293 bp, and 200 bp, it is a brown enoki mushroom, 464 bp and 200 bp bp, step 4 of discriminating as a white enoki mushroom;

Images