KR102298723B1 - Marker for discrimination of resistance to tomato yellow leaf curl virus and discrimination method using the same marker - Google Patents

Abstract

The present invention relates to a marker for determining tomato yellow leaf curl virus resistance and a discrimination method using the same, and by using the marker of the present invention and an agent capable of detecting or amplifying the same, it is possible to quickly and accurately determine tomato yellow leaf curl virus resistance.

Description

Marker for discrimination of resistance to tomato yellow leaf curl virus and discrimination method using the same marker}

The present invention relates to a marker for judging tomato yellow leaf curl virus resistance and a discrimination method using the same.

The global seed market for tomatoes is a high value-added global vegetable crop worth about 1 trillion won, and consumption has increased in Korea as well. The expansion of the domestic tomato market led to the revitalization of the cultivation of new varieties. Tomato yellow leaf curl virus (TYLCV) is a disease that causes a great problem in tomato cultivation, and the cultivation of resistant tomato varieties has been the main breeding goal. Existing breeding methods based on phenotypes are time-consuming and costly to develop excellent varieties, so many studies have been made to improve selection efficiency by using DNA molecular markers. DNA molecular markers are specific nucleotide sequence fragments that can determine whether polymorphism is present in the genome of an organism, and have the advantage of being fast and highly accurate as they are not affected by the cultivation environment and the growth stage of crops compared to phenotype-based methods. In the case of tomatoes, the demand for MAS (Marker Assisted Selection) technology through the development of molecular markers to select resistance genes for multiple diseases is high, so research is being actively conducted. However, the previously developed TYLCV resistance molecular markers are associated markers, and since the association between the marker and the gene is not maintained through recombination, they are not effective in selecting resistant strains in the breeding field, and thus their utilization is not high.

Korean Patent Publication No. 2013-0043406

An object of the present invention is to provide a marker for identifying tomato yellow leaf curl virus resistance.

An object of the present invention is to provide a composition for determining tomato yellow leaf curl virus resistance.

An object of the present invention is to provide a kit for determining tomato yellow leaf curl virus resistance.

An object of the present invention is to provide a method for determining tomato yellow leaf curl virus resistance

1. Among the nucleotide sequence of the Ty-3 gene of SEQ ID NO: 1, the 12bp indel mutation at the position corresponding to positions 34 to 45, the SNP mutation at the position corresponding to position 286, and the SNP mutation at the position corresponding to position 754 Tomato yellow leaf curl virus resistance discrimination marker comprising a polynucleotide consisting of 12 or more consecutive nucleotides comprising any one or more mutations or a polynucleotide complementary thereto.

2. A composition for determining tomato yellow leaf curl virus resistance, comprising an agent capable of detecting or amplifying the marker of 1 above.

3. The composition of the above 2, wherein the preparation comprises a primer set consisting of the sequences of SEQ ID NOs: 2 and 3 or a primer set consisting of the sequences of SEQ ID NOs: 4 and 5 tomato yellow leaf curl virus resistance discrimination.

4. A kit for determining tomato yellow leaf curl virus resistance comprising the composition of any one of 2 or 3 above.

5. In the tomato to be discriminated, the 12bp indel at the position corresponding to positions 34 to 45 among the nucleotide sequence of the Ty-3 gene of SEQ ID NO: 1, the SNP at the position corresponding to the 286 position, and the SNP at the position corresponding to the 754 position Tomato yellow leaf curl virus resistance determination method comprising the step of confirming any one.

6. In the above 5, the insertion of 12bp at the position corresponding to positions 34 to 45, the base at the position corresponding to position 286 is adenine (A) or the base at the position corresponding to position 754 is adenine (A) ), a method of determining the identified tomato as a yellow leaf curl virus resistant variety.

7. The method of 5 above, wherein the identification is performed by amplifying the marker and treating the amplification product with at least one restriction enzyme selected from the group consisting of Mfel, Bstz17I and RsaI.

The present invention relates to a composition comprising a marker for discriminating a yellow leaf curl virus in tomatoes and a preparation capable of detecting or amplifying the same, enabling rapid and accurate discrimination.

1 is a diagram showing a sequencing strategy for searching for sequence variation in the Ty-3 gene. Gray and black boxes indicate UTR and coding regions, respectively, and non-coding regions are indicated by solid lines.
2 is a diagram showing amino acid sequence variation between Ty-3 resistant strains and susceptible strains. In case of amino acid sequence substitution by SNP or InDel, it is indicated in black. "*" means the mutation used to discover the Ty-3 CAPS marker.
3 is a diagram showing the nucleotide sequence variation between Ty-3 resistant strains and susceptible strains. In case of base sequence substitution by SNP or InDel, it is indicated in yellow.

Hereinafter, the present invention will be described in detail.

The present invention provides a 12bp indel mutation at the position corresponding to positions 34 to 45 in the nucleotide sequence of the Ty-3 gene of SEQ ID NO: 1, SNP mutation at the position corresponding to position 286, and SNP mutation at the position corresponding to position 754 It provides a marker for identifying tomato yellow leaf curl virus resistance comprising a polynucleotide or a polynucleotide complementary thereto consisting of 12 or more consecutive nucleotides including any one or more mutations.

As used herein, the term "tomato yellow leaf curl virus (TYLCV) resistance" refers to having a resistance to TYLCV, which exhibits a healthy phenotype even when infected with TYLCV. The degree of resistance or sensitivity to TYLCV is different depending on the tomato variety. As a specific example, TB38 and TB45 are classified as TYLCV resistant varieties.

The present invention is based on the fact that TYLCV-resistant individuals have InDel mutations and SNP mutations in the Ty-3 gene of non-resistant individuals.

The term "marker" refers to a nucleotide sequence used as a reference point when identifying a genetically unspecifically related locus, and the location on the genetic map of a molecular marker is referred to as a locus or locus.

The marker provided in the present invention may be a restriction amplification polymorphic sequence marker.

The term "cleaved amplified polymorphic sequence (CAPS) marker" is a marker that can interpret a change in one nucleotide sequence, such as a SNP, or a change in a site cleaved by a restriction enzyme caused by InDel. CAPS marker is a method of analyzing polymorphisms that appear after PCR amplification with a locus-specific primer and cut with restriction enzymes.

The term "InDel" refers to a mutation in which some nucleotides are inserted or deleted in the middle of the nucleotide sequence of DNA. The InDel marker searches for regions that are inserted or deleted from the standard genome through a method of comparing and analyzing the reference genome and the genomic information of the variety used in the experiment, and prepares a primer based on the information. do. Therefore, the amplification result can represent two types of band size compared to the standard genome, large (insertion) and small (deletion).

The term "polymorphism" refers to a case in which two or more types of alleles exist at one locus, and among polymorphisms, only a single base differs from one individual to another is referred to as SNP.

The term “allele” refers to several types of one type of gene present at the same locus on homologous chromosomes.

The term "nucleotide" refers to deoxyribonucleotides or ribonucleotides that exist in single-stranded or double-stranded form, and unless specifically stated otherwise, includes analogs of natural nucleotides.

The marker is present at a position corresponding to positions 34 to 45, a position corresponding to position 286, and a position corresponding to position 754 among the nucleotide sequence of the Ty-3 gene of SEQ ID NO: 1, the target tomato Ty- By confirming the presence or absence of a marker at a position corresponding to the position in the 3 gene, it is possible to determine whether tomato yellow leaf curl virus resistance.

The Ty-3 gene of SEQ ID NO: 1 is a tomato Ty-3 gene having resistance to yellow leaf curl virus, and there is an indel mutation of 12bp at positions 34 to 45, specifically, the sequence of SEQ ID NO: 1 is The 12bp is the inserted sequence. If the same 12bp sequence is present at the same position in the Ty-3 gene of the target tomato, the target tomato may have resistance to the tomato yellow leaf curl virus.

In addition, in the Ty-3 gene of SEQ ID NO: 1, there are SNP mutations at positions 286 and 754. By confirming the presence or absence of SNP at the position corresponding to the position in the Ty-3 gene of the target tomato, the presence or absence of virus resistance can be determined. can be checked Specifically, if the 12bp is present at positions 34 to 45 of the Ty-3 gene of the target tomato, it can be known by confirming the sequence at position 286 or 754, otherwise corresponding to position 286 or 754 This can be known by identifying the sequence of the position.

The "corresponding position" refers to the sequence of the corresponding position when the sequence is aligned, and when the 12bp (indel) is present at positions 34 to 45 in the Ty-3 gene of the target tomato, SEQ ID NO: Position 286 and position 754 in the Ty-3 gene of 1 may be the same position in the Ty-3 gene of the target tomato, and if the 12 bp does not exist, the position may vary by the corresponding length.

When the base at the position corresponding to position 286 or 754 of the Ty-3 gene of SEQ ID NO: 1 in the Ty-3 gene of the target tomato is adenine, the target tomato may be a tomato yellow leaf curl virus resistant variety.

The marker is a polynucleotide The marker includes a polynucleotide or a polynucleotide complementary thereto, and the length includes the marker, and if it can be detected or amplified and identified, the length is not limited, for example, 12 bp or more, 50 bp or more, 100 bp or more, 300 bp or more, 500 bp or more, 5000 bp or less, 3000 bp or less, 1000 bp or less, and the like.

In addition, the present invention provides a composition for identifying tomato yellow leaf curl virus resistance comprising an agent capable of detecting or amplifying the marker.

The agent capable of detecting or amplifying the marker for determining resistance to the tomato yellow leaf curl virus may be a primer or a probe, but is not limited thereto.

The term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to several bases to several hundred bases as short as possible to achieve specific binding to mRNA, and is labeled to existence can be checked. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like.

An agent capable of amplifying a marker of the present invention may be a primer set.

The term "primer" refers to a nucleotide sequence having a short free 3' hydroxyl group, capable of forming a base pair with a template and serving as a starting point for template strand copying. It means a short sequence and is mainly used in the form of a primer set that amplifies a specific section. Primers can initiate DNA synthesis in the presence of reagents for polymerization (eg, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in appropriate buffers and temperatures. Primers may incorporate additional features that do not change the basic properties of the primer to serve as the starting point for DNA synthesis. The suitable length of the primer is determined by the characteristics of the primer to be used, and is usually used in a length of 15 to 30 bp, but is not limited thereto. The primer need not be exactly complementary to the base sequence of the template, but must be complementary enough to form a hybrid-complex with the template.

In the present invention, as long as the agent can amplify the marker of the Ty-3 gene, its sequence and length are not limited and may be appropriately designed/selected. For example, the primer sets of SEQ ID NOs: 2 and 3 may be included, and the primer sets of SEQ ID NOs: 4 and 5 may be included.

Any method known to those skilled in the art can be used for the gene amplification. For example, polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, strand displacement amplification (strand displacement amplification) or Qβ replicate enzyme may be used, but is not limited thereto.

The nucleotide sequence used in the present invention is construed to include a sequence exhibiting substantial identity to the sequence described in the sequence listing in consideration of mutations having biologically equivalent activity. As used herein, the term "substantial identity" aligns the sequence of the present invention with any other sequence as much as possible, and analyzes the aligned sequence using an algorithm commonly used in the art. means a sequence that exhibits 60% homology, more specifically 70% homology, even more specifically 80% homology, and most specifically 90% homology.

Therefore, a nucleotide sequence having high homology with the nucleotide sequence represented by SEQ ID NOs: 2 to 5, for example, has a high homology of 70% or more, specifically 80% or more, more specifically 90% or more The base sequence should also be interpreted as being included in the scope of the present invention.

Furthermore, the present invention provides a kit for determining tomato yellow leaf curl virus resistance comprising the composition.

The kit of the present invention includes a composition comprising an agent capable of detecting or amplifying the above-mentioned markers; reagents for the detection or amplification; And it may be a kit comprising a restriction enzyme. Reagents for the amplification may include, but are not limited to, dNTPs, DNA polymerase, and buffers. The dNTPs include dATP, dCTP, dGTP, and dTTP, and the DNA polymerase may use a commercially available polymerase such as Taq DNA polymerase or Tth DNA polymerase as a heat-resistant DNA polymerase. In addition, restriction enzymes such as Mfel, Bstz17I or RsaI may be additionally included in order to measure the presence or absence of a specific SNP mutation and a specific fragment resulting therefrom.

The kit of the present invention may further comprise a user's guide describing optimal conditions for conducting the reaction. The handbook can be a printout explaining how to use the kit, eg, how to prepare a PCR buffer, suggested reaction conditions, and the like. Instructions may include a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide may include information published or provided through an electronic medium such as the Internet.

The present invention is a 12bp indel at a position corresponding to positions 34 to 45 among the nucleotide sequence of the Ty-3 gene of SEQ ID NO: 1 in the tomato to be discriminated, the SNP at the position corresponding to the 286 position, and the position corresponding to the 754 position. It provides a method for determining tomato yellow leaf curl virus resistance comprising the step of identifying any one of the SNPs.

Specifically, when a 12bp indel is inserted at a position corresponding to positions 34 to 45 in the nucleotide sequence of the Ty-3 gene of SEQ ID NO: 1, when the base at the position corresponding to position 286 is adenine (A), 754 If it corresponds to any one of the case where the position base corresponding to the position is adenine (A), it can be determined as having resistance.

The confirmation may be performed by amplifying the marker and treating the amplified product with at least one restriction enzyme selected from the group consisting of Mfel, Bstz17I and RsaI.

By checking whether fragmentation is performed through the restriction enzyme treatment, analysis can be performed more conveniently and at a low cost.

In one embodiment of the present invention, when the composition includes a primer set consisting of the sequences of SEQ ID NOs: 2 and 3, the restriction enzyme may be MfeI or Bstz17I.

In one embodiment of the present invention, when the composition includes a primer set consisting of the sequences of SEQ ID NOs: 4 and 5, the restriction enzyme may be RsaI.

Specifically, the primer set is used to amplify the InDel or SNP mutant portion of Ty-3. At least one restriction enzyme selected from the group consisting of MfeI, Bstz17I and RsaI is mixed with the amplified fragment to determine resistance and sensitivity by observing a specific truncated fragment.

In one embodiment of the present invention, when the BstZ17I restriction enzyme is mixed with the fragment amplified by treating the primer set of SEQ ID NOs: 2 and 3 to the Ty-3 gene of the tomato to be judged (12bp indel detection), a specific cleaved fragment When this is observed, it is a resistant variety, and when it is not observed, it can be determined as a susceptible variety.

Or, if a specific cleaved fragment is not observed by mixing the MfeI restriction enzyme with the fragment amplified by treating the Ty-3 gene with the primer sets of SEQ ID NOs: 2 and 3 (detection of the SNP corresponding to position 286), it is a resistant individual, If observed, it can be determined as a susceptible individual.

Or, if 5 truncated fragments are observed by mixing RsaI restriction enzyme with the fragment amplified by treating the Ty-3 gene with primer sets of SEQ ID NOs: 4 and 5 (detection of the SNP corresponding to position 754), it is a resistant individual, If four cleaved fragments are observed, it can be determined as a susceptible individual.

If necessary, the method of the present invention isolates genomic DNA from the target tomato, and using the primers described above, a base corresponding to positions 34 to 45 of the Ty-3 gene of SEQ ID NO: 1, a base corresponding to position 286 and amplifying a nucleotide sequence including at least one of nucleotide sequence mutations corresponding to position 754.

Isolation of genomic DNA and amplification of the nucleotide sequence may be performed according to experimental methods and conditions known in the art, which are not particularly limited.

Hereinafter, examples will be given to describe the present invention in detail.

experimental material

A total of eight tomato inbred lines (S. lycopersicum) were used for sequencing of Ty-2 and Ty-3 genes. These are Ty-2 resistant strains (TB47 and TB50), Ty-2 sensitive strains (TB48 and TB49), Ty-3 resistant strains (TB38 (Ty-3 gene is SEQ ID NO: 1) and TB45 (Ty-3 gene is SEQ ID NO: 1). 6) and Ty-3 susceptible cultivars (TB61 (Ty-3 gene is SEQ ID NO: 7) and TB70 (Ty-3 gene is SEQ ID NO: 8)). For validation of the markers developed in this study, an additional 30 Resistant and susceptible cultivars (18 F1 commercial cultivars, 9 inbred lines and 3 wild species) were used, of which one F1 cultivar and one inbred were Ty-2 It is known to contain the gene, two wild species LA1932 and LA2779 are the source of Ty-3 resistance.LA1969 is included as the source of Ty-1 resistance.Another 13 species (7 F1 varieties and 8 inbreds) ) is resistant to TYLCV, but the cause of its resistance is unknown.The other 10 F1 varieties are susceptible.In addition, using validated markers, 171 tomatoes to approach Ty-2 and Ty-3 resistance A collection of accessions (77 juvenile breeding lines and 94 germplasm) was genotyped.This breeding line was derived from the Institute of Horticultural and Oriental Science (NIHHS), RDA, Korea. were obtained from RDA's National Agrobiodiversity Center (NAC), US Department of Agriculture's Germplasm Resources Information Network (GRIN), CM Rick Tomato Genetics Resource Center (TGRC), and Sejong University.

Experimental method

1. Gene Sequencing of Ty-3

Genomic DNA was extracted from fresh young leaves of 4-week-old seedlings using a modified cetyl trimethyl ammonium bromide (CTAB) method. The leaf tissue was placed in a tube having two 4 mm diameter stainless beads and pulverized by stirring for 3 minutes using TissueLyser (QIAGEN, CA, USA, USA). After grinding, all extraction steps are the same as described above. For complementary DNA (cDNA) synthesis, total RNA was extracted from fresh young leaves of 4-week-old seedlings using the Trizol(TM) method. The extracted RNA was used to synthesize cDNA using the NEXscriptTM cDNA synthesis kit (Geneslab, Seongnam, Korea).

The full-length genomic DNA sequence of the Ty-3 gene was searched from Sol Genomic Network (SGN, https://solgenomics.net) using the tomato reference genome assembly version SL3.0. For the Ty-3 gene, 3 primer sets were designed to amplify the 5' UTR and a portion of the first 6 exons using a 4,242 bp genomic DNA sequence (SGN gene ID: Solyc06g051190.2.1). Specifically, these primers amplified the 5' UTR/first exon (669 bp), the second/third exon (514 bp) and the fourth/fifth exon (813 bp) (FIG. 1).

PCR amplification using 50-100ng of genomic DNA or cDNA, 0.2mM dNTP, 0.1μM each of F (forward) and R (reverse) primers, 1X PCR buffer, and 0.5U of Taq polymerase contained in a total volume of 50 μl was performed. The PCR amplification process involves initial denaturation at 94°C for 3 minutes, then at 94°C for 3 seconds, at annealing temperature (50°C to 60°C depending on the melting point of the primer) for 30 seconds, and at 72°C for 45 seconds. Repeat the cycle 40 times during the period, including extension in one cycle for 7 minutes at 72 °C.

PCR amplicon was purified using the NEXprepTM Purification Mini Kit (Geneslab, Seongnam, Korea) according to the manufacturer's instructions. The purified amplification product was used for Sanger sequencing (Cosmogenetech, Seoul, Korea). The DNA sequences were trimmed and aligned using Staden Package software and the Clustal Omega tool (http://www.ebi.ac.uk/Tools/msa/clustalo). Sequence variation between TYLCV resistant and susceptible strains was confirmed by visual inspection of sequence alignments. Nucleic acid sequences were translated into amino acid sequences to identify non-synonymous mutations using the ExPASy-translate tool.

2. Marker discovery and gene analysis in the cytoplasmic population

Non-synonymous SNPs and small insertion/delections (InDels) identified from multiple alignments of genomic DNA, cDNA, and amino acid sequences were used to develop markers of cleaved amplified polymorphic sequences (CAPS). To identify the CAPS, both the CAPS Designer tool implemented in SGN (https://solgenomics.net/tools/caps_designer/caps_input.pl) and SnapGene Viewer software (https://www.snapgene.com) were used. Large InDel was used as a direct marker to look for polymorphisms in agarose gels. Genotyping with the CAPS marker was performed by treating 1 g of the PCR amplification product with 1.2 units of restriction enzymes (New England Biolabs, Ipswich, MA, USA) and incubating overnight at an appropriate temperature. Resistance and susceptibility alleles were determined by gel electrophoresis of amplicons treated with 1x RedSafe™ nucleic acid staining solution (iNtRON Biotechnology, Seongnam, Korea) and 2% agarose gel. Alleles of the InDel marker were separated on a 3% agarose gel after PCR amplification.

Experiment result

1. Sequence Variation Associated with Ty-3 Resistance

For the Ty-3 gene (SEQ ID NO: 1), a 1,996 bp sequence was generated including a 5' UTR, 5 exons, and a portion of an intron. Multiple sequence alignments detected a total of 30 SNPs between resistant and susceptible cultivars. Of these, 12 SNPs were found in the coding sequence, and 10 SNPs were non-synonymous. In addition, 12 bp InDel in the first exon and 4 InDels in the non-coding sequence (3 in the 5' UTR and 1 in the intron sequence) were found (Table 1).

location Ty-3 SNP InDel Upstream region na na 5' UTR 8 3 Exon 12 (9) One Intron 10 One 3' UTR na na

^One _{The number of non-synonymous SNPs is indicated in parentheses.}

2. Molecular markers for Ty-3 selection

For the candidate Ty-3 used in the experiment, the non-synonymous SNP and InDel in the coding sequence were considered to develop the CAPS marker. Of the 10 non-synonymous SNPs, 5 SNPs were converted to CAPS. Two CAPS markers (Ty3-SNP9 and Ty3-SNP17) were selected based on the cost-effective restriction enzymes Mfel and Rsal, respectively. PCR performed with the Ty3-SNP9 primer set produced 678 bp (resistance) and 669 bp (susceptibility) amplification products. This difference in size of the amplification product is due to the presence of InDel in the 5' UTR amplified by the primer set and the first exon sequence. After treatment with MfeI, the sensitive amplification product was transferred in two fragments (555 bp and 114 bp), whereas the fragment of the resistant allele was not cleaved. In contrast, the Ty3-SNP17 marker was identified as a truncated fragment of the 813 bp PCR amplification product in both the resistant and susceptible alleles. In addition, 12 bp InDel was used to develop the CAPS marker (ty3-InDel4). It produced two truncated fragments (325 bp and 353 bp) for the resistance allele and an uncleaved fragment for the susceptible allele after BstZ17I treatment. One primer set was used for Ty3-SNP9 and Ty3-InDel4 markers, and a 9 bp different PCR amplification product was observed between the resistant and susceptible alleles in the Ty3-InDel4 marker.

The amino acid sequence analysis results encoded by the Ty-3 gene between resistant and susceptible varieties are shown in FIG. 2, and the prepared primers and excavation markers are shown in Table 2.

gene Marker name Marker type Primer sequence (5'-3') restriction enzyme ¹ Fragment size (bp) resistance sensibility Ty-3 Ty3-InDel4 CAPS F: CCTATCCTCAGTGTTTCGGTCA BstZ17 I 353/325 (678) ¹ 669 (669) R: GGCGAAAGACTTTGTGTACACA Ty3-SNP9 CAPS F: CCTATCCTCAGTGTTTCGGTCA Mfe I 678 (678) 555/114 (669) R: GGCGAAAGACTTTGTGTACACA Ty3-SNP17 CAPS F: TCTCAGGTGATGCTGAGCAC Rsa I 497/148/65/52/51 (813) 562/148/52/51 (813) R: AGAGAACGAAAACGAAATTTCAAACA

^One _{The fragment size after restriction enzyme digestion is indicated first, and the size of the PCR amplification product before digestion is indicated in parentheses. The different amplification size for the two CAPS markers between the resistance and susceptibility alleles is due to the presence of a 12bp indel on the first exon as well as other indels on the 5'UTR.}

For validation, these new markers were used for genotyping of 30 tomato cultivars with a known phenotype for TYLCV. The results are shown in Table 3. Two of these resistant cultivars (one F1 cultivar and one inbred) are known to contain the Ty-2 gene. F1 and inbreeding strains were identified as heterozygous and homozygous for the resistance allele for the Ty2-UpInDel marker, respectively. Since it can be seen that the Ty-2 gene is completely dominant for TYLCV resistance, it was expected to find a hetetozygous form as a Ty-2 marker in resistant F1 cultivars. The F1 strain with the Ty-2 gene was identified as a homozygous form of the susceptibility allele for all three Ty-3 markers. Similarly, inbreds were identified as homozygous for the susceptible allele of the Ty-3 marker. Three wild species known to contain either Ty-1 (LA1969) or Ty-3 (LA1932 and LA2779) were identified as homozygous forms of the sensitive allele for the Ty2-UpInDel marker. However, it was identified as homozygous for the resistance alleles of the three Ty-3 markers.

Among other 15 TYLCV resistant strains, a homozygous form of the sensitivity allele for the Ty2-UpInDel marker was identified in 5 F1 strains and 2 inbred strains. However, these six cultivars were identified as either homozygous or heterozygous forms of the resistance allele for the Ty-3 marker. F1 cultivar 'Songari' with TYLCV resistance exhibited a homozygous form for both Ty-2 and Ty-3 markers, and was speculated to possess a different Ty gene. In addition, all ten susceptible F1 strains were determined to be homozygous for the susceptibility allele of the Ty-2 marker. Six cultivars (two F1 cultivars and four inbreds) with TYLCV resistance to all three Ty-3 markers were identified as homozygous for the susceptibility allele and genotype susceptibility for the Ty-3 marker. This suggests that TYLCV resistance in cultivars is due to Ty-2 or other Ty genes. For example, the F1 cultivar 'Tyunique' and the inbreeding cultivar 'Hero120' showed a homozygous form of the resistance allele for the Ty-2 marker, while the other four cultivars were identified as heterozygous. In addition, all ten susceptible strains showed a homozygous form of the susceptibility allele for the Ty-3 marker.

serial number kind Generation
(class) phenotype resistance gene marker genotype ¹ Ty2-UpInDel Ty3-InDel4 Ty3-SNP9 Ty3-SNP17 One bogopanorang F ₁ S unknown S S S S 2 Kkotomato F ₁ S unknown S S S S 3 Kkomaheuksu F ₁ S unknown S S S S 4 Cadilak F ₁ S unknown S S S S 5 Miniheuksu F ₁ S unknown S S S S 6 Tangtang60 F ₁ S unknown S S S S 7 Beryking F ₁ S unknown S S S S 8 Shinlovely256 F ₁ S unknown S S S S 9 Dongyu250 F ₁ S unknown S S S S 10 RAFITO F1 F1 S unknown S S S S 11 Hulk F ₁ R Ty-2 H S S S 12 Tyshinheuksu F ₁ R unknown S H H H 13 Songari F ₁ R unknown S S S S 14 Aroma300 F ₁ R unknown S H H H 15 Tyunique F ₁ R unknown R S S S 16 Shinsugarred F ₁ R unknown H H H H 17 Shinsugaryellow F ₁ R unknown S H H H 18 TOP 1199 F1 R unknown S H R H 19 Hero80 Inbred R unknown H S S S 20 Hero90 Inbred R unknown H S S S 21 Hero100 Inbred R unknown H S S H 22 Hero110 Inbred R unknown H S S H 23 Hero120 Inbred R Ty-2 R S S S 24 Hera110 Inbred R unknown H S S H 25 Thomas Inbred R unknown S H H H 26 Tars Inbred R unknown H S S S 27 TC 32347 Inbred R unknown S R R R 28 LA1932 wild R Ty-3 S R R R 29 LA1969 wild R Ty-1 S R R R 30 LA2779 wild R Ty-3 S R R R

^One _{R = homozygous form of the resistance allele, H = heterozygous form of the resistance allele, and S = homozygous form of the susceptibility allele.}

3. Assessment of resistance of Ty-2 and Ty-3 in the cytoplasmic population

Ty-2 and Ty-3 markers were used to genetically analyze a population of 171 tomato accessions consisting of 77 juvenile breeding lines and 94 cytoplasms. The results are shown in Tables 4 and 5.

For the Ty-2 marker, 8 (4.67%) and 6 (3.50%) accesions were identified as having homozygous resistance alleles and heterozygous forms, respectively (Table 4). In contrast, more than 91% were identified as homozygous susceptibility alleles.

Three Ty-3 markers were identified, with 22-32 accessions carrying at least one homozygous resistance allele. Thirteen of these accessions showed homozygous resistance alleles for the Ty-3 marker. The number of accessions with homozygous forms of the susceptibility alleles for all Ty-3 markers ranged from 132 (77.19%) to 149 (87.13%). Moreover, it was found that seven accessions of the breeding line had homozygous resistance alleles for the Ty-2 marker as well as at least one of the three Ty-3 markers. For all four markers, a homozygous form of the resistance allele was identified in the breeding line '16TB36'. The other two breeding lines '16TB14' and '16TB74' were identified as homozygous resistance alleles for the Ty-2 marker and for the two Ty-3 markers. Breeding lines selected using the Ty-2 and Ty-3 markers mean that they can accelerate development of superior varieties with a broad spectrum of TYLCV resistance.

marker genotype number of varieties Ty2-UpInDel Ty3-InDel4 Ty3-SNP9 Ty3-SNP17 resistant homozygote 8 (4.67%) 30 (17.54%) 22 (12.86%) 32 (18.71%) Heterozygote 6 (3.5%) 1 (0.58%) 0 (0%) 7 (4.09%) susceptibility homozygote 157 (91.81%) 140 (81.87%) 149 (87.13%) 132 (77.19%)

kind marker genotype Ty2-UpInDel Ty3-InDel4 Ty3-SNP9 Ty3-SNP17 16TB3 R R S S 16TB14 R R R S 16TB19 R S S R 16TB36 R R R R 16TB65 R S S R 16TB72 R R S S 16TB74 R R S R

^One _{R = homozygous form of the resistance allele, H = heterozygous form of the resistance allele, and S = homozygous form of the susceptibility allele.}

<110> SEJONG UNIVERSITY INDUSTRY ACADEMY COOPERATION FOUNDATION <120> Marker for discrimination of resistance to tomato yellow leaf curl virus and discrimination method using the same marker <130> 19P09046-Right <150> KR 10-2018-0141998 <151> 2018-11-16 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 913 <212> DNA <213> Lycopersicon esculentum <400> 1 atgggtgatc cgttgattga agaaattgat gttccttctt gtatactgga tgcaccttta 60 ccatattctg tagagacgat gcttgataga atctgcaagg agcaggggca aaaaccaccg 120 tgtactggca ttagaaggag gctgagctct attggtgaaa aagggtcatt agaaatgctc 180 aaaataatat cacgtcgtcc tatcaagaag agtctctctg cttttcttgt ttacatgatt 240 gatcgctacc cggattgtct ctcctcttcc tctagcccct tcaatagtct actcaaacgc 300 tcttcttccc ctcttctatt tccatctcca gagggtaaac gtttacttgg tgaaagttct 360 tctaaatcaa agcttgagat gggcttattg gcctgtgcaa gccctcagaa agttgctcgc 420 cagttatcat tttgcgagga gcctgaatct aactgtagaa gaacctcccc ttatgtcagc 480 caacagttga tgatcctcaa tgaacttgaa tttagaaaat tgtttttggt actgagctac 540 attggatgca acaagttgga agatgttata tcccctcaaa ttgctgatga tattgtaaga 600 aagaaagatc tttccatgac tgattttgaa tcagaaattt ggaatgcttt tggaaaagca 660 tgttatgctg tgtcagatag atcaaagtac ttagactgga attgcagaaa gacacatatc 720 tactattgcc acattaagca gaacggatgc tgtaccttca agggtccata cttgaacaca 780 gcaaggactc acttacagag agccctggga gatgacaatg tactgattgt caaatttgtt 840 gaagatacaa gttgtgccaa tataattctc gaggaaggca ttcttgttgg cttgagacgt 900 taccgtttct ttg 913 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Ty3 primer1_F <400> 2 cctatcctca gtgtttcggt ca 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Ty3 primer1_R <400> 3 ggcgaaagac tttgtgtaca ca 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ty3 primer2_F <400> 4 tctcaggtga tgctgagcac 20 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Ty3 primer2_R <400> 5 agagaacgaa aacgaaattt caaaca 26 <210> 6 <211> 913 <212> DNA <213> Lycopersicon esculentum <400> 6 atgggtgatc cgttgattga agaaattgat gttccttctt gtatactgga tgcaccttta 60 ccatattctg tagagacgat gcttgataga atctgcaagg agcaggggca aaaaccaccg 120 tgtactggca ttagaaggag gctgagctct attggtgaaa aagggtcatt agaaatgctc 180 aaaataatat cacgtcgtcc tatcaagaag agtctctctg cttttcttgt ttacatgatt 240 gatcgctacc cggattgtct ctcctcttcc tctagcccct tcaatagtct actcaaacgc 300 tcttcttccc ctcttctatt tccatctcca gagggtaaac gtttacttgg tgaaagttct 360 tctaaatcaa agcttgagat gggcttattg gcctgtgcaa gccctcagaa agttgctcgc 420 cagttatcat tttgcgagga gcctgaatct aactgtagaa gaacctcccc ttatgtcagc 480 caacagttga tgatcctcaa tgaacttgaa tttagaaaat tgtttttggt actgagctac 540 attggatgca acaagttgga agatgttata tcccctcaaa ttgctgatga tattgtaaga 600 aagaaagatc tttccatgac tgattttgaa tcagaaattt ggaatgcttt tggaaaagca 660 tgttatgctg tgtcagatag atcaaagtac ttagactgga attgcagaaa gacacatatc 720 tactattgcc acattaagca gaacggatgc tgtaccttca agggtccata cttgaacaca 780 gcaaggactc acttacagag agccctggga gatgacaatg tactgattgt caaatttgtt 840 gaagatacaa gttgtgccaa tataattctc gaggaaggca ttcttgttgg cttgagacgt 900 taccgtttct ttg 913 <210> 7 <211> 901 <212> DNA <213> Lycopersicon esculentum <400> 7 atgggtgatc cgttgattga agaaattgat gttctggatg cacctttacc atattctgta 60 gagacgatgc ttgatagaat ctgcaaggag caggggcaaa aaccaccgtg tactggcatt 120 agaaggaggc tgagctctat tggtgaaaaa gggtcattag aaatgctcaa aataatatca 180 cgtcgtccta tcaagaagag tctctctgct tttcttgttt acatgattga tcgctacccg 240 gattgtctct cctcttcctc tagccccttc aattgtctac tcaaacgctc ttcttcccct 300 cgtctctttc catctccaga gggtaaacgt ttacaaggtg aaagttcttc taaatcaaag 360 cttgagatgg gcttattggc ctgtgcaagc cctcagaaag ttgctcgcca gttatcattt 420 tgcgaggagc ctgaatctaa ctgtagaaga acctcccctt atgtcagcca acagttgatg 480 atcctcaatg aacttgaatt tagaaaattg tttctggtac tgagctacat tggatgcaac 540 aagttggaag atgttatatc ccctcaaatt gctgatgata ttgtaagaaa gaaaaatctt 600 tccatgactg attttgaatc agaaatttgg aatgcttttg gaaaagcatg ttatgctgtg 660 tcagatagat caaagtactt agactggaat tgcagaaaga cacatatcta ctattgccac 720 attaagcaga acggatactg ttccttcaag ggtccatact tgaacacatt aaggactcac 780 ttacagag ccctgggaga tgacaatgta ctgattgtaa aatttgttga agatacaagt 840 tgtgccaata taattctcga ggaaggcatt cttgttggct tgagacgtta ccgtttcttt 900 g 901 <210> 8 <211> 901 <212> DNA <213> Lycopersicon esculentum <400> 8 atgggtgatc cgttgattga agaaattgat gttctggatg cacctttacc atattctgta 60 gagacgatgc ttgatagaat ctgcaaggag caggggcaaa aaccaccgtg tactggcatt 120 agaaggaggc tgagctctat tggtgaaaaa gggtcattag aaatgctcaa aataatatca 180 cgtcgtccta tcaagaagag tctctctgct tttcttgttt acatgattga tcgctacccg 240 gattgtctct cctcttcctc tagccccttc aattgtctac tcaaacgctc ttcttcccct 300 cgtctctttc catctccaga gggtaaacgt ttacaaggtg aaagttcttc taaatcaaag 360 cttgagatgg gcttattggc ctgtgcaagc cctcagaaag ttgctcgcca gttatcattt 420 tgcgaggagc ctgaatctaa ctgtagaaga acctcccctt atgtcagcca acagttgatg 480 atcctcaatg aacttgaatt tagaaaattg tttctggtac tgagctacat tggatgcaac 540 aagttggaag atgttatatc ccctcaaatt gctgatgata ttgtaagaaa gaaaaatctt 600 tccatgactg attttgaatc agaaatttgg aatgcttttg gaaaagcatg ttatgctgtg 660 tcagatagat caaagtactt agactggaat tgcagaaaga cacatatcta ctattgccac 720 attaagcaga acggatactg ttccttcaag ggtccatact tgaacacatt aaggactcac 780 ttacagag ccctgggaga tgacaatgta ctgattgtaa aatttgttga agatacaagt 840 tgtgccaata taattctcga ggaaggcatt cttgttggct tgagacgtta ccgtttcttt 900 g 901

Claims (7)

Any one of a 12bp indel mutation at a position corresponding to positions 34 to 45 in the nucleotide sequence of the Ty-3 gene of SEQ ID NO: 1, a SNP mutation at a position corresponding to position 286, and a SNP mutation at a position corresponding to position 754 A marker composition for identifying tomato yellow leaf curl virus resistance comprising a polynucleotide consisting of 12 or more consecutive nucleotides comprising the above mutations or a polynucleotide complementary thereto.
A composition for determining resistance to tomato yellow leaf curl virus, comprising an agent capable of detecting or amplifying the marker of claim 1.
The method according to claim 2, wherein the agent comprises a primer set consisting of a sequence of SEQ ID NOs: 2 and 3 or a primer set consisting of a sequence of SEQ ID NOs: 4 and 5 Tomato yellow leaf curl virus resistance discrimination composition.
A kit for determining tomato yellow leaf curl virus resistance comprising the composition of any one of claims 2 or 3.
Among the base sequence of the Ty-3 gene of SEQ ID NO: 1 in the tomato to be discriminated, any of the 12bp indel at the position corresponding to positions 34 to 45, the SNP at the position corresponding to the position 286, and the SNP at the position corresponding to the position 754 Tomato yellow leaf curl virus resistance determination method comprising the step of identifying one marker.
The method according to claim 5, wherein the insertion of 12bp at the position corresponding to positions 34 to 45, the base at the position corresponding to position 286 is adenine (A) or the base at the position corresponding to position 754 is adenine (A) A method of discriminating the identified tomato as a yellow leaf curl virus resistant variety.
The method according to claim 5, wherein the confirmation amplifies the marker, and when the marker is a 12bp indel at positions 34 to 45, Bstz17I restriction enzyme in the amplification product, and SNP at the position corresponding to positions 286. In the case of an MfeI restriction enzyme or a SNP at a position corresponding to position 754 in the product, the amplification product is treated with an RsaI restriction enzyme.

Images