KR101905458B1 - CAPS markers for discriminating of apple cultivars and uses thereof - Google Patents

Abstract

The present invention relates to CAPS markers for discriminating apple cultivars and to uses thereof, wherein the CAPS markers derived from single nucleotide polymorphism (SNP) selected through a genotyping-by-sequencing (GBS) technique exhibit accurate polymorphism for eight apple cultivars of Fuji, Gala, Golden delicious, Earlyblaze, Hongo, Kent, Aikanokaori and Jonahgold, and thus the eight kinds of apple cultivars can be effectively discriminated and can be applied very usefully in molecular breeding research and apple breeding industry of the apple cultivars.

Description

CAPS markers for discriminating apple varieties and their uses

The present invention relates to CAPS markers for discriminating apple cultivars and their uses.

Apples ( Malus × domestica Borkh.) Like other fruit trees, it is a perennial crop. It takes a long time from seed to the time of flowering and fruiting. It is not only homogenous but also self-incompatibility. In addition, the sleep surface area is relatively large, so that the breeding period is very long, which is laborious and costly. 18 varieties of apple varieties have been developed from the 'Hongro' variety in 1988 to the National Institute of Horticultural Science. Generally, domestic cultivated cultivars are supplied as seedlings which are not cultivated both for domestic use and for export, so it is almost impossible to discriminate cultivar type morphologically. In addition, the newly cultivated cultivars often use the existing cultivars as parents, so they are closely related to each other genetically, so it is more difficult to distinguish cultivars by only morphological traits. Since DNA markers can easily and accurately discriminate cultivars by using DNA extracted without examination of morphological traits such as tree branches or leaves or fruits, it is possible to prevent the inclusion of varieties in distribution seedlings and to protect breeder rights It is also very helpful. In addition, since the DNA marker inherently reflects the genetic characteristics of the breed, it is highly susceptible to environmental influences, and thus is highly useful in replacing and complementing phenotypic characteristics.

To date, various DNA markers such as RAPD (amplified polymorphic DNA), AFLP (amplified fragment length polymorphism), SSR (simple sequence repeats) and ISSR (inter simple sequence repeats) have been reported. The RAPD and AFLP methods have disadvantages such as reproducibility problems and time consuming and costly analysis. SSR markers have high stability due to their commonality, they are effective for sorting of cultivars, but they are expensive to develop markers.

Cleaved amplified polymorphic sequences (CAPS), also called restriction amplification polymorphism sequences, are breed identification methods that detect sequence differences by restriction enzyme treatment. Detection is carried out in advance for the purpose of a gene which knows that there is a difference in nucleotide sequence among varieties. Only the gene of the genome of the species is selected by PCR method and amplified. In most markers, there is no difference between the length of the amplified gene and the breed. However, since the internal sequence of the gene is different, restriction enzymes recognizing the sequence difference are selected and processed. It is possible to distinguish the difference between the varieties carrying the restriction enzyme-digested DNA and the varieties having the DNA not digested, and the difference in length is easily detected by electrophoresis.

Korean Patent Laid-Open Publication No. 2011-0074204 discloses a SCAR label for identification of an apple and a use thereof, and Korean Patent No. 1291609 discloses a chloroplast CAPS marker for rice species classification. However, the CAPS markers for distinguishing apple cultivars of the present invention and their uses have not yet been disclosed.

The present invention has been made in view of the above-described needs, and it is an object of the present invention to provide a method for producing a variety of apple cultivars, which comprises 11 kinds of apple cultivars, namely, Fuji, Gala, Golden Delicious, Early Blaze, Hongo, Soap 2, Soap 3, Macintosh, Kent, CAPS markers were constructed based on single nucleotide polymorphism (SNP) based on genotyping-by-sequencing (GBS) -based sequence data of Jona gold varieties, and the CAPS markers were constructed using Fuji, Gala, Golden Delicious, Early Blaze, Hong, Kent, Aikano kaori, and Jonah gold apple cultivars.

In order to solve the above problems, the present invention provides a primer set of SEQ ID NOs: 1 and 2, a primer set of SEQ ID NOs: 3 and 4, a primer set of SEQ ID NOs: 5 and 6, a primer set of SEQ ID NOs: 7 and 8, A primer set for discriminating apple cultivars containing a primer set of 10 is provided.

Further, the present invention provides a primer set comprising: the primer set; A reagent for carrying out an amplification reaction; And a kit for identifying an apple variety including a restriction enzyme.

In addition, the present invention provides a method for isolating genomic DNA comprising: isolating genomic DNA from an apple sample; Amplifying the target sequence by using the separated genomic DNA as a template and performing an amplification reaction using the primer set; Cleaving the amplification product with a restriction enzyme; And separating the cleavage products by size by electrophoresis of the cleavage products.

CAPS markers derived from single nucleotide polymorphism (SNP) selected through the GBS (genotyping-by-sequencing) technology of the present invention are commercially available from Fuji, Gala, Golden Delicious, Early Blaze, Hongo, Kent, Aikano Kaori, It is possible to effectively discriminate the eight kinds of apple varieties, and can be applied very usefully in the molecular breeding research and apple breeding industry of apple varieties.

FIG. 1 shows genotyping-by-sequencing (GBS) -based sequence data of Fuji, Gala, Golden Delicious, Early Blaze, Hongo, Soap 2, Soap 3, Macintosh, Kent, Aikano Kaori and Zona gold apple varieties (A and B) showing SNP polymorphism at recognition site of restriction enzyme Eco RI (GAATTC). According to the International Union of Pure and Applied Chemistry (IUPAC) codes of the SNP, R is an adenine or guanine, A is an adenine, G is guanine, K is guanine or thymine, T is thymine, Is possible.
FIG. 2 shows genotyping-by-sequencing (GBS) -based sequence data of Fuji, Gala, Golden Delicious, Early Blaze, Hongo, SoBa No. 2, SoBa No. 3, Macintosh, Kent, Aikano Kaori and Jona gold apple varieties And the polymorphism of SNP at the recognition site of Hin dIII restriction enzyme (AAGCTT). According to the IUPAC code of the SNP, S means cytosine or guanine, C means cytosine, G means guanine, and N means that the presence of all nucleotide sequences is possible due to the error in the nucleotide sequence decoding.
FIG. 3 shows genotyping-by-sequencing (GBS) -based sequence data of Fuji, Gala, Golden Delicious, Early Blaze, Hongo, Soap 2, Soap 3, Macintosh, Kent, Aikano Kaori and Jona gold apple varieties (A and B) showing the polymorphism of the SNP generated at the recognition site of the Eco RV restriction enzyme (GATATC). According to the IUPAC code of the SNP, M means cytosine or adenine, C means cytosine, A means adenine, and N means the possibility of existence of all nucleotide sequences due to the error of base sequence decoding, and n means Null.
Figure 4 using a primer set (EcoRⅠ_R1) with restriction enzymes Eco RⅠ consisting of SEQ ID NO: 1 and SEQ ID NO: 2 of the present invention Fuji (A1), split (A2), Golden Delicious (A3), early blazed (A4), The polymorphisms of the cut fragments of the A5, A5, A6, A7, A8, A9, A10 and A11 varieties were analyzed by capillary digital It was confirmed through the gel. H12 is a DNA ladder of 100 bp.
5 is a primer set Fuji (B1) using the (EcoRⅠ_K3) with restriction enzymes Eco RⅠ, Gala (B2), Golden Delicious (B3), early blazed (B4) consisting of SEQ ID NO: 3 and SEQ ID NO: 4 of the present invention, The polymorphisms of the cut fragments of the Bronchromae B5, B6, B7, B8, B9, A10, and B11 were analyzed by capillary digital It was confirmed through the gel. H12 is a DNA ladder of 100 bp.
Figure 6 using the primer set (Hin dⅢ_S3) with restriction enzymes Hin dⅢ consisting of SEQ ID NO: 5 and SEQ ID NO: 6 of the present invention Fuji (C1), split (C2), Golden Delicious (C3), early blazed (C4) Polymorphism of truncated fragments of C5, C5, C5, C6, C7, C8, C9, A10 and C11 varieties was determined using a capillary It was confirmed through digital gel. H12 is a DNA ladder of 100 bp.
7 is using the primer set (EcoRⅤ_M3) with restriction enzymes Eco RⅤ consisting of SEQ ID NO: 7 and SEQ ID NO: 8 of the present invention Fuji (D1), split (D2), Golden Delicious (D3), early blazed (D4), The polymorphisms of the cut fragments of the Hongo (D5), Dowley 2 (D6), Dowley 3 (D7), Macintosh (D8), Kent (D9), Aikano Kaori (D10) It was confirmed through the gel. H12 is a DNA ladder of 100 bp.
FIG. 8 is a graph showing the relationship between the primer set (EcoRV_M4) consisting of SEQ ID NO: 9 and SEQ ID NO: 10 of the present invention and the restriction enzymes Eco RV of Fuji (E1), Gala (E2), Golden Delicious (E3), Early Blaze The polymorphisms of the cut fragments of E5, E6, E7, E8, E9, E10 and E11 varieties were analyzed by capillary digital It was confirmed through the gel. H12 is a DNA ladder of 100 bp.

In order to achieve the object of the present invention, the present invention provides a primer set of SEQ ID NOs: 1 and 2, a primer set of SEQ ID NOs: 3 and 4, a primer set of SEQ ID NOs: 5 and 6, a primer set of SEQ ID NOs: A primer set for discriminating apple cultivars containing primer sets of 9 and 10 is provided.

The primer is an oligonucleotide having the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: Substituted sequences may also be included.

As used herein, the term "primer " refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

In the primer set of the present invention, the nucleotide sequences shown in SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 are nucleotide sequences of the marker for discriminating apple cultivars . The odd-numbered sequences all represent forward primers, and the even-numbered sequences represent reverse primers.

The five primer sets are combined to be used as markers for discriminating apple cultivars. The size of the PCR product obtained using the primers is designed to be about 450 to 550 bp. The apple cultivar may be at least one selected from the group consisting of Fuji, Gala, Golden Delicious, Early Blaze, Hongo, Kent, Aikano kaori, and Zona gold.

Further, the present invention provides a primer set comprising: the primer set; A reagent for carrying out an amplification reaction; And a kit for identifying an apple variety including a restriction enzyme. The restriction enzymes may be EcoRI , HindIII and EcoRV .

In the kit of the present invention, the reagent for carrying out the amplification reaction may include DNA polymerase, dNTPs, buffer, and the like. In addition, the kit of the present invention may further include a user guide describing optimal reaction performing conditions. The manual is a printed document that explains how to use the kit, for example, how to prepare PCR buffer, the reaction conditions presented, and so on. The manual includes instructions on the surface of the package including a brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

In addition,

Isolating the genomic DNA from the apple sample;

Amplifying the target sequence by using the separated genomic DNA as a template and performing an amplification reaction using the primer set;

Cleaving the amplification product with a restriction enzyme; And

And detecting the cleavage product by electrophoresis of the cleavage product.

The method of the present invention comprises isolating genomic DNA from an apple sample. Methods for isolating genomic DNA from the sample can be performed by methods known in the art, and the method is not particularly limited.

As used herein, the term "restriction enzyme" refers to a special enzyme as an endonuclease that identifies a specific base sequence of DNA and cleaves double chains. In a specific embodiment of the present invention, PCR was performed on the basis of the selected primer set, purified with a PCR purification kit, and then treated within the active temperature using a restriction enzyme in combination with the primer.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not limited thereto.

Materials and methods

1. Apples gDNA  extraction

Leafs were collected from apple varieties Fuji, Gala, Golden Delicious, Early Blaze, Hongo, Soba no. 2, Soba no. 3, Macintosh, Kent, Aikano Kaori and 11 species of Jona gold. After washing with distilled water, Packed and stored at -80 ° C. To extract gDNA (genomic DNA), a QIAquick gel extraction kit (Qiagen, Germany) was used. The young leaves of the apple tree were placed in a mortar bowl filled with liquid nitrogen, cooled, and transferred to a tube. 400 μl of AP1 buffer and 4 μl of RNase were added to the tube, mixed, and incubated at 65 ° C in a constant temperature water bath Lt; / RTI > for 10 minutes. 130 μl of P3 (Neutralization buffer, 3.0 M potassium acetate pH 5.5) was added to the lysate, and the mixture was reacted for 5 minutes on ice. Then, the lysate was centrifuged at 14,000 rpm for 5 minutes at 4 ° C. Of the lysate was transferred to a QIAshredder mini-spin column in a 2 ml tube and centrifuged at 14,000 rpm for 2 min at 4 < 0 > C. After adding 675 μl of AW1 buffer and mixing, 650 μl of the mixture was transferred to a DNeasy minispin column and centrifuged at 8,000 rpm for 1 minute at 4 ° C. The remaining 485 μl of the mixture was transferred to a DNeasy minispin column Followed by centrifugation at 8,000 rpm for 1 minute at 4 < 0 > C. 500 [mu] l of AW2 buffer was added and centrifuged at 8,000 rpm for 1 minute at 4 [deg.] C. The precipitate was discarded and 500 [mu] l AW2 buffer was added and centrifuged at 14,000 rpm for 2 minutes at 4 [ Thereafter, the remaining precipitate in the tube was discarded, the column was dried for 25 minutes, the column was transferred to a 1.5 mL microcentrifuge tube, and 50 A of AE buffer was dispensed. The cells were stored at room temperature for 5 minutes and centrifuged at 8,000 rpm for 1 minute at 4 ° C.

2. GBS  SNP development and analysis using technology

For the sequencing and genotyping by genotyping by sequencing (GBS) technique, a library for GBS was prepared from the DNAs of 11 apple cultivars as shown in Table 1 below (Elshire et al., 2011 , PloS one, 6 (5): e19379), and the library was sequenced according to the standard protocol of Illumina Hiseq 2000 instrument. The genome sequence of Golden Delicious (Velasco et al., 2010, Nat. Genet. 42: 833) varieties was used for bioinformation analysis. genome sequence) was used as a reference genome. For single nucleotide polymorphism (SNP) searches, a large number of SNPs predicted by polymorphism in the reference genome are "biallelic SNPs, missing rates of less than 10%, and minor alleles frequency is greater than 5% ".

List of apple varieties used in the present invention kind Korean name  Parentage Fuji Fuji Ralls Genet x Red Delicious Gala Gala Kidd's Orange Red x Golden delicious Golden Delicious Golden Delicious Grimes Golden x Unknown Earliblaze Early Blaze unknown Hongro Hongo Spur Earliblaze x Spur Golden delicious Sobaek No.2 Soba no. 2 Mutation of Hongro Sobaek No.3 Soba no. 3 Mutation of Fuji Mcintosh macintosh missing rateFameuse x Detroit Kent Kent Cox's Orange Pippin x Jonathan Aikanokaori Aikano Kaori Chance seedling of Fuji Jonagold Jonah Gold Golden Delicious × Jonathan

3. GBS  Based SNP derived CAPS Marker  For conversion PCR  Perform

Five markers with high depth and polymorphic information content (PIC) were selected from the GBS-based sequence data of the 11 apple varieties. The selected SNPs were 450 ~ 550bp in size The primer information was prepared as shown in Table 2 below.

The primers and restriction enzymes used in the present invention primer The base sequence (5'-3 ') Tm (占 폚) Expected size Restriction enzyme EcoR1_R1 F: CCTGAGCTGCCAAGGAATAG
(SEQ ID NO: 1) 58 506 Eco RI R: TCACAAGATCGCAAGATTGG
(SEQ ID NO: 2) EcoR1_K3 F: TGGGGTTTGATTCCTCTCAG
(SEQ ID NO: 3) 59 470 Eco RI R: TGGCAAAGCTGTGTTGGTTA
(SEQ ID NO: 4) HindIII_S3 F: AAAGGGAACTCCAACATCCA
(SEQ ID NO: 5) 60.6 492 Hin dIII R: GACTTCATGGCAATTGAAGATTA
(SEQ ID NO: 6) EcoRV_M3 F: TGATAGCCTGGTTTCTATTTGTG
(SEQ ID NO: 7) 60.6 479 Eco RV R: TGGTTGGGCAATAGATTAGGA
(SEQ ID NO: 8) EcoRV_M4 F: AAAAAGTGGGCTCGGAGCTA
(SEQ ID NO: 9) 60.6 480 Eco RV R: TTAGGCTTCCGAAACTTCATTA
(SEQ ID NO: 10)

The PCR mixture was prepared by adding 6 μl of gDNA of the extracted apple cultivar (11 species), 20 μl of 2 × Hot Taq polymerase (GeNetbio, Korea), 8 μl of primer set (4 μl each of forward sequence and reverse sequence) and 6 μl of distilled water To prepare a total of 40 μl of the PCR reaction mixture. PCR was carried out at 94 ° C for 5 minutes, followed by 30 seconds at 94 ° C, 45 seconds of annealing at the melting temperature (Tm) shown in Table 2, 30 seconds at 72 ° C 35 times PCR was repeatedly performed, and finally, extension at 72 ° C for 7 minutes.

4. GBS  Based SNP derived CAPS Marker  For conversion PCR  refine

After the PCR reaction, the PCR product was removed using PCR purification kit (Bioneer, Korea) to increase the activity of the restriction enzyme. Specifically, 40 μl of the PCR product was mixed with 200 μl of a primary buffer (PCR binding buffer), and 240 μl of the mixture was placed in a DNA binding column tube and centrifuged at 13,000 rpm for 1 minute at 4 ° C. Subsequently, the tube was replaced with a 2.0-ml tube, 500 μl of the secondary solution was dispensed, and centrifugation was further performed at 13,000 rpm for 1 minute at 4 ° C. Then, it was dried at room temperature for 5 minutes, centrifuged at 13,000 rpm for 1 minute at 4 ° C, and 30 μl of the tertiary solution was placed in a DNA binding filter column and allowed to stand for 4 minutes and then incubated at 13,000 rpm Gt; min. ≪ / RTI >

5. GBS  Based SNP derived CAPS Marker  Restriction enzyme treatment for conversion

21 [mu] l of the purified PCR product, restriction enzymes Eco RI and Eco RV (NEB, England) and 2.5 占 퐇 of 10X enzyme buffer (Enzyme Buffer) was treated at 37 占 폚 for 4 hours. Further, 25 μl of the reaction solution containing 21 μl of purified PCR product, 1.5 μl of restriction enzyme Hin dIII (NEB, England) and 2.5 μl of 10 × enzyme buffer (Enzyme Buffer) was treated at 37 ° C. for 1 hour.

6. Capillary electrophoresis

Capillary electrophoresis was performed using a fragment analyzer (Advanced Analytical, Inc., Ames, USA) to confirm the polymorphism of cleaved fragments of the transformed CAPS markers. For analyzing the fragments, a gel was prepared by adding an intercalating dye to a dsDNA 905 separation gel. To the PCR product digested with restriction enzymes, 5 μl of TE (Tris-EDTA) buffer was added Lt; / RTI > Thereafter, capillary electrophoresis was performed on the fragment analyzer.

Example  One. GBS  Based SNP derived CAPS Marker  Verification

In this Example 1, genotyping-by-sequencing (GBS) of 11 kinds of apple varieties of Fuji, Gala, Golden Delicious, Early Blaze, Hongo, Soba 2, Soap 3, Macintosh, Kent, Aikano Kaori and Zona gold It was confirmed that SNP polymorphisms appeared at recognition sites of SNP base sequences and restriction enzymes ( EcoR I , HindIII and EcoR V ) through the nucleotide sequence data (FIGS. 1 to 3), and the CAPS markers of the present invention were used Capillary electrophoresis showed that the polymorphic band of the cleavage fragment was shown between Fuji, Gala, Golden Delicious, Early Blaze, Hongo, Kent, Aikano kaori and Jona gold varieties as shown in Figs. 4 to 8 .

Specifically, as shown in Table 3, the 11 kinds of apple cultivars were classified into two groups through the EcoR I_R1 marker, and the varieties consisting of one fragment were Fuji, Early Blaze, SoBa 2, SoBa 3, And Kent varieties. The three fragments consisted of Gala, Golden Delicious, Hongo, Aikano Kaori, and Jona gold varieties, and were classified into three groups by EcoR I K3 marker. 2, Sobaek 3, Macintosh and Kent varieties. The two fragments consisted of Golden Delicious, Aikano Kaori and Jonah Gold varieties, and three fragments were identified as Fuji, Gala and Early Blaze varieties. In addition, the varieties classified into two groups by the HindIII-S3 markers were Fuji, Golden Delicious, Early Blaze, Hongo, Aikano Kaori and Jona gold varieties. 2, 3, and 3 were classified as two groups by EcoRV_M3 marker, and one fragment was classified as Gala, Golden Delicious, Early Blaze, Hongo, Soba 2, Soba 3 , Macintosh and Kent varieties, and the three fragmented varieties were identified as Fuji, Aikano kaori and Jona gold varieties. In addition, it was classified into three groups through EcoRV_M4 markers, and the one with the one fragment was the Aikano kaori varieties and the two varieties consisted of the Gala, Golden Delicious, Hongo, Soba 2, Soba 3 and And the three-piece varieties were identified as Fuji, Early Blaze, Kent and Jonah Gold varieties.

In conclusion, it was confirmed that the combination of five CAPS markers of the present invention can discriminate eight kinds of apple varieties of Fuji, Gala, Golden Delicious, Early Blaze, Hongo, Kent, Aikano kaori and Jona gold. That is, the fuji cultivars are EcoR I_R1, HindIII_S3 and The GALA varieties were classified by the combination of EcoR I_R1 and EcoR I_K3 CAPS markers, and the Golden Delicious varieties were classified by the combination of EcoR I_R1, EcoR I_K3 and EcoR V_M3 CAPS markers. In addition, Early Blaze varieties are Eco RI_R1, HindIII_S3 and The cultivars were classified by the combination of EcoR I_R1, EcoR I_K3 and EcoR I_K CAPS markers. The Hong Kong varieties were classified by the combination of EcoR I_R1 and EcoR I_K3 CAPS markers. EcoRV_M4 CAPS markers, and JOANA gold varieties could be classified by the combination of EcoR1_R1, EcoR1_K3, EcoRV_M3 and EcoRV_M4 CAPS markers.

The fragment configuration and size (bp) of 11 kinds of apple varieties using the CAPS marker of the present invention, EcoR1_R1 EcoR1_K3 HindIII_S3 EcoRV_M3 EcoRV_M4 Fuji 521 481/298/180 503 495/281/206 490/286/198 Gala 531/292/226 481/298/180 501/299/201 492 285/198 Golden Delicious 530/292/226 297/180 501 492 285/198 Early Blaze 525 481/298/180 502 495 492/285/198 Hongo 531/293/227 480 501 492 284/198 Soba no. 2 526 479 500/284/199 495 284/197 Soba no. 3 527 480 500/283/198 491 285/198 macintosh 525 480 498/298/199 492 286/197 Kent 525 479 507/307/205 491 491/285/198 Aikano Kaori 531/291/225 297/179 499 496/280/206 490 Jonah Gold 529/292/225 297/180 500 495/281/206 492/286/198

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> CAPS markers for discriminating of apple cultivars and uses          the <130> PN17201 <160> 10 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 cctgagctgc caaggaatag 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 tcacaagatc gcaagattgg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 tggggtttga ttcctctcag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 tggcaaagct gtgttggtta 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 aaagggaact ccaacatcca 20 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gacttcatgg caattgaaga tta 23 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 tgatagcctg gtttctattt gtg 23 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tggttgggca atagattagg a 21 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 aaaaagtggg ctcggagcta 20 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 ttaggcttcc gaaacttcat ta 22

Claims (5)

A primer set of SEQ ID NOs: 1 and 2, a primer set of SEQ ID NOs: 3 and 4, a primer set of SEQ ID NOs: 5 and 6, a primer set of SEQ ID NOs: 7 and 8, and a primer set of SEQ ID NOs: One or more selected from the group consisting of Gala, Golden delicious, Earliblaze, Hongro, Kent, Aikanokaori and Jonagold. A set of primers to identify apple varieties. delete A primer set according to claim 1; A reagent for carrying out an amplification reaction; Gina, Golden delicious, Earliblaze, Hongro, Kent, Aikanokaori, and Jonagold, including restriction enzymes, &Lt; RTI ID = 0.0 &gt; 1). &Lt; / RTI &gt; The method according to claim 3, wherein the reagent for carrying out the amplification reaction comprises DNA polymerase, dNTPs and a buffer, which are selected from the group consisting of Fuji, Gala, Golden delicious, Earliblaze ), Hongro, Kent, Aikanokaori, and Jonagold. &Lt; RTI ID = 0.0 &gt; 1. &lt; / RTI &gt; Isolating the genomic DNA from the apple sample;
Amplifying the target sequence by performing amplification reaction using the separated genomic DNA as a template and using the primer set according to claim 1;
Cleaving the amplification product with a restriction enzyme; And
Gula, Golden delicious, Earliblaze, Hongro, Kent, and the like, which include electrophoresing the cleavage products and separating cleaved products by size, , Aikanokaori, and Jonagold. &Lt; RTI ID = 0.0 &gt; 11. &lt; / RTI &gt;

Images