KR102505574B1 - Molecular marker for discriminating genotype of ESP2 gene regulating amylose content in rice and uses thereof - Google Patents

Abstract

The present invention is a primer set composition for genotype determination of endosperm storage protein 2 ( ESP2 ) gene of rice comprising the oligonucleotide primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 and the oligonucleotide primer sets of SEQ ID NO: 3 and SEQ ID NO: 4, and the same It's about use.

Description

Molecular marker for discriminating genotype of ESP2 gene regulating amylose content in rice and uses thereof}

The present invention relates to a molecular marker for determining the genotype of the endosperm storage protein 2 ( ESP2 ) gene, which regulates the amylose content of rice, and its use.

The study of starch-related traits, such as amylose content and resistant starch content, is of great interest because of the potential health benefits of cereals. Amylose content in rice is controlled by genetic and cultural/environmental factors. The main gene that controls amylose content is the Wx (waxy) gene located on the short arm of chromosome 6 in rice. Five polyallelic genes, including Wxa , Wxb , and wx , have been reported. It has been reported to induce modification of GBSS1 (Granule-bound starch synthase 1) protein (Zhou et al ., J. Integr. Agric. 2015;14(6):1153-62).

On the other hand, Korea Patent Publication No. 2015-0020451 discloses a gene that is not related to the amylose content of rice plants and a single nucleotide polymorphism containing a mutation of the gene, 'variation about a method for quickly, accurately and simply determining Polynucleotide and rice genetic resource identification method using the same' are disclosed, and Korean Patent Publication No. 2015-0005831 discloses 'rice genetic resource identification method and amylose-containing rice primer' using the mutant OsBEIIb gene. There is no description of the 'molecular marker for genotyping of the ESP2 gene that regulates the amylose content of rice and its use' of the present invention.

The present invention was derived from the above needs, and the present inventors performed amylose at chromosome 11 through genetic analysis using Dodam rice and Hwayoung rice mating groups, which are non-waxy japonica varieties with large differences in amylose content and resistant starch content. A quantitative trait loci (QTL) controlling the content was detected and named qAC11 . In addition, as a result of the epigenetic sequence analysis of Dodam rice and Hwayoung rice, ESP2 was designated as a candidate gene involved in the regulation of amylose content in the region of chromosome 11. A number of base mutations were observed. In order to confirm the mutation, two primer sets were prepared and as a result of verification, it was confirmed that the two markers could discriminate the ESP2 genotype of Hwayeongbyeo and Dodamrice, thereby completing the present invention.

In order to solve the above problems, the present invention is a genotype of the endosperm storage protein 2 ( ESP2 ) gene of rice comprising the oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2 and the oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4 A primer set composition for discrimination is provided.

In addition, the present invention is the primer set composition; And it provides a kit for determining the genotyping of the ESP2 gene in rice, including a reagent for performing an amplification reaction.

In addition, the present invention isolates the total DNA from the sample of rice resources; Amplifying a target sequence by performing polymerase chain reaction (PCR) using the isolated total DNA as a template and using the primer set composition according to the present invention; and detecting the product of the amplification step.

Until now, there has been no study report on the gene controlling the amylose content in japonica rice except for the Wx gene. Therefore, the ESP2 gene identified in the present invention can be effectively used to control the amylose content of japonica rice, and the molecular marker that can discriminate the genotype of the ESP2 gene is used in breeding research to select promising lines with the desired genotype. may help you do that. In addition, since the amylose content can be predicted using rice seedlings using molecular markers, effort and time can be saved compared to using seeds.

Figure 1 is the result of examining the amylose content (AC) in the progeny of the Dodam rice/Hwayoung rice mating combination.
Figure 2 shows the chromosomes where three QTLs involved in amylose content control are located in the genetic map created using the progeny 91 lines of the Dodam rice / Hwayeong rice hybridization combination.
Figure 3 is a diagram showing the structure of the ESP2 gene and nucleotide variation among Ilpum, Hwaseong, Hwayoung, and Dodamssal.
4 shows the result of determining the genotype of the ESP2 gene in the F ₂ generation of Dodam rice/Hwayeong rice hybrids using the oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2.
5 shows the results of determining the ESP2 gene genotype of 16 rice cultivars using oligonucleotide primer sets of SEQ ID NO: 3 and SEQ ID NO: 4.

In order to achieve the object of the present invention, the present invention is a rice ESP2 (endosperm storage protein 2) gene comprising the oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2 and the oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4 Provided is a primer set composition for determining the genotype of.

In the primer set composition according to the present invention, the oligonucleotide primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 are CAPS (Cleaved amplified polymorphic sequences) markers based on SNP (single nucleotide polymorphism) located in the 5th exon of the rice ESP2 gene As a result, if the product amplified by the primer set is cleaved by restriction enzyme Pvu II treatment to generate bands of 108 bp and 46 bp in size, the sample has the Hwayoung rice ESP2 genotype, and is not cleaved by restriction enzyme treatment 154 If a single band of bp size is confirmed, the sample can be determined to have the ESP2 genotype of Dodam rice (a variety for processing high amylose with an amylose content of 42.8%).

In the present invention, the term "CAPS" is also referred to as a restriction amplification polymorphic sequence, and refers to a polymorphic fragment generated by restriction enzyme treatment of a polymorphic polymerase chain reaction (PCR) product between individuals. Detection is performed for the purpose of a gene that is known to have differences in nucleotide sequence between individuals in advance, and only the gene concerned is selected and amplified from the genome of the species by the PCR method. In most markers, there is no difference between the length of the amplified gene and the variety, but the sequence inside the gene is different, so a restriction enzyme that recognizes the difference in sequence is selected and processed. It is possible to distinguish between an individual having DNA cut with restriction enzymes and an individual having uncut DNA, and the difference in length is easily detected by electrophoresis.

In addition, in the primer set composition according to the present invention, the oligonucleotide primer sets of SEQ ID NO: 3 and SEQ ID NO: 4 are molecular markers based on InDel (Insertion/Deletion) polymorphism located in the first intron of the ESP2 gene. If the product amplified by the set is confirmed to have a size of 429 bp, the sample can be determined to have the Hwayoung rice ESP2 genotype.

In the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and can serve as a starting point for synthesis of a primer extension product. The length and sequence of the primers should allow for the synthesis of extension products to begin. The specific length and sequence of the primer will depend on the complexity of the DNA or RNA target required, as well as the conditions of use of the primer, such as temperature and ionic strength.

The primers may include oligonucleotides composed of segments of at least 16, at least 17, at least 18, at least 19, at least 20 consecutive nucleotides in the sequences of SEQ ID NOs: 1 to 4, depending on the sequence length of each primer. there is. For example, the primers (22 oligonucleotides) of SEQ ID NO: 1 contain at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 sequences in the sequence of SEQ ID NO: 1 It may include oligonucleotides composed of fragments of nucleotides. In addition, the primers may also include added, deleted or substituted sequences of the nucleotide sequences of SEQ ID NOs: 1 to 4.

In this specification, oligonucleotides used as primers may also include nucleotide analogs, such as phosphorothioates, alkylphosphorothioates, or peptide nucleic acids, or Intercalating agents may be included. In addition, the primers may incorporate additional features that do not alter the basic properties of the primers that serve as the starting point of DNA synthesis. The suitable length of the primer is determined by the characteristics of the primer to be used, but usually a length of 15 to 30 bp is used. The primer does not have to be exactly complementary to the sequence of the template, but must be complementary enough to form a hybrid-complex with the template.

The present invention also relates to the primer set composition of the present invention; And it provides a kit for genotyping the endosperm storage protein 2 ( ESP2 ) gene of rice, including reagents for performing an amplification reaction.

The kit of the present invention may further include a restriction enzyme when the primer set consists of the oligonucleotide primers of SEQ ID NO: 1 and SEQ ID NO: 2. The restriction enzyme may preferably be Pvu II.

In the present invention, the term "restriction enzyme" means a special enzyme as an endonuclease that identifies a specific nucleotide sequence of DNA and cuts a double chain.

In the kit of the present invention, reagents for performing the amplification reaction may include, but are not limited to, DNA polymerase, dNTPs, and buffers. The dNTPs include dATP, dCTP, dGTP, and dTTP, and as the DNA polymerase, a commercially available polymerase such as Taq DNA polymerase or Tth DNA polymerase may be used as a thermostable DNA polymerase. In addition, the kit of the present invention may further include a user guide describing optimal reaction performance conditions. The guide is a printout explaining how to use the kit, eg, how to prepare the PCR buffer, and the reaction conditions to be presented. The guide includes a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

The present invention also includes the steps of isolating total DNA from samples of rice resources; Amplifying a target sequence by performing polymerase chain reaction (PCR) using the isolated total DNA as a template and using the primer set composition according to the present invention; And it provides a method for determining the genotype of the endosperm storage protein 2 ( ESP2 ) gene of rice, comprising the step of detecting the product of the amplification step.

The method of the present invention comprises the step of isolating genomic DNA from a rice sample. A method known in the art may be used as a method for isolating genomic DNA from the sample, and for example, a CTAB method or a Wizard prep kit (Promega, USA) may be used. A target sequence may be amplified by performing an amplification reaction using the isolated genomic DNA as a template and a primer set according to an embodiment of the present invention as primers. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In addition, identification, that is, detection of the amplification product according to the present invention may be performed through gel electrophoresis, capillary electrophoresis, DNA chip, radioactivity measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting the amplification product, gel electrophoresis may be performed, and agarose gel electrophoresis or acrylamide gel electrophoresis may be used for gel electrophoresis depending on the size of the amplification product. In addition, capillary electrophoresis can be performed. Capillary electrophoresis can use, for example, an ABi Sequencer. In addition, in the fluorescence measurement method, when PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of a primer or probe, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence is measured using a fluorescence meter. can be measured by In addition, the radioactivity measurement method is performed by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification product, and then using a radioactivity measurement instrument, for example, a Geiger counter or liquid scintillation Radioactivity can be measured using a liquid scintillation counter.

In the identification method according to an embodiment of the present invention, the step of detecting the product of the amplification step may be a step of identifying the cleavage product after digesting the product of the amplification step with a restriction enzyme. When the primer set used in the PCR consists of oligonucleotide primers of SEQ ID NO: 1 and SEQ ID NO: 2, a step of digesting the product of the amplification step with a restriction enzyme may be further included, and the cleavage product is subjected to gel electrophoresis to cleavage Products of the amplification step can be detected by separating the products by size. In a specific embodiment of the present invention, PCR was performed based on the selected primer set, purified with a PCR purification kit, and treated at an active temperature using Pvu II restriction enzyme.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Plant material

92 RIL (recombinant inbred line) groups derived from a cross combination of Dodam rice and Hwayoung rice were cultivated in 2017 and 2018 in Chungnam National University experimental farm. Total genomic DNA was extracted from fresh leaves using the CTAB (cetyltrimethylammonium bromide) method. Specifically, leaves were randomly collected using 10 plants per strain and then collected and considered as one sample for the strain. DNA samples of 50 ng/μl per line were used for genotyping-by-sequencing (GBS) analysis. Sequence comparison analysis was performed using the parent strain and the Nipponbare reference sequence.

2. QTL search

QTL IciMapping version 4.1 (Meng et al. 2015, Crop J. 3(3) 269-83) was used to detect and identify QTL by combining the use of the inclusive composite interval mapping (ICIM) method and single marker analysis (SMA). ICIM analysis was performed using forward-backward stepwise regression model 6 with a window size of 20 cM. 1,000 permutations were calculated to determine the LOD threshold significance level (P<0.05). QTL locations were assigned to the maximum LOD score (LOD = 2.8) in the target region. Various molecular markers have been used for QTL mapping.

3. Whole-genome sequencing

Full-length genome reanalysis was conducted by requesting Macrogen Co., Ltd. A shotgun DNA library was prepared from the high molecular weight genomic DNA of the parental line using the TruSeq Nano DNA kit. The library was used for cluster generation. In the present invention, quality inspection of raw reads was performed using FastQC V0.11.8 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc). Trimmomatic v0.38 (http://www.usadellab.org/cms/?page=trimmomatic) was used to remove adapter sequences and low-quality reads to reduce bias in the analysis. Analysis was performed on all paired-end samples. After filtering the data, normal coverage reads were mapped to the reference genome using Burrows-Wheeler Aligner v0.7.17 (http://bio-bwa.sourceforge.net/). Nipponbare (Os-Nipponbare-Reference-IRSP-1.0) was used as a reference genome to map reads from sequencing. The mass sequence data generated was used to find genetic variants. The reference genome in this analysis was based on the NCBI sequence (GCA_001433935.1). After mapping, duplicates were removed with Picard (v2.17.2, http://broadinstitute.github.io/picard/) and variants were identified with SAMTools (http://samtools.sourceforge.net/). Information from each variant was assembled and grouped by chromosome or scaffold. SnpEff v4.3t (http://snpeff.sourceforge.net/) was used to determine annotation information such as amino acid changes due to mutation.

4. Determination of amylose content

For amylose content measurement, 30 seeds were collected from 5 individuals per line and considered as a single sample of the individual. Each seed was finely powdered after performing dehulling and polishing. Amylose content was measured using Megazyme assay kit (Megazyme Ltd., Ireland).

5. Statistical analysis

Results were analyzed based on one-way analysis of variance (ANOVA) and Tukey's test at a significance level of 0.05 using MINITAB 16.2.4 software. Tukey's test was used for multiple comparisons, whereas Pearson's correlation coefficient was performed for correlation analysis between traits.

Example 1. Analysis of QTLs associated with amylose content control

The amylose content was investigated over 2017 and 2018 using Dodam rice and Hwayoung rice and 91 progeny of their mating combinations. As a result, it was confirmed that the amylose content of Dodam rice was significantly higher than that of Hwayoung rice (FIG. 1A), and it was found that the descendants of these mating combinations showed, on average, higher amylose content than Hwayoung rice (FIG. 1B). .

Genetic maps were prepared using the progeny lines of the Dodam rice and Hwayeong rice mating combinations, and QTL analysis associated with amylose content control was performed. As a result, QTL were detected on chromosomes 2, 6, and 11 (FIG. 2). Among them, it was confirmed that the ESP2 gene is located in the QTL region of chromosome 11.

Example 2. ESP2 Development of molecular markers based on genetic mutations

ESP2 gene sequences were compared between parents, Hwayeongbyeo and Dodamrice, and representative japonica rice, Ilpumbyeo and Hwaseongbyeo. As a result, various nucleotide mutations leading to amino acid mutations were observed (FIG. 3), and were classified into three groups based on nucleotide sequence mutations (Table 1). Dodam rice was classified as HAP3, Hwayoung rice as HAP1, and Hwaseong rice as HAP2, just like Ilpoom rice. The physical positions in Table 1 represent the positions of each base on chromosome 11 in the Nipponbare reference sequence (Os-Nipponbare-Reference-IRGSP-1.0).

Among the mutations, the present inventors found a molecular marker based on the SNP (G/A, Hwayeongbyeo/Dodamssal) located in the 5th exon of the ESP2 gene and InDel (ATTCG/G, Hwayeongbyeob/Dodamssal) located in the first intron. developed. In particular, molecular markers based on the SNPs were developed as CAPS markers based on the presence or absence of a recognition site for the restriction enzyme Pvu II.

Molecular marker for genotyping of ESP2 gene base mutation marker name Base sequence (5'→3') order
number Expected size (bp) limit
enzyme Exon 5
4973180 ESP2_5-F ctgctttggagaagttcattga One 108, 46 (Hwayoung)
/154 (Dodam) Pvu II ESP2_5-R gaatggagcttttcagagagc 2 Intron 1
4974161 ESP2_1-F gtgtctaattggataaaccctattc 3 429 (Hwayoung)
/- (Dodam) - ESP2_1-R aaggttggttgcgtcttctggt 4

Example 3. Verification of molecular markers

Using the developed molecular marker (Table 2), the genotype of the ESP2 gene in the offspring and representative rice cultivars derived from the cross combination of Dodam rice and Hwayeong rice was analyzed. Briefly, genomic DNA was extracted from each sample, a PCR reaction was prepared with the composition shown in Table 3 below, and PCR was performed under the conditions shown in Table 4. After that, the products amplified with the ESP2_5-F and ESP2_5-R primer sets were loaded on a 1% agarose gel, purified using a gel extraction kit, and treated with restriction enzymes under the conditions shown in Table 5.

PCR reaction composition Component Volume (μl) 10X PCR buffer 3.0 2.5 mM dNTPs 2.4 Forward primer (10 pmole/μl) 1.0 Reverse primer (10 pmole/μl) 1.0 genomic DNA (50 ng/μL) 1.0 Taq polymerase
(SmartGene Taq Polymerase, Korea) 0.3 D.W. 21.3 Total 30.0

PCR reaction conditions reaction Step Temp. (℃) Time Cycle Pre-denaturation 95 5min reaction denaturation 95 30 seconds 35 annealing 58 40 seconds extension 72 1 min Final-extension 72 10min

Restriction enzyme treatment conditions Volume (μl) Digestion condition PCR product 8.75 3hrs at 37℃
→ 2% agarose gel loading Restriction buffer 1.00 Restriction enzyme 0.25 Total 10.0

As a result, the offspring generation derived from the mating combination of Dodam rice/Hwayoung rice showed the genotype and isotype of Dodam rice, the genotype of Hwayeong rice and the genotype of homozygous and heterozygous ESP2 genotype (Fig. As a result of analyzing the amylose content of the lines showing the genotype, as shown in Table 6 below, it was found that the line showing the ESP2 genotype of Dodam rice showed a higher amylose content, which was the same as the result of FIG. 1.

In addition, genotypes of representative japonica rice cultivars were analyzed using a molecular marker based on InDel located in the first intron of the ESP2 gene. As a result, as shown in FIG. 5, it was found that the genotypes of the ESP2 gene were distinguished. As a result, it was found that the genotype of the ESP2 gene could be determined using the two primer sets of the present invention.

<110> The Industry & Academic Cooperation in Chungnam National University (IAC) <120> Molecular marker for discriminating genotype of ESP2 gene regulating amylose content in rice and uses its <130> PN21094 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> artificial sequence <220> <223> primer <400> 1 ctgctttgga gaagttcatt ga 22 <210> 2 <211> 21 <212> DNA <213> artificial sequence <220> <223> primer <400> 2 gaatggagct tttcagagag c 21 <210> 3 <211> 25 <212> DNA <213> artificial sequence <220> <223> primer <400> 3 gtgtctaatt ggataaaccc tattc 25 <210> 4 <211> 22 <212> DNA <213> artificial sequence <220> <223> primer <400> 4 aaggttggtt gcgtcttctg gt 22

Claims (7)

delete an oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2 and an oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4; And a kit for genotyping the endosperm storage protein 2 ( ESP2 ) gene of rice, comprising reagents for performing an amplification reaction,
The oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2 is a SNP (single nucleotide polymorphism) to determine the genotype,
The oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4 determines the InDel (Insertion/Deletion) polymorphism located in the first intron of the ESP2 gene, which is 5 consecutive bases from the 4974161st base in chromosome 11 of the Nipponbare reference sequence. is to do,
The kit further comprises a Pvu II restriction enzyme, a kit for determining the genotype of the ESP2 gene in rice. delete The kit according to claim 2, wherein reagents for performing the amplification reaction include DNA polymerase, dNTPs, and a buffer. isolating total DNA from a sample of rice stock;
Using the isolated total DNA as a template, PCR (polymerase chain reaction) was performed using the oligonucleotide primer sets of SEQ ID NO: 1 and SEQ ID NO: 2 and the oligonucleotide primer sets of SEQ ID NO: 3 and SEQ ID NO: 4 to obtain a target sequence. amplifying; and
As a genotyping method for the endosperm storage protein 2 ( ESP2 ) gene of rice, comprising the step of digesting the product of the amplification step with Pvu II restriction enzyme and then identifying the cleavage product,
The oligonucleotide primer set of SEQ ID NO: 1 and SEQ ID NO: 2 is the 4973180th base in chromosome 11 of the Nipponbare reference sequence (Os-Nipponbare-Reference-IRGSP-1.0), the 5th exon of the rice ESP2 gene Genotype of SNP is to determine
The oligonucleotide primer set of SEQ ID NO: 3 and SEQ ID NO: 4 is located in the first intron of the ESP2 gene, which is 5 consecutive bases from the 4974161st base in chromosome 11 of the Nipponbare reference sequence. Characterized in determining the InDel polymorphism A method for genotyping the ESP2 gene in rice. delete delete

Images