KR102510016B1 - Molecular marker for discriminating genotype of Chinese cabbage pure line cultivar and uses thereof - Google Patents

Abstract

The present invention relates to a molecular marker for distinguishing genotypes of pure Chinese cabbage varieties and their use. The primer set of the present invention is morphologically similar to common Chinese cabbage, but the intergeneric hybrid is superior to other Chinese cabbage when interbreeding with radish varieties. Since CR291M-64 Chinese cabbage variety, which is well formed, can be efficiently identified, it will be useful for predicting the mating efficiency of intergeneric crosses using CR291M-64 Chinese cabbage variety or for introducing new Chinese cabbage varieties.

Description

Molecular marker for discriminating genotype of Chinese cabbage pure line cultivar and uses thereof}

The present invention relates to molecular markers for distinguishing genotypes of purebred cabbage varieties and uses thereof.

Cross ability indicates the degree of hybridization in a cross between species or breeds, and the higher the cross ability, the better the crossover. Cases of natural or artificial crossbreeding between different species have been reported, and this is known as an important mechanism that can cause the generation of new species. Chinese cabbage ( Bassica campestris var. Pekinensis) and radish ( Raphanus sativus ) show great differences in morphology, and although they belong to different genera and have significant genetic differences, they rarely form hybrids, and the hybrids are stable descendants. It has been developed and commercialized as a 'pear radish' that can have However, when intergeneric crossing between Chinese cabbage and radish occurs, it is common that fertilization itself is not carried out due to a crossover barrier or even if fertilization is made, it does not develop into a normal seed. In this case, normal seeds can be produced even if various radishes are used as the parent, so efficient intergeneric hybrids can be produced. Therefore, research on the mating barriers involved in the formation of intergeneral hybrids and development of new intergeneral hybrids have been attempted for many years to create new genetic resources, but it is difficult to form hybrids and the resulting hybrids do not have fertility. There are difficulties.

On the other hand, Korean Patent Publication No. 2020-0055666 discloses 'a DNA marker capable of distinguishing genotypes of Chinese cabbage, radish and intergeneric hybrids thereof and its use', and Korean Patent No. 1011694 discloses 'a molecular marker using 'Method for identifying Chinese cabbage varieties' is disclosed, but there is no description of molecular markers and their uses for distinguishing genotypes of pure Chinese cabbage varieties of the present invention.

The present invention was derived from the above request, and the present inventors compared the nucleotide sequences of CR291M-64 and Hui M-2, which are purebred Chinese cabbage varieties, to confirm SNP and InDel polymorphisms, and then, using the SNP information, two The sequence of one of the cultivars can be cut with a specific restriction enzyme, and the sequence of the other cultivar is identified as a site that cannot be cut with the restriction enzyme, and a primer set capable of amplifying DNA including the corresponding restriction enzyme site was prepared. After PCR was performed on purebred Chinese cabbage varieties using the primer set prepared above, the amplification product was treated with the restriction enzyme Hind III. By confirming that it can be, the present invention was completed.

In order to solve the above object, the present invention is an oligonucleotide primer set of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; And oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Provides a primer set composition for genotype determination of Chinese cabbage varieties comprising at least one primer set selected from the group consisting of.

In addition, the present invention provides a kit for determining the genotype of Chinese cabbage varieties comprising the primer set composition.

In addition, the present invention isolates the genomic DNA from the Chinese cabbage sample; Amplifying a target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer set composition; And detecting the product of the amplification step; provides a method for determining the genotype of a Chinese cabbage variety including.

The primer set of the present invention can efficiently discriminate the CR291M-64 Chinese cabbage variety, in which intergeneric hybrids are formed much better than other Chinese cabbage varieties, during intergeneric crossing of Chinese cabbage and radish. It is expected to be useful for predicting efficiency or introducing new cabbage varieties.

1 is a PCR result using the CAPS marker of the present invention, A is a purebred Chinese cabbage cultivar CR291M-64 (CR) and Hui M-2 (Hui) and an F ₁ object between the two breeds (BF1); Gel loading result before restriction enzyme treatment of products amplified from purebred radish cultivars KB68M (KB) and Wonyeon25-1M (WY) and F ₁ individual (RF1) samples between the two cultivars, B is purebred Chinese cabbage cultivar CR291M-64 It is a gel loading result after restriction enzyme treatment of the product amplified in (CR) and Hwi M-2 (Hwi) samples.

In order to achieve the object of the present invention, the present invention is an oligonucleotide primer set of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; And oligonucleotide primer sets of SEQ ID NOs: 7 and 8; Provides a primer set composition for genotype determination of Chinese cabbage varieties comprising at least one primer set selected from the group consisting of.

The primer set according to the present invention may be a primer set for Cleaved amplified polymorphic sequences (CAPS). CAPS, also called restriction amplification polymorphism sequence, refers to a polymorphic fragment generated by restriction enzyme treatment of a polymorphic PCR product among individuals. Detection is performed for the purpose of a gene that is known to have differences in nucleotide sequence between breeds in advance, and only the gene concerned is selected and amplified from the genome of the species by the PCR method. In most markers, there is no difference between the length of the amplified gene and the breed, but the sequence inside the gene is different, so a restriction enzyme that recognizes the difference in sequence is selected and processed. It is possible to distinguish between cultivars with DNA cut with restriction enzymes and cultivars with uncut DNA, and the difference in length is easily detected by electrophoresis.

In the primer set composition for genotyping of Chinese cabbage varieties according to an embodiment of the present invention, the four primer sets are capable of amplifying a sequence containing a single nucleotide polymorphism (SNP) base located on the chromosome of pure Chinese cabbage As a primer set (see Table 2), it is characterized by not binding to free genomic DNA.

The primer set composition of the present invention preferably includes one or more primer sets selected from the group consisting of the four primer sets, and includes four primer sets, that is, oligonucleotide primer sets of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; and an oligonucleotide primer set of SEQ ID NOs: 7 and 8. Simultaneous use of four primer sets can more efficiently determine the genotype of Chinese cabbage varieties.

The primers may include oligonucleotides consisting of segments of at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides in the sequences of SEQ ID NOs: 1 to 8, depending on the sequence length of each primer. there is. For example, a primer of SEQ ID NO: 1 (20 oligonucleotides) may comprise an oligonucleotide consisting of a segment of at least 16, at least 17, at least 18 or at least 19 contiguous nucleotides within the sequence of SEQ ID NO: 1 . In addition, the primer may also include added, deleted or substituted sequences of the nucleotide sequences of SEQ ID NOs: 1 to 8.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primers should allow for the synthesis of extension products to begin. The specific length and sequence of the primer will depend on the complexity of the DNA or RNA target required, as well as the conditions of use of the primer, such as temperature and ionic strength.

In this specification, oligonucleotides used as primers may also include nucleotide analogs, such as phosphorothioates, alkylphosphorothioates, or peptide nucleic acids, or Intercalating agents may be included.

The present invention also provides a kit for determining the genotype of Chinese cabbage varieties comprising the primer set composition.

In the kit according to the present invention, the primer set composition comprises oligonucleotide primer sets of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; and oligonucleotide primer sets of SEQ ID NOs: 7 and 8; four primer sets, that is, oligonucleotide primer sets of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; And oligonucleotide primer sets of SEQ ID NOs: 7 and 8; may include all, but are not limited thereto.

The kit according to the present invention may further include reagents for performing the amplification reaction, and the reagents for performing the amplification reaction may include DNA polymerase, dNTPs, buffers, and the like. In addition, the kit according to the present invention may further include a restriction enzyme, and the restriction enzyme may preferably be Hind III. In addition, the kit of the present invention may further include a user guide describing optimal reaction performance conditions. The guide is a printout explaining how to use the kit, eg, how to prepare the PCR buffer, and the reaction conditions to be presented. The guide includes a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

The present invention also

Isolating genomic DNA from cabbage samples;

Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using the primer set composition of the present invention; and

Detecting the product of the amplification step; provides a method for determining the genotype of a Chinese cabbage variety including.

In one embodiment according to the present invention, the primer set composition comprises an oligonucleotide primer set of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; and oligonucleotide primer sets of SEQ ID NOs: 7 and 8; four primer sets, that is, oligonucleotide primer sets of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; And oligonucleotide primer sets of SEQ ID NOs: 7 and 8; may include all, but are not limited thereto.

The method of the present invention includes the step of isolating genomic DNA from a Chinese cabbage sample. A method known in the art may be used as a method for isolating genomic DNA from the cabbage sample, and for example, a CTAB method or a Wizard prep kit (Promega) may be used. A target sequence may be amplified by performing an amplification reaction using the isolated genomic DNA as a template and using a primer set according to an embodiment of the present invention. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In one embodiment of the present invention, the method for determining the genotype of the cabbage variety includes detecting a product of the amplification step, and the detection of the product of the amplification step is DNA chip, gel electrophoresis, capillary electrophoresis, It may be performed through radioactivity measurement, fluorescence measurement or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting amplification products, capillary electrophoresis can be performed. Capillary electrophoresis can use, for example, an ABi Sequencer. In addition, gel electrophoresis can be performed, and for gel electrophoresis, agarose gel electrophoresis or acrylamide gel electrophoresis can be used depending on the size of the amplification product. In addition, in the fluorescence measurement method, when PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactivity measurement method is performed by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution to label the amplification product, and then using a radioactivity measurement instrument, for example, a Geiger counter or liquid scintillation Radioactivity can be measured using a liquid scintillation counter.

In the method according to one embodiment of the present invention, after performing an amplification reaction using the primer set composition to amplify a target sequence, digesting the product of the amplification step with restriction enzyme Hind III; And electrophoresis of the products of the restriction enzyme digestion step to separate the products by size; may further include, but is not limited thereto.

In the present invention, the term "restriction enzyme" refers to a special enzyme as an endonuclease that identifies a specific nucleotide sequence of DNA and cuts a double chain. In a specific embodiment of the present invention, PCR was performed based on the selected primer set, purified with a PCR purification kit, and treated at an active temperature using a restriction enzyme in combination with a primer.

In the method for determining the genotype of Chinese cabbage varieties according to an embodiment of the present invention, the oligonucleotide primer set of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; And oligonucleotide primer sets of SEQ ID NOs: 7 and 8; When the amplification product amplified by at least one primer set selected from the group consisting of is cleaved by restriction enzyme Hind III treatment, it can be identified as Chinese cabbage variety CR291M-64, or When the amplification products amplified by the oligonucleotide primer sets of SEQ ID NOs: 3 and 4 are cleaved by restriction enzyme Hind III treatment, the Chinese cabbage variety Hui M-2 can be identified.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Development of molecular markers

Using the SNP information between the nucleotide sequences of CR291M-64 and Hui M-2 (provided by the Biobreeding Institute), the sequence of one of the two varieties can be cut using a specific restriction enzyme, and the sequence of the other variety identified a site that could not be cut with the corresponding restriction enzyme and prepared a PCR primer capable of amplifying DNA to include the site. In addition, the primer set of the present invention made based on the nucleotide sequence of Chinese cabbage allows to search for a region that is not amplified in the free DNA, so that the marker can be amplified specifically for the subgenome. Through this, using the SNP information, it was possible to determine which region of the chromosome the marker was targeting, to identify the subgenome, and to determine the genotype of the Chinese cabbage cultivar used as a model.

Specifically, in order to confirm the polymorphism between CR291M-64 and WhiM-2 nucleotide sequences, the nucleotide sequences of CR291M-64 and Hui M-2 were used in the standard genome (Chiifu-401-42; http://brassicadb.cn/) After mapping to the nucleotide sequence, polymorphisms such as SNP (single nucleotide polymorphism) and InDel (insertion/deletion) were analyzed using the GATK (genome analysis toolkit) program. Among them, using the SNP information, the sequence of one of the two breeds can be cut using a specific restriction enzyme, and the sequence of the other breed is searched for a region that is not cut with the restriction enzyme, and a specific length including this region PCR primers capable of amplifying the DNA sequence were selected using the Primer3 program, and then those specific to the target site were selected using BLAST (Basic Local Alignment Search Tool). The target site is selected as a site capable of distinguishing a variety, and means excluding those that can target sites other than the corresponding site on the genome.

PCR was performed using the genomic DNA of the purebred Chinese cabbage cultivars 'CR291M-64 and Hui M-2' as templates with the selected primers, and CAPS (cleaved amplified polymorphic sequence) analysis was performed by treating with restriction enzymes, and the Chinese cabbage genome While being specifically amplified, primers capable of specifically distinguishing CR291M-64 and Hui M-2, which are purebred Chinese cabbage cultivars, were selected as markers. Through the above process, SNPs between CR291M-64 and Hui M-2, which are purebred Chinese cabbage varieties, and CAPS marker information based thereon are shown in Table 1 and Table 2, respectively.

SNP information of the present invention marker chromosome location genotype CR291M-64 Hui M-2 Marker 4 A04 786,825 T A Marker 6 A06 11,171,789 C T Marker 8 A08 11,076,011 G C Marker 10 A10 13,705,815 T C

CAPS marker information of the present invention primer
designation Sequence (5'→3') (SEQ ID NO) Tm(℃) Expected size (bp) limit
enzyme Genotype 1 Genotype 2 Marker 4-F ACATCTCCCCTCGTGTTTCG (1) 59.8 1,351
(971/380) 1,351 Hind III Marker 4-R TCGCTTGTCTGGACAGTGTC (2) 60 Marker 6-F ACACATATTGGACCAGCCCC (3) 60 902 902
(617/285) Marker 6-R AGCTCAGACACTAGTTAAGCC (4) 57.8 Marker 8-F ACTTTCTAGTGCCGGTCCTG (5) 59.3 874
(526/348) 874 Marker 8-R GTACGTCAGATGTCCAATCGC (6) 59.1 Marker 10-F AGGTTGGCCAGACGTTATGG (7) 60 692
(533/159) 692 Marker 10-R CTTCTGGTGAAACACGCAGC (8) 60

Example 1. Identification of Purebred Chinese Cabbage Varieties Using CAPS Markers of the Present Invention

F ₁ (BF1) between purebred Chinese cabbage cultivars CR291M-64 (CR) and Hui M-2 (Hui) and the two cultivars using the primer set of Table 2; As a result of PCR on purebred radish cultivars KB68M (KB) and Wonyeon 25-1M (WY) and F ₁ (RF1) between the two cultivars, the primer sets of the present invention are all specifically amplified in Chinese cabbage cultivars, It was confirmed that it was not amplified in radish varieties (FIG. 1A). That is, it was expected that the primer set of the present invention, prepared based on the Chinese cabbage nucleotide sequence, could be used for subgenome discrimination between Chinese cabbage and radish genera.

In addition, PCR was performed on purebred Chinese cabbage varieties using the primer set of the present invention, and then the amplification product was treated with restriction enzyme Hind III to confirm the CAPS marker cleavage fragment. As a result, in the case of Markers 4, 8 and 10, CR291M The amplification product of 64 was cleaved with a restriction enzyme and two bands were detected, but the amplification product of Hui M-2 did not have a restriction enzyme recognition site, so only a single band was detected. In addition, in the case of Marker 6, the amplification product of CR291M-64 was not cleaved and a single band was detected, but the amplification product of Hui M-2 was cleaved by a restriction enzyme and two bands were detected (Fig. 1B).

That is, the CAPS marker of the present invention is a marker based on the SNP between CR291M-64, a purebred Chinese cabbage cultivar, and Hui M-2 without amplification in the genomic DNA of radish, and PCR is performed using the primer set in Table 2 and then restricted. It was manufactured to distinguish the genotype of Chinese cabbage varieties through the band cutting pattern by treating the enzyme Hind Ⅲ.

The Chinese cabbage CR291M-64 variety to be identified with the CAPS marker of the present invention is a homozygous Chinese cabbage variety developed through small cell culture and has morphological characteristics similar to those of general Chinese cabbage. It is a special variety with a high rate of normal seed development, unlike other crossbreeding combinations that lead to seed death due to problems in the seed development process. Therefore, since the CAPS marker of the present invention can accurately distinguish CR291M-64 Chinese cabbage varieties from other Chinese cabbage varieties, it is possible to discriminate the genotype of CR291M-64 varieties and other Chinese cabbage varieties within a low cost and efficient time, and CR291M-64 varieties It was expected that it could be usefully used to predict the mating efficiency of intergeneric crosses using .

<110> Seoul National University R&DB Foundation <120> Molecular marker for discriminating genotype of Chinese cabbage pure line cultivar and uses its <130> PN21152 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 1 acatctcccc tcgtgtttcg 20 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 2 tcgcttgtct ggacagtgtc 20 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 3 acacatattg gaccagcccc 20 <210> 4 <211> 22 <212> DNA <213> artificial sequence <220> <223> primer <400> 4 agctcagaca actagttaag cc 22 <210> 5 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 5 actttctagt gccggtcctg 20 <210> 6 <211> 21 <212> DNA <213> artificial sequence <220> <223> primer <400> 6 gtacgtcaga tgtccaatcg c 21 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 7 aggttggcca gacgttatgg 20 <210> 8 <211> 20 <212> DNA <213> artificial sequence <220> <223> primer <400> 8 cttctggtga aacacgcagc 20

Claims (8)

delete delete oligonucleotide primer sets of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; And oligonucleotide primer sets of SEQ ID NOs: 7 and 8; A kit for genotyping CR291M-64 and Hui M-2 cultivars comprising at least one primer set selected from the group consisting of and restriction enzyme Hind III. delete Isolating genomic DNA from cabbage samples;
Using the isolated genomic DNA as a template, an oligonucleotide primer set of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 3 and 4; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; and oligonucleotide primer sets of SEQ ID NOs: 7 and 8; amplifying a target sequence by performing an amplification reaction using one or more primer sets selected from the group consisting of;
Digesting the product of the amplification step with restriction enzyme Hind III; and
Method for determining the genotype of CR291M-64 and Hui M-2 varieties, including; electrophoresis of the product of the restriction enzyme digestion step to separate the cutting product by size. delete delete The method of claim 5, wherein the method comprises an oligonucleotide primer set of SEQ ID NOs: 1 and 2; oligonucleotide primer sets of SEQ ID NOs: 5 and 6; Oligonucleotide primer sets of SEQ ID NOs: 7 and 8; When the amplification product amplified by the oligonucleotide primer set of 4 is cleaved by restriction enzyme Hind Ⅲ treatment, it is characterized in that it is identified as Chinese cabbage variety Hui M-2, which distinguishes the genotype of CR291M-64 and Hui M-2 varieties method.

Images